Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2021 Nov 18.
Published in final edited form as: Taxon Rep Int Lepid Surv. 2021 Oct 29;9:7. doi: 10.5281/zenodo.5622602

Two new species of Hermeuptychia from North America and three neotype designations (Nymphalidae: Satyrinae)

Qian Cong 2,4, Eduardo P Barbosa 5, Mario A Marín 5, André V L Freitas 5, Gerardo Lamas 6, Nick V Grishin 1,2,3,*
PMCID: PMC8601677  NIHMSID: NIHMS1755031  PMID: 34806023

Abstract

Two new species of Hermeuptychia Forster, 1964 are described. Hermeuptychia sinuosa Grishin, sp. n. (type locality Guatemala: El Progreso, Morazán) is an isolated member of the genus that does not readily fit into known species groups, as suggested by its distinct male and female genitalia and COI DNA barcode sequences. It is distinguished from its congeners by prominently wavy submarginal lines, rounder wings and distinctive genitalia, and can typically be identified by a white dot, instead of an eyespot, near the ventral hindwing apex. Hermeuptychia occidentalis Grishin, sp. n. (type locality Mexico: Guerrero, Acapulco) belongs to the Hermeuptychia sosybius group as indicated by the presence of androconia on the dorsal surface of the wings, genitalia and COI DNA barcodes, and in addition to DNA characters, differs from its relatives in the shape of the uncus and female genitalia. Neotypes of Oreas strigata canthe Hübner, [1811] (type locality Suriname: Gelderland, Suriname River), Megisto acmenis Hübner, 1823 (type locality Argentina: Buenos Aires), and Satyrus cantheus Godart, [1824] (type locality USA: Florida, Pinellas Co., St. Petersburg) and lectotype of Euptychia celmis var. bonaërensis [sic] Burmeister, 1878 (type locality Argentina: Buenos Aires) are designated. These designations establish Hermeuptychia canthe as a valid species widely distributed in South America from Colombia to Bolivia and Southeast Brazil, Euptychia celmis var. bonaërensis [sic] Burmeister, 1878 as a junior objective synonym of Yphthimoides acmenis, and S. cantheus as a junior subjective synonym of Hermeuptychia sosybius (Fabricius, 1793). Papilio camerta Cramer, 1780 is treated as nomen dubium requiring further studies to determine an identity that is consistent with the original description, as it may be conspecific with Paryphthimoides poltys (Prittwitz, 1865) instead of being a Hermeuptychia species as currently assumed.

Keywords: biodiversity, cryptic species, Neotropical, Mesoamerica, satyrines, female genitalia


The Neotropical genus Hermeuptychia was erected by Forster (1964) on the basis of male genitalia characters to unite a group of relatives hardly identifiable by highly variable wing patterns, but distinct in male genitalia. Lamas (2004) recognized eight named species of Hermeuptychia and suggested the existence of several unnamed species in Colombia and Peru. One of these species has been described since (Nakahara et al. 2017). Subsequently, Euptychia undulata Butler, 1867 has been transferred to Hermeuptychia (Zacca et al. 2021).

DNA-based studies rationalized from the perspective of morphology revealed extensive cryptic species diversity in Hermeuptychia (Seraphim et al. 2014; Tan et al. 2021), with two new species named from the United States (Cong and Grishin 2014). The major challenge is to associate biological species delineated with a significant contribution from DNA sequences (Cong and Grishin 2014; Seraphim et al. 2014; Tan et al. 2021) with the names proposed on the basis of old type specimens (Cong et al. 2021) in agreement with the literature (Viloria 2021), and in a manner consistent with the International Code of Zoological Nomenclature (ICZN 1999). Furthermore, not all names placed in Hermeuptychia are currently associated with their primary type specimens, causing further confusion (Viloria 2021) and thus threatening the stability of nomenclature.

Here, to facilitate a future integrative revision of Hermeuptychia grounded in genome-based sequencing of primary type specimens, some of these challenges are addressed. Methods employed in this work are as those described previously (Cong and Grishin 2014). Collection acronyms are given in the Acknowledgments section below. New COI barcode sequences reported here were deposited in GenBank <https://www.ncbi.nlm.nih.gov/genbank/> with accession numbers OK641921–OK641923.

Hermeuptychia sinuosa Grishin, new species

http://zoobank.org/026F9922-541B-466C-B25E-34739C18C1BD

(Figs. 1–10, 33a–d, j, k, 36 part)

Figs. 1–10. Hermeuptychia sinuosa sp. n. type specimens.

Figs. 1–10.

1–2. holotype ♂, Guatemala: El Progreso, Morazán, 10-Jan-1990, leg. C. J. Durden, DNA sample NVG-2307, genitalia No. NVG140403–35 [TMMC] (genitalia Fig. 33a–d); 3–8. paratypes, Mexico, pres. by Prof. M. Draudt, 62. 24., Joicey Bequest. Brit. Mus. 1934–120 [BMNH], © The Trustees of the Natural History Museum London, used with permission: 3–4. ♂, Guerrero, Nov-1916, BMNH(E)#806416; 5–6. ♂, Morelos: Cuernavaca, BMNH(E) #834699; 7–8. ♀, Colima, Mar-1922, BMNH(E)#834698; 9–10. paratype ♀, Mexico: Sierra de Guerrero, Dec-1912, leg. R. Muller, #3670, DNA sample NVG-2981, genitalia NVG14101–12 [USNM] (genitalia Fig. 33j, k). In Figs. 1–32 dorsal/ventral surfaces are in odd/even-numbered figures, except 1 and 29, which are ventral; labels are shown for type specimens in-line with the specimen images and are reduced 2.5-fold compared to specimens as indicated by a smaller scale bar. Larger scale refers to specimens. “F” specifies mirror image (left-right inverted).

Description and diagnosis.

On average smaller than its congeners (forewing length 14–16 mm), wings rounder and of similar shape in both sexes, dorsally unspotted brown, ventrally with postmedian eyespots typically very small, nearly equal to each other in size, five on forewing and six on hindwing (some may be vestigial, especially on forewing), hindwing eyespots 2, 5 & 6 (counting from costa) developed best, usually black, yellow-ringed and pupillated with pale metallic blue. Recognized by a well-expressed and wavy (sinuous) submarginal line placed at some distance from the two thinner marginal lines, hindwing 6th eyespot on this line, 1st eyespot usually replaced by a white dot (sometimes a patch of cream-white scales overlays a small eyespot), making such specimens identifiable by this character. These cream-white scales forming the dot are different from iridescent scales that pupillate eyespots. Median lines are darker at veins in some specimens, which is another character atypical for Hermeuptychia. Male genitalia distinctive (Fig. 33a–d): uncus narrow, in dorsal view lanceolate, widest near the distal third, apex truncated, nearly straight (not strongly bent ventrad) in lateral view, without carina; saccus long and narrow, about as long as vinculum; valva nearly straight, only slightly concave ventrad in the middle, without a deep notch, dorsally narrows gradually towards cucullus, then more abruptly past the base of cucullus, which narrows further to a point, slightly upturned; aedeagus as long as valva, not expanded at its base. Female genitalia (Fig. 33j, k) with antrum small comparatively to other species, weakly sclerotized, obcordate in shape, widest near its distal third, in dorso-ventral dimension thin and appears flattened, not cup-like as in most congeners.

Fig. 33. Genitalia of Hermeuptychia type specimens.

Fig. 33.

a–d. H. sinuosa holotype ♂, data in text and Figs. 1–2. e–h. H. occidentalis holotype ♂, data in text and Figs. 11–12. i. H. occidentalis, paratype ♂, Mexico: Morelos, Cuernavaca, Sep-1897, E. A. Smyth collection, DNA sample NVG-2979, genitalia NVG14101–10 [USNM] (specimen Figs. 13–14). j, k. H. sinuosa paratype ♀, Mexico: Sierra de Guerrero, Dec-1912, leg. R. Muller, #3670, DNA sample NVG-2981, genitalia NVG14101–12 [USNM] (specimen Figs. 9–10). l, m. H. occidentalis paratype ♀, Mexico: Guerrero, Acapulco, 7-Apr-1961, leg. J. Legge, DNA sample NVG-2971, genitalia NVG14101–02 [USNM] (specimen Figs. 17–18). Views: a, e. dorsal; b, f, j, l. ventral; c, g, k, m. lateral; d, h, i. dorsolateral. All images are to scale.

Barcode sequence of the holotype:

Sample NVG-2307, GenBank accession OK641921, 658 base pairs:

AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATAATTGGAACATCATTAAGTTTAATTATTCGAATGGAATTAGGTAATCCAGGATTTTTAATTGGGGATGATCAAATTTATAATACTATTGTAACAGCTCACGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGTAATTGACTTATCCCCTTAATATTAGGAGCTCCTGATATAGCCTTCCCACGTATAAATAATATAAGATTTTGATTATTACCCCCATCTTTAATTTTATTAATTTCTAGTAGTATTGTAGAAAATGGAAGTGGAACAGGATGAACAGTTTATCCCCCTCTTTCATCTAATATTGCTCATAGAGGATCATCGGTTGATTTAGCAATTTTTTCTCTTCATTTAGCTGGAATTTCTTCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAATAATATATCTTATGATCAAATACCTTTATTTATCTGAGCTGTAGGAATCACAGCTCTTCTTTTACTTCTTTCCTTACCCGTTTTAGCGGGAGCTATTACTATACTTCTTACCGACCGTAATTTAAATACATCATTTTTTGACCCCGCAGGAGGAGGTGATCCTATTTTATACCAACATCTATTT

Type material. Holotype:

♂, has four rectangular printed labels: three white [GTM.ElProgreso.002 | Morazan | DurdenCJ 90010A07], [DNA sample ID: | NVG-2307 | c/o Nick V. Grishin], [NVG140403–35] and one red [HOLOTYPE ♂ | Hermeuptychia | sinuosa Grishin]. The locality label stands for Guatemala: El Progreso, Morazan, above k99, leg. C. J. Durden, 10-Jan-1990. NVG140403–35 is a genitalia preparation number, genitalia vial placed on the same pin with the specimen. The holotype is illustrated in Figs. 1–2 (genitalia Fig. 33a–d) and is currently in the University of Texas at Austin collection, Austin, TX, USA [TMMC].

Paratypes:

4 ♂♂ and 3 ♀♀, all from Mexico: ♀ Colima, Mar-1922, BMNH(E) #834698, ♂ Morelos, Cuernavaca, BMNH(E) #834699, ♂ Guerrero, Nov-1916, BMNH(E) #806416, ♀ Guerrero, Sierra de Guerrero, “Dec. 12” [probably 12-Dec-?], DNA sample NVG-2981, genitalia NVG141101–12 [USNM], ♂ Oaxaca, Chiltepec, 2-Nov-1969, RLR, DNA sample NVG-14112H06, ♀ Veracruz, Catemaco, Dos Amates, 23-Sep-1972, RLR, DNA sample NVG-14112H07, ♂ no data label [likely from one of the two “RLR” localities above], DNA sample NVG-14112H05.

Type locality.

Guatemala: El Progreso, Morazán.

Etymology.

The name refers to the sinuous submarginal dark line on wings beneath. The name is a feminine adjective.

Distribution.

In addition to the type locality in Guatemala, this species is widely distributed in Mexico (Colima, Morelos, Guerrero, Oaxaca, Veracruz).

Comments.

This species was at times identified as Hermeuptychia lupita (Reakirt, [1867]) (type locality Mexico: Veracruz) (Warren et al. 2016), which is incorrect, as also pointed out by Viloria (2021). Facies of Hermeuptychia sinuosa sp. n. do not agree with the original description of Neonympha lupita. In particular, the former species is smaller (wingspan <1.15 vs. 1.25 inches in N. lupita), and the wing pattern of the ventral side differs: the new species typically has more than 4 eyespots (1 forewing, 3 hindwing in N. lupita) and lacks additional (to the three median lines) “transverse lines” on the hindwing “towards the base” (Reakirt [1867]).

Hermeuptychia occidentalis Grishin, new species

http://zoobank.org/7FB00257-D9A6-4C25-930B-78145BF3AFAC

(Figs. 11–18, 33e–i, l, m, 36 part)

Figs. 11–18. Hermeuptychia occidentalis sp. n. type series.

Figs. 11–18.

11–12. holotype ♂, Mexico: Guerrero, Acapulco, 7-Apr-1961, leg. J. Legge, DNA sample NVG-2970, genitalia NVG14101–01 (Fig. 33e–h) [USNM]; paratypes: 13–14. ♂, Mexico: Morelos, Cuernavaca, Sep-1897, E. A. Smyth collection, DNA sample NVG-2979, genitalia NVG14101–10 (Fig. 33i) [USNM]; 15–16. ♂, Mexico: Jalisco, nr. Pitillal, 3-May-1985, leg. G. R. Scott, DNA sample NVG-2789; 17–18. ♀, Mexico: Guerrero, Acapulco, 7-Apr-1961, leg. J. Legge, DNA sample NVG-2971, genitalia NVG14101–02 (Fig. 33l, m) [USNM].

Description and diagnosis.

Belongs to the same species group with Hermeuptychia sosybius (Fabricius, 1793) and Hermeuptychia hermybius Grishin, 2014 as judged by the presence of large areas on the dorsal surface of the wings covered with androconia, morphology of the male genitalia and COI DNA barcodes that place this species as sister to the two others (Fig. 36). Due to wing pattern variation, identification by facies is challenging. Characterized by a postmedian area on the ventral hindwings distad of the distal median line and to the eyespots (sometimes beyond them) paler than the rest of the wing, and markedly paler than the discal area forming a (somewhat) darker band bordered by the two median lines. The forewings in most specimens show the same, but weaker, tendency of being paler towards the outer margin from the distal median line. Veins not paler than the background, as they frequently are in H. hermybius. Diagnosed by genitalia and COI barcodes. In male genitalia (Fig. 33e–i), which are otherwise similar to H. hermybius, the uncus is narrower, lanceolate in dorsal view, being broadest near its basal third, rather than near or past its middle, not constricted before the truncated apex, the apex narrower as well. In the female genitalia (Fig. 33l, m), the antrum is broader, nearly round, broadest near its middle, nearly symmetrical. The following combination of characters in the COI DNA barcode is proposed as diagnostic: T5C, T247C, T484C, T580C, T583C, and T646C, where the number refers to the sequence given below (from 1 to 658), the letter before the number is the expected ancestral base pair in this position and the letter after the number is the base pair in this new species.

Fig. 36. COI barcode dendrogram.

Fig. 36.

constructed using BioNJ (Gascuel 1997) from Jukes-Cantor distances (Jukes and Cantor 1969) computed on the alignment after removal of all positions with gaps. Species names are given (and colored) only when they are determined with confidence. Species sequenced in Seraphim et al. (2014) are named by their morphogroup employed in that work. GenBank accessions are specified. Branches and species names for barcodes obtained in this work are shown in red. NT is neotype and HT is holotype. The dendrogram is rooted with the barcode of Megisto cymela|GU088434 (not shown). Due to insufficient phylogenetic signal in barcodes, the dendrogram may not reflect phylogeny and is only shown to illustrate divergence and similarity between barcodes.

Barcode sequence of the holotype:

Sample NVG-2970, GenBank accession OK641922, 658 base pairs:

AACTCTATATTTTATTTTTGGTATCTGAGCAGGAATAATTGGTACATCATTAAGTTTAATTATCCGAATAGAATTAGGTAACCCAGGATTTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGTAATTGACTTATTCCTTTAATATTAGGAGCTCCTGATATAGCTTTCCCACGTATAAACAATATAAGATTTTGATTATTACCCCCATCTTTAATTTTATTAATTTCTAGTAGTATTGTAGAAAATGGAAGTGGAACAGGATGAACAGTTTATCCCCCTCTTTCATCTAATATTGCTCATAGAGGTTCTTCAGTAGATTTAGCAATTTTTTCTCTTCATTTAGCTGGAATTTCTTCAATTCTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAATAATATATCCTATGATCAAATACCTTTATTTATTTGAGCTGTAGGAATTACAGCTCTTCTTTTACTTCTTTCATTACCTGTTTTAGCAGGAGCTATCACTATACTCCTCACTGATCGAAATTTAAATACATCATTTTTTGATCCTGCAGGAGGAGGAGACCCTATTTTATACCAACATTTATTT

Type material. Holotype:

♂, has four rectangular labels: three white, one handwritten [April 7, 1961 ♂ | Acapulco | Mexico | Coll. by J. Legge], others printed [DNA sample ID: | NVG-2970 | c/o Nick V. Grishin], [genitalia | NVG141101–01 | Nick V. Grishin] and one red [HOLOTYPE ♂ | Hermeuptychia | occidentalis Grishin]. The holotype is illustrated in Figs. 11–12 (genitalia Fig. 33e–h) and is in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA [USNM].

Paratypes:

2 ♂♂ and 1 ♀, from Mexico: ♂ Jalisco, near Pitillal, 3-May-1985, leg. Glenn R. Scott, DNA sample NVG-2789; ♂ Morelos, Cuernavaca, Sep-1897, E. A. Smyth collection, DNA sample NVG-2979, genitalia NVG14101–10 [USNM]; ♀ Guerrero, Acapulco, 7-Apr-1961, leg. J. Legge, DNA sample NVG-2971, genitalia NVG14101–02 [USNM].

Type locality.

Mexico: Guerrero, Acapulco.

Etymology.

The name refers to the western distribution of this species. The name is a feminine adjective.

Distribution.

This species is known from southwestern Mexico (Jalisco, Morelos, Guerrero).

Neotype designation for Hermeuptychia canthe (Hübner, [1811])

Meaningful integrative taxonomic revision of Hermeuptychia, a genus of many confusingly similar cryptic species, requires clarity about its nomenclature. Such clarity can only be achieved when all relevant names are objectively defined by their primary type specimens, and these specimens are sequenced to provide DNA datasets necessary for a more definitive identification and comparisons. No extant primary type specimens are known for Hermeuptychia canthe (Hübner, [1811]). Although, as documented in the literature, most of Hübner types were likely lost (Hemming 1937; Calhoun 2018), N.V.G. searched for possible H. canthe syntypes in the collections of the Muséum National d’Histoire Naturelle, Paris, France (MNHP), the Natural History Museum, London, UK (BMNH) and the Museum für Naturkunde, Berlin, Germany (ZMHB). These searches were unsuccessful, leading us to believe that the syntypes are no longer extant, and we proceed herein with a neotype designation. There is an exceptional need to designate the neotype of H. canthe. Kept as a junior subjective synonym for decades, H. canthe was resurrected by Viloria (2021) who used the name as valid. To unambiguously establish the identity of this species necessary for further work on this very challenging genus, a neotype that facilitates DNA-based studies is required. We believe that it is not possible to discern the cryptic diversity of Hermeuptychia without DNA comparisons (Tan et al. 2021).

The original illustrations of Oreas strigata canthe Hübner, [1811] are identifiable as a Hermeuptychia, probably from Suriname (Hemming 1937), largely brown unspotted dorsally, and ventrally with 5 eyespots on the forewing (including the one near the apex) and 6 on the hindwing (Figs. 29, 30). All the eyespots on the illustrations are approximately the same size, e.g. those in hindwing cells R5-M1 and CuA1-CuA2 are not larger than others. The distance between the two brown lines on the ventral forewing increases towards the costa. We found a male specimen from Suriname that agrees with these distinctive features of the original illustrations and we hereby designate this specimen shown in Figs. 19, 20, genitalia Fig. 34, as the neotype of Oreas strigata canthe Hübner, [1811]. This species belongs to Hermeuptychia.

Figs. 19–32. Hermeuptychia specimens. H. canthe: 19–20.

Figs. 19–32.

neotype ♂, designated herein, Suriname: Gelderland, Suriname River, genitalia slide W. D. F. #306 (Fig. 34), DNA sample NVG-14061C10 [USNM]; 21–22. ♂, Peru: Madre de Dios, Amazonia Lodge, Atalaya, 491 m, 25-Sep-2011, leg. Steve Kinyon, #1907, DNA sample NVG-2649, genitalia NVG140628–17 (Fig. 35i) [USNM]; 23–24. ♀, Guyana: Region 9, Kanuku Mts., Nappi Creek, 03°20.7’N 59°34.2’W, 500’−1000’, 21-Feb-10-Mar-1999, leg. S. Fratello, R. Hanner, S. Hendricks & R. Williams, USNM ENT 00232265, DNA sample NVG-2675, genitalia NVG140628–43 (Fig. 35l–m) [USNM]; 25–26. ♂, Colombia: Caqueta, Florencia, 6-Aug-1976, fairly wet hillside forest, leg. J. A. Scott, DNA voucher NVG-2798; 27–28. ♀, Suriname: Commewijne, De Nieuwe Grond, secondary forest, 2-Jun-1982, leg. Olle Pellmyr, DNA sample NVG-2644, genitalia NVG140628–12 (Fig. 35j–k) [USNM]; 29–30. illustrations of type specimens from the original description, not to scale (Hübner [1811]). 31–32. H. cantheus neotype ♂, designated herein, USA: Florida, St. Petersburg, 3-Nov-1938, leg. H. E. Wilford, DNA sample 11-BOA-15609E04 [USNM].

Fig. 34.

Fig. 34.

Genitalia of Oreas strigata canthe Hübner, [1811] neotype, mounted on slide #306 24-Oct-1940 by W. D. Field [USNM], aedeagus is shown below, pasted in this image from aside.

Our neotype of H. canthe satisfies all the requirements set forth by the ICZN Article 75.3. Namely: 75.3.1. It is designated to clarify the taxonomic identity of O. canthe, which remained hypothetical until now, impeding research on Hermeuptychia; 75.3.2. The characters that differentiate this taxon have been given above, as a description of the original illustrations, complemented here by the following features of male genitalia (Fig. 34, 35): saccus long, only somewhat shorter than tegumen with uncus; “truncated” at the end, uncus with thin, membranous carina in basal half; valva about 4 times longer than its height, ventrally with a broad notch, cucullus long and narrow, terminally without teeth, aedeagus slightly longer than valvae. The COI barcode sequence of the neotype (GenBank accession OK641923) is:

Fig. 35. Genitalia of Hermeuptychia canthe.

Fig. 35.

a–d. ♂, Bolivia: Beni, 40 km E San Borja, Estacion Biologica Beni, Palm Camp at Rio Curiraba, 9–15-Sep-1987, malaise trap in inundation forest, leg. W. E. Steiner & M. G. Pogue, BIOLAT/LEPI 000002406, DNA sample NVG-2633, genitalia NVG140628–01; e–h. ♂, ibid, BIOLAT/LEPI 000002432, DNA sample NVG-2635, genitalia NVG140628–03 [USNM]; i. ♂, Peru: Madre de Dios, Amazonia Lodge, Atalaya, 491 m, 25-Sep-2011, leg. Steve Kinyon, #1907, DNA sample NVG-2649, genitalia NVG140628–17 (specimen Figs. 21–22); j, k. ♀, Suriname: Commewijne De Nieuwe Grond, secondary forest, 2-Jun-1982, leg. Olle Pellmyr, DNA sample NVG-2644, genitalia NVG140628–12 (specimen Figs. 27–28); l, m. ♀, Guyana: Region 9, Kanuku Mts., Nappi Creek, 03° 20.7’N 59° 34.2’W, 500’−1000’, 21-Feb-10-Mar-1999, leg. S. Fratello, R. Hanner, S. Hendricks, R. Williams, USNM ENT 00232265, DNA sample NVG-2675, genitalia NVG140628–43 (specimen Figs. 24–25). All specimens are in USNM. Views: a, e. dorsal; b, f, j, l. ventral; c, g, k, m. lateral; d, h, i. dorsolateral. All images are to scale.

AACTTTATATTTTATTTTTGGTATCTGAGCAGGAATAATTGGCACATCATTAAGTTTAATTATCCGAATAGAATTAGGTAATCCAGGATTTTTAATTGGAGATGACCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGTGGATTTGGTAATTGACTTATTCCCTTAATATTAGGAGCTCCTGATATAGCTTTCCCACGTATAAATAATATAAGATTTTGATTATTACCTCCATCTTTAATTTTATTAATTTCTAGTAGCATTGTAGAAAATGGAAGTGGAACTGGATGAACAGTTTATCCCCCTCTTTCATCTAATATTGCTCATAGAGGTTCTTCTGTAGATTTGGCAATTTTTTCTCTTCACTTAGCTGGAATTTCTTCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAATAATATATCTTATGATCAAATACCCCTATTTATTTGAGCCGTAGGAATTACAGCTCTCCTCTTACTTCTTTCATTACCTGTTTTAGCAGGAGCTATTACTATACTTCTTACTGATCGAAATTTAAATACATCATTTTTTGACCCTGCAGGAGGAGGAGACCCCATTTTATATCAACATTTATTC

75.3.3. The neotype specimen is a male that bears the following five rectangular labels: [Gelderland, | Suriname River.], [Collection | Wm. Schaus], [genitalia | slide X-24–40 | W. D. F. #306], [DNA sample ID: | NVG-14061C10 | c/o Nick V. Grishin], and [NEOTYPE ♂ | Oreas canthe | Hübner, [1811] | designated by Grishin]; 75.3.4. Our search for the syntypes is described above, and it was unsuccessful, leading us to believe that they are no longer extant; 75.3.5. The neotype is consistent with what is known about this taxon, in particular with the original illustrations: e.g., on the ventral side, it has 5 eyespots on the forewing and 6 eyespots on the hindwing, all approximately the same size; 75.3.6. The neotype is from Suriname: Gelderland, Suriname River, and the syntypes were presumed to be from Suriname (Hemming 1937); 75.3.7. The neotype is in the collection of the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM).

Distances between barcodes of species with confidently assigned names and those from morphogroups defined by Seraphim et al. (2014) are illustrated here as a dendrogram (Fig. 36). The neotype of S. canthe is a species from morphogroup 10 (Seraphim et al. 2014). In agreement with Viloria (2021), we consider it to be a valid species, Hermeuptychia canthe (Hübner, [1811]). To facilitate recognition of this species, additional sequenced specimens from across its range are shown in Figs. 21–28, and their genitalia are shown in Fig. 35. In addition to its type locality in Suriname, this widely distributed species is recorded from Colombia, Guyana, French Guiana, Brazil (PA, MT, MG), Ecuador, Peru, and Bolivia, as evidenced by the specimens we studied (Fig. 19–28, 34, 35), the DNA sequence search of the BOLD database queried with the neotype barcode (Ratnasingham and Hebert 2007) and reports in the literature (Seraphim et al. 2014; Tan et al. 2021).

Euptychia celmis var. bonaërensis [sic] Burmeister, 1878 is a junior objective synonym of Yphthimoides acmenis (Hübner, 1823)

A number of Satyrini Boisduval, [1833] species have a dry season form, in which patterns of eyespots and stripes are much reduced to nearly absent, and the ventral side is paler, of mottled appearance (Freitas et al. 2010; Freitas et al. 2021). Similar to that, the original illustration of Megisto acmenis Hübner, 1823 (type locality “Baltimore”) reveals “not the slightest trace of any eyespots” on the ventral side of its wings (Hübner 1823) (Fig. 37a). Type specimens of this species have not been located and its type locality is likely erroneous (Scudder 1875; Weymer 1910–1912) leading to confusion about this taxon. For instance, there is a Hermeuptychia specimen of unknown provenance in BMNH labeled “acmenis” and illustrated in D’Abrera (1988). This Hermeuptychia specimen, representing a rather extreme example of the dry season form or aberration, cannot be confidently identified to species without dissection or DNA sequencing, because many Hermeuptychia species are similar to this form. The status of M. acmenis and the Hermeuptychia “acmenis” specimen were discussed in detail by Viloria (2021), who concluded that M. acmenis belongs to Hermeuptychia based on this specimen and wing shape similarity of the illustrated M. acmenis type(s) and Hermeuptychia. However, the progression of ventral wing pattern deterioration in Hermeuptychia is inconsistent with that of M. acmenis. Hermeuptychia possesses submarginal wavy lines that are similar in intensity to the two median lines. These lines tend to deteriorate similarly. I.e., if the median lines are expressed clearly (as in the M. acmenis illustration), then the submarginal lines are clear as well. If the submarginal lines are obsolete, then the median lines are obsolete too (as in the Hermeuptychia “acmenis” specimen).

Fig. 37. Megisto acmenis.

Fig. 37.

a. Original illustration of Megisto acmenis from Hübner (1823) and individuals of Yphthimoides celmis that are similar to it: b. from Brazil: Paraná, Tapejara photographed by Tiago Barbosa in June 2019 (CC BY-NC, Barbosa 2019); c, d. from Buenos Aires area in Argentina photographed by Holger Braun on 13 October 2019 (CC BY, Braun 2019); d. shows its enlarged hindwing submarginal area that is essentially unspotted: “von Augenpuncten nicht die geringste Spur”. The images are rotated, cropped, b. flipped, and c, d. color-corrected compared to the originals.

A more detailed analysis of the Hermeuptychia “acmenis” specimen reveals that its wing patterns on the ventral side and size do not agree with the original description and illustration of M. acmenis. In particular, in this specimen: (1) both hindwings have clearly defined traces of eyespots: small brown spots in cells CuA1-CuA2 (larger) and RS-M1 (smaller), but the description states: “von Augenpuncten nicht die geringste Spur”, i.e., not the slightest trace of any eyespots (Hübner 1823: 11); (2) the hindwings are rather uniform in color and median lines are not visible: only a slightly paler diffuse postmedian band stands out from the brown background, vs. two prominent median lines outlining a darker area between them in the illustration of M. acmenis; (3) the forewing has a long dash along the distal end of discal cell, but the illustration shows a very short mark in that area; (4) the ventral side of the wings is of less mottled apperance than shown in the illustration; (5) the forewing length is <17 mm, but the illustration depicts a larger specimen, as extrapolated from the comparison with Adelpha plesaure Hübner, 1823 illustrated on the same plate (likely to scale): the forewing length is expected to be 18 mm or more. Moreover, the original description of M. acmenis states: “Mit M. Euridice hat sie viel ähnliches” (With M. Euridice has much in common), and Lethe eurydice (Linnaeus, 1763) is larger than most Hermeuptychia. Therefore, at the very least, this Hermeuptychia “acmenis” is not the specimen illustrated in the orginal description, not a syntype, and probably not M. acmenis at all.

To prepare for a more detailed genomic study of Hermeuptychia, we investigated M. acmenis further. If Baltimore was the correct locality, the only somewhat similar species that may reach this latitude is Cyllopsis gemma (Hübner, 1818). The similarity is in the placement and shape of lines and, in particular, in the degree of mottling and color gamut. However, if M. acmenis were C. gemma, it would have been an unusual aberration that totally lost the ventral hindwing submarginal patch of “spider-eye” spots. We have not seen such an aberration, although some of the more southern Cyllopsis R. Felder, 1869 species do experience deterioration of eyespots, e.g., Cyllopsis pyracmon (Butler, 1867).

Weymer (1910–1912) likened M. acmenis to Cissia phronius (Godart, [1824]), which in size is more similar to L. eurydice, and larger than Hermeuptychia, in agreement with our M. acmenis size estimates from the original illustrations (Hübner 1823). As Weymer noted, darker dots in the median lines of C. phronius are absent in M. acmenis, therefore the two are distinct species and should be kept as such. Moreover, wingshape of C. phronius is different: the forewing is elongated and the hindwing has crenulate margins. Dry season forms of Emeryus difficilis (Forster, 1964) are known to possess similar hindwing pattern to that of M. acmenis and essentially lack the eyespots (Zacca et al. 2020). However, E. difficilis is larger (forewing ~21 mm), has well-expressed submarginal lines on the dorsal surface of the wings, and its hindwing outer margin is crenulate. These characters are not consistent with the original illustration of M. acmenis.

Out of all Satyrini worldwide, the only species known to us that may have the following combination of characters: mottled appearance of wings’ ventral side, with two median lines, darker between them and paler just outside this darker median band framed by the two lines, with a small dash at the end of the forewing discal cell, and lacking essentially any spots in the postmedian areas of both wings, is Yphthimoides celmis (Godart, [1824]). Such dry season specimens look rather similar to the original illustration of M. acmenis. For instance, a butterfly photographed in Brazil: Paraná, Tapejara and shown on the iNaturalist website (Barbosa 2019) (Fig. 37b) comes particularly close to M. acmenis. Moreover, an individual from Argentina: Buenos Aires Province, Parque Pereyra (Braun 2019) (Fig. 37c, d) is entirely missing “a trace of any eyespots”.

The only notable discrepancy is that the hindwing darker discal band is more strongly curved towards the anal margin in the M. acmenis illustrated by Hübner (1823) than in Y. celmis. However, the same discrepancy is also present in the Hermeuptychia “acmenis” specimen in BMNH: traces of median lines are not convex thus differing from the original illustration. This illustrated curvature, also mentioned by Weymer (1910–1912), is reminiscent of some species of Erebia Dalman, 1816 and Oeneis Hübner, [1819], but none of these species fits other features of the M. acmenis pattern. The closest might be Erebia fasciata A. Butler, 1868, but it has at least some red-toned areas on the forewing, and the submarginal dark area on both wings below is more clearly defined than the M. acmenis illustration shows. Thus, we hypothesize that the strongly curved band may have been an atypical feature of the illustrated specimen or an artistic interpretation, and agree with Lamas (2004) who placed M. acmenis in Yphthimoides Forster, 1964. One of the most commonly encountered species, Yphthimoides celmis, is found in southeastern South America. A number of species described in the same publication with M. acmenis come from South Brazil, and at least one from Argentina, so it is possible that M. acmenis was also collected in that region and mislabeled “Baltimore” at some point (Hübner 1823).

Although as documented in the literature, most of Hübner types were likely lost (Hemming 1937; Calhoun 2018), N.V.G. searched for possible M. acmenis syntypes in the collections of the Muséum National d’Histoire Naturelle, Paris, France (MNHP), the Natural History Museum, London, UK (BMNH) and the Museum für Naturkunde, Berlin, Germany (ZMHB). These searches were unsuccessful, leading us to believe that the syntypes are no longer extant, and we proceeded with the neotype designation. There is an exceptional need to designate the neotype of M. acmenis, because the identity of this species and its type locality have been unclear, and it was confused with Hermeuptychia in collections and publications (D’Abrera 1988; Viloria 2021). To proceed with a meaningful integrative revision of Hermeuptychia, it is essential to have M. acmenis defined objectively and in agreement with the original description and original illustrations. Our investigations show that populations currently assigned to Y. celmis from around Buenos Aires (Argentina) agree with what is known about M. acmenis (Fig. 37). Therefore, we decided to select a specimen from these populations as the neotype of M. acmenis. The specimens with reduced or lacking eyespots from the region have been named Euptychia celmis var. bonaërensis [sic] Burmeister, 1878, which is characterized in the original description as “a remarkable variation … almost without eyes” (Burmeister 1878). To simplify the synonymy, we hereby designate the specimen curated as the lectotype of Euptychia celmis var. bonaërensis Burmeister, 1878, illustrated in Warren et al. (2016), as the neotype of Megisto acmenis Hübner, 1823. Its forewing length is about 18 mm, which is in agreement with the size estimated from the original illustration of M. acmenis.

Our neotype of M. acmenis satisfies all the requirements set forth by the ICZN Article 75.3. Namely: 75.3.1. It is designated to clarify the taxonomic identity of Megisto acmenis Hübner, 1823, which remained undefined until now, impeding future research; 75.3.2. The characters that differentiate this taxon have been given in its original description by Hübner (1823: 11): “It has much in common with M. Euridice [sic!], but not the slightest trace of any eyespots” and can be further gleaned from the original illustration: brown unspotted wings above, and below paler yellow-brown, mottled in appearance, with a slightly darker broad discal band spanning both wings and outlined by even darker lines on both sides, paler just outside the band and devoid of eyespots; 75.3.3. The neotype specimen is a male, which is also a lectotype of Euptychia celmis var. bonaërensis [sic] Burmeister, 1878 hereby designated by Gerardo Lamas, that bears the following 5 labels: [Buen. | Aires], [Typus.], [bonaërensis | Burm.], [Col. | Antigua], and [lectotype ♂ | Euptychia celmis var. | bonaerensis Burm. | 1878 | G. Lamas det. ‘92]. The following red rectangular label will be mailed to the curators of the collection to add to this specimen: [NEOTYPE ♂ | Megisto acmenis | Hübner, 1823 | designated by Barbosa | Freitas and Grishin]. This specimen was one of the two syntypes of E. celmis var. bonaërensis, both males with the same data in the same collection (see below), and is designated as the lectotype of that taxon to enhance the stability of nomenclature; 75.3.4. Our search for the syntypes is described above, and it was unsuccessful, leading us to believe that they are no longer extant; 75.3.5. The neotype is consistent with what is known about this taxon, in particular with the original illustration and description as detailed above; 75.3.6. The neotype is from Buenos Aires (Argentina), and the type material was stated to be from “Baltimore”, which is likely erroneous, because no similar species have been found in eastern North America (Scudder 1875; Weymer 1910–1912), but both localities start with the letter B, suggesting a number of speculations. The specimen(s) on which Hübner based his description and illustrations of M. acmenis was/were given to him by a certain “Herr Berg”, of whom nothing else appears to be known, except that other species forwarded by him to Hübner were supposedly obtained in Uruguay, Paraguay and Brazil, and only one other species (a crambid moth) was labeled “Baltimore” though it appears to be widespread, found from the USA south to at least Brazil; 75.3.7. The neotype is in the collection of the Museo Argentino de Ciencias Naturales Bernardino Rivadavia, Buenos Aires, Argentina [MACN].

Lamas (2004) lists Yphthimoides acmenis (Hübner, 1823) as a distinct species, and Euptychia celmis var. bonaërensis [sic] Burmeister, 1878 as a synonym of Yphthimoides celmis (Godart, [1824]). We have not investigated this synonymy, but if it holds, then due to objective synonymy established here by the neotype designation of M. acmenis, Y. celmis would become a junior subjective synonym of Y. acmenis. For now, we simply transfer E. celmis var. bonaërensis [sic] from Y. celmis to Y. acmenis, keeping both Yphthimoides species as valid, to follow Lamas (2004). Furthermore, Euptychia celmis ab. “inocellata” Köhler, 1935 (an infrasubspecific name) and Epinephele euptychioides Köhler, 1939, both from Argentina, may also belong to Y. acmenis and/or celmis, but this possibility has not been investigated further.

Satyrus cantheus Godart, [1824] is a junior subjective synonym of Hermeuptychia sosybius (Fabricius, 1793)

As detailed by Cardé et al. (1970) and further elaborated by Viloria (2021), Godart ([1824]) divided the Fabrician concept of Papilio canthus Linnaeus, 1767 into three species. Two of them are known today as Lethe eurydice (Linnaeus, 1763) (type locality USA: Pennsylvania) and Emeryus argulus (Godart, [1824]) (type locality Brazil: Pará, Santa Bárbara do Pará). The latter name was proposed in the same work that also coined the name for the third species: Satyrus cantheus Godart, [1824], which is a nomen dubium (Cardé et al. 1970). Viloria (2021) suggested that one of the two specimens in the Hunterian Collection in Glasgow pinned below the header label “Pap. Canthus / Fabr. pag 64 N° 288” may have been used as a basis for the description of S. cantheus. Viloria discussed only the second specimen (GLAHM:127581, which is a female, not a male), without mentioning the first one (GLAHM: 127580, a male). These two specimens are of different species that are presently placed in different subtribes. The phenotype of this second specimen discussed by Viloria (GLAHM:127581) does not agree with the original description of S. cantheus. First, each of its forewings has five obvious eyespots instead of “three small eyespots not very pronounced” per the description. It is apparent, that Godart paid much attention to the number of eyespots and their structure. E. g., he separated argulus from canthus with cantheus (all of which Fabricius combined under P. canthus Linnaeus, 1767) by the number of ventral hindwing eyespots: 5 in the former versus 6 in the two latter species; and their structure: with two (not one) pupils in the former species. Second, the 5th eyespot (next to the 6th, which is stated to be at the anal angle [=tornus]) is not the largest: it is 1.2–1.3 times smaller than the 2nd eyespot, measured in longitudinal dimension. Third, the 6th eyespot (the one stated to be by the anal angle) is not the smallest: it is about 1.3 times larger than the 4th one. Fourth, the specimen is about 1.5 times smaller than a typical L. eurydice, but Godart’s description states that S. cantheus [Godart species number 56] “is about the same in size as the previous one”, which is the number 55 P. canthus Linnaeus, 1767 (a junior objective synonym of L. eurydice). For all these reasons, this specimen is not a syntype. Furthermore, this specimen would not define the name S. cantheus as intended in the original description to qualify as a neotype.

Fabricius did not propose a new name canthus homonymous with Papilio canthus Linnaeus, 1767 as suggested by Viloria (2021). This is because Fabricius gave the name canthus in the third line of his description and attributed it to the Linnaeus citation, in a manner he did for many other species when giving brief modified descriptions for previously proposed names (Fabricius 1775). Moreover, he repeated this treatment and attribution in subsequent publications, only adding an additional name and citation to it (Papilio argante Cramer, 1779) that he considered to refer to the same species (Fabricius 1781-[1782]; Fabricius 1793). No new name currently attributed to Fabricius that we know of referenced an identically spelled name citing a previous author and publication. Therefore, Fabricius either misidentified the Linnaean taxon completely, or expanded it to cover additional phenotypes, and Godart’s work points to the latter (Godart [1824]). Moreover, all new names proposed by Fabricius have been thoroughly studied and catalogued in detail by a number of authors, and none mentions canthus as a new name. For instance, there is no mention of canthus with Fabricius as the author in the comprehensive catalogue by Zimsen (1964). There is no name canthus assigned to Fabricius in The Global Lepidoptera Names Index (Beccaloni et al. 2003). Furthermore, Godart ([1824]: 493) did not credit canthus to Fabricius, only to Linnaeus, mentioning that “Fabricius combined this butterfly [i.e. canthus] with the next [called cantheus by Godart]; but it appears to us to be a different species, at least judging from the description that follows” (interpretively translated and comments in brackets are added by us). Because Fabricius did not propose a new name canthus, no name-bearing (i.e., type) specimens of the Fabrician concept of canthus are possible by definition: there was no new name to bear.

We agree with Cardé et al. (1970) and Viloria (2021) that Godart’s S. cantheus is not a misspelling of P. canthus, but is an available name. Our reading of Godart ([1824]) excludes the possibility of a misspelling, because Godart uses “S. canthus” for his species no. 55 and “S. cantheus” for his species no. 56: the two consecutively numbered species that are expected to have different names, as they do (not one being a misspelling of the other). Miller and Brown (1981) made a mistake in stating that Godart attributed the name cantheus to Linnaeus: only the name canthus [no. 55] was attributed to Linnaeus, not the name number 56, which cited only Fabricius. Therefore, the conclusion of Miller and Brown about the misspelling is erroneous. Furthermore, Godart used two sets of names throughout his work: French names that were not italicized, employed French words and had accents over letters when appropriate; and Latin names that were italicized, employed Latin or Latinized words and lacked accented letters. For instance, he used “Satyre” as a French name, which would be “Satyr” in English, not the Latin Satyrus, and therefore not a genus epithet. With this distinction, only Godart’s Latin names would enter zoological nomenclature. For instance, for the species known today as Neonympha areolatus (J. E. Smith, 1797) (type locality USA: Georgia, Chatham Co.), Godart’s species number 58, he used “Satyre aréolé” as a French name, and “Satyrus areolatus” as a Latin name (Godart [1824]). Even more striking an example is “Polyommate W-blanc” for “Polyommatus W-album” (Godart [1824]: 648). However, for the majority of species, the second word in the French name matched the species epithet more closely than in these cases. Because of that, the situation with two sets of names may be confusing to a casual reader, but Godart meticulously followed this distinction. Only French names were used in the section of the work giving brief diagnoses (e.g., pp. 460–476) (Godart [1824]). A French name was also used as the title for each species description (e.g., pp. 477–552), immediately following the species number. Latin names were given in the second line of these expanded descriptions, after the French names. Given this distinction between French and Latin names employed by Godart, a deviant spelling “cautheus” [3rd letter “u”, not “n”] occurred only once and in the French name (Godart [1824]: 465), not in the Latin name, and therefore is irrelevant to zoological nomenclature. The correct (and only) spelling of this species epithet in Godart’s work is “cantheus”.

Furthermore, because there was no Fabrician name canthus, there could be no replacement name for it. Therefore, Godart did not propose a “replacement name”, he proposed a new name: Satyrus cantheus, and this taxon must have had type specimen(s). Because Godart’s description of S. cantheus ends with “(Translation of Fabricius)”, it is possible that Godart did not inspect any specimens at all, as also suggested by Cardé et al. (1970): “type … probably never existed”, but based his new species entirely on the Fabrician texts. This hypothesis may not be entirely true, because Godart elaborated on the Fabrician description by mentioning the size of his S. cantheus (species number 56): “Its size is about the same as the previous one”, which was species number 55 P. canthus Linnaeus, 1767 (a junior objective synonym of L. eurydice) (Godart [1824]). No reference to this size was given in any Fabrician works we studied, and it should have come from some additional knowledge Godart had about the type specimen(s). Whether Godart inspected the actual specimens or not, the name-bearing type currently encompasses a series of all specimens used to constitute Godart’s description of cantheus, either directly examined by him, or described by Fabricius in those parts of his texts that were cited and translated by Godart as falling under Godart’s concept of cantheus. Among these specimens, there should be at least one specimen possessing, as per its description, a combination of the following four characters: (1) size approximately as L. eurydice; (2) 3 small indistinct ventral forewing eyespots; (3) the 5th ventral hindwing eyespot (counting from the apex) being the largest of the six present, and (4) the 6th spot (by the anal angle) being the smallest. To define the taxon S. cantheus, we hereby designate the syntype that has all 4 characters stated above and was found first (with the earliest date and time) in the search for syntypes of Satyrus cantheus as the lectotype of Satyrus cantheus Godart, [1824]. This designation satisfies the ICZN Code (ICZN 1999). Our lectotype fulfills the definition of the term as a single specimen selected out of syntypes subsequently to the establishment of the name (ICZN Code Glossary). The designation is individual: it is made for cantheus only (Art. 74.3.). We employ the term “lectotype” (Art. 74.7.1.). Our designation contains information sufficient to recognize this single specimen by the characters given as being the first syntype found in the search for syntypes that possesses all these characters (Art. 74.7.2.). The reason for the lectotype designation is to objectively define this taxon by selecting the specimen that actually agrees with the key characters given in the original description of S. cantheus, and thus represents this species as intended by Godart, promoting stability of nomenclature.

Next, we searched for the lectotype in collections and databases where the types of Fabricius and Godart could be. In particular, N.V.G. inspected the holdings of the Muséum National d’Histoire Naturelle, Paris, France (MNHP), which are known to have a number of Godart types, some with a characteristic “god.” signature on their labels; and looked through the relevant parts of the collections of the Natural History Museum, London, UK (BMNH) and the Museum für Naturkunde, Berlin, Germany (ZMHB). We also extensively searched online databases, including the Natural History Museum of Denmark, University of Copenhagen, Denmark (2021), the Hunterian collections, University of Glasgow, Scotland, UK (2021) and the National Museums of Scotland, Edinburgh, UK (2021). Our searches failed to find the lectotype that also has not been found by previous workers, and therefore we believe it became lost. Hence, we proceed herein with a neotype designation. There is an exceptional need to designate the neotype of S. cantheus. Although this name has not been used as valid for over a century and some considered it a misspelling (Miller and Brown 1981), others a nomen dubium (Cardé et al. 1970), Viloria (2021) resurrected it and applied it in a manner inconsistent with the original description. To proceed with a meaningful integrative taxonomic revision of Hermeuptychia, it is essential to stabilize the identity of S. cantheus by a neotype that while being in a reasonable agreement with the original description, minimally disrupts currently used taxonomic arrangement and allows more detailed genomic studies of the neotype. DNA work plays a highly significant role in Hermeuptychia studies (Cong and Grishin 2014; Seraphim et al. 2014; Tan et al. 2021). Therefore, the neotype should facilitate DNA-based studies.

First, we agree with Viloria (2021) that S. cantheus is most likely a Hermeuptychia. Its description is rather similar to the descriptions of other Hermeuptychia species by these authors. Second, in agreement with the original type locality (“North America”, which nevertheless could have been an error and simply carried by default from P. canthus, which is L. eurydice), we aim to select a neotype from North America. North American Hermeuptychia are typically decisively smaller than L. eurydice, and the largest populations are known from the southeastern USA, which is also a general area that contributed type specimens for many early butterfly names. Therefore, we looked for a southeastern USA Hermeuptychia specimen that matches best the original description of S. cantheus. The specimen that we hereby designate as the neotype of Satyrus cantheus Godart, [1824] is the male pictured in Figs. 31, 32. It largely agrees with the original description: immaculate brown on dorsal side; ventral side paler, with 2 brownish lines on both wings, 3 not very large eyespots on the forewing, 6 on the hindwing, out of which the 5th is large and the 6th by the anal angle is smaller. The discrepancies with the original description are: the 5th eyespot is the same size as the 2nd eyespot (not larger); the 6th eyespot, while being small, is larger than the 1st (not the smallest); and this being large for a USA Hermeuptychia specimen (FW length 17 mm) is still smaller than a typical L. eurydice. However, due to significant variation in Hermeuptychia eyespots, we were satisfied with the reasonable match to the description, and did not invest additional effort into looking for a perfect match. Additional advantage of this specimen is the availability of DNA sequences.

Our neotype of S. cantheus satisfies all the requirements set forth by the ICZN Article 75.3. Namely: 75.3.1. It is designated to clarify the taxonomic identity of Satyrus cantheus Godart, [1824], which remained undefined until now, impeding research on Hermeuptychia; 75.3.2. The characters that differentiate this taxon have been given in its original description by Godart ([1824]: 465, 493–494), i.e., wings brown on dorsal side, ventral side paler, with two ferruginous lines spanning both wings, forewing with three weakly defined eyespots and hindwing with six; 75.3.3. The neotype specimen is a male that bears the following six rectangular labels: [St. Petersburg, Fla. | XI-3–1938], [H. E. Wilford | collector], [96], [Ernest Shoemaker | Collection 1956], [DNA sample ID: | 11-BOA-15609E04 | c/o Nick V. Grishin], and [NEOTYPE ♂ | Satyrus cantheus | Godart, [1824] | designated by Grishin] and its partial COI barcode sequence has been deposited in GenBank with accession KJ025563 (Cong and Grishin 2014); 75.3.4. Our search for the lectotype is described above, but it was unsuccessful, leading us to believe that the lectotype is no longer extant; 75.3.5. The neotype is consistent with what is known about this taxon, in particular with the original description: e.g. ventrally, it has 3 less prominent eyespots on the forewings and 6 eyespots on the hindwings, the 5th of which is large and the one by the anal angle is small; 75.3.6. The neotype is from USA: Florida: Pinellas Co., St. Petersburg, and the lectotype was stated to be from North America with no other details given about the locality; 75.3.7. The neotype is in the collection of the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM).

The neotype of S. cantheus is the species known today as Hermeuptychia sosybius (Fabricius, 1793) (Cong and Grishin 2014): it has patches of darker androconia on the dorsal surface of the wings and its COI barcode sequence is identical to that of the H. sosybius neotype. Therefore, Satyrus cantheus Godart, [1824] is a junior subjective synonym of Hermeuptychia sosybius (Fabricius, 1793).

Papilio camerta Cramer, 1780 is a nomen dubium

Only the ventral side is illustrated in the original description of Papilio camerta Cramer, 1780 (type locality Suriname). The wings exhibit 2 median lines, 3 marginal lines, and small and similarly-sized submarginal dark eyespots: 4 on the forewing (no eyespot in cell R5-M1 by the apex) and 6 on the hindwing, each encircled with yellow and pupillated with silvery-blue. We also inspected and photographed the original drawing of P. camerta by G. W. Lambertz in the Library of the Natural History Museum, London, that served as a model for published engravings (Gilbert 2000). The Lambertz drawings, which are usually more accurate than stylized engravings, could help identify the species illustrated. Indeed, the Lambertz drawing of P. camerta reveals differences between the eyespots in this specimen: all forewing eyespots and the 4th eyespot on the hindwing (in cell M3-CuA1) are brown, others are black.

The ventral wing pattern combined with small size (forewing length 17 mm on the drawing) suggest that P. camerta may indeed be a Hermeuptychia species as currently placed (Lamas 2004). However, there is no dark dash at the end of the ventral forewing discal cell, and the description clearly mentions an eyespot (encircled yellow and pupillated with a silvery dot) on the dorsal forewing “extremities” (Cramer 1780). We know of no species worldwide that match the P. camerta description together with the Lambertz illustration. Similarly to Weymer (1910–1912), we cannot explain the dorsal forewing eyespot mentioned in the original description, and for this reason place Papilio camerta Cramer, 1780 as a nomen dubium until a meaningful explanation can be found.

Assuming a number of inaccuracies, we can offer a hypothesis about the identity of P. camerta. Silver pupils in some eyespots on the Lambertz drawing are not round but irregular, and seemingly made by more than one stroke of a brush (they are rounder on the engraving though) (Fig. 38). It is unclear whether this is an imperfection of the drawing, or it meant to depict bipupillated eyespots. If the eyespots were bipupillated, then this species could have been Paryphthimoides poltys (Prittwitz, 1865) or a relative, and the dorsal eyespot might have been on the “extremities” of the hindwings (not forewings: a possible mistake in the description), as in Paryphthimoides Forster, 1964. In some specimens of P. poltys, the differences between eyespots agree with the Lambertz illustration: the forewing eyespots and the 4th hindwing eyespot are more brown than black, and the dashes at the end of the discal cells are vestigial on both wings. Thus, if “tippen” (Dutch) / “extremités “(French) meant anal angle, forewing was a lapsus calami for hindwing, and with irregular silvery-blue dots in the eyespots Lambertz was depicting bipupillation, then P. camerta may be conspecific with P. poltys. Alternatively, is it conceivable that the dorsal eyespot mentioned in the description may have been on a specimen of a different species than the one illustrated by Lambertz, making the type series polytypic. These issues remain to be investigated and the best compromise reached. While we are not able to solve the problem of the P. camerta identity, to facilitate its eventual resolution, we illustrate the Lambertz drawing, the published engraving, and provide translations of the original description (Fig. 38).

Fig. 38. Papilio camerta Cramer, 1780.

Fig. 38.

The original drawing (Lambertz, insets show enlarged right hindwing eyespots, © The Trustees of the Natural History Museum London, used with permission), published engraving and original description (Cramer 1780), its translation, and the text from Weymer (1911).

ACKNOWLEDGMENTS

We are grateful to Blanca Huertas, David Lees and Geoff Martin (BMNH: Natural History Museum, London, UK), Rodolphe Rougerie (MNHP: Muséum National d’Histoire Naturelle, Paris, France), Alex Wild (TMMC: University of Texas Biodiversity Center, Austin, TX, USA), Robert K. Robbins, John M. Burns, and Brian Harris (USNM: National Museum of Natural History, Smithsonian Institution, Washington, DC, USA) and Wolfram Mey and Viola Richter (ZMHB: Museum für Naturkunde, Berlin, Germany) for granting access to the collections under their care and help; James A. Scott for specimens; Bernard Hermier, Noemy Seraphim, and Keith Willmott for stimulating discussions, advice and helpful suggestions, Paul A. Opler and David M. Wright for insightful discussions and critical review of the manuscript. We are indebted to the Texas Parks and Wildlife Department (Natural Resources Program Director David H. Riskind) for research permit 08-02Rev to N.V.G. A.V.L.F. thanks the Brazilian Research Council - CNPq (fellowship 304291/2020-0) and NSF (DEB-1256742); E.P.B. was supported by Brazilian Research Council – CNPq - (162673/2020-5); M.A.M. was supported by Fapesp (2018/11910-1) and CAPES (Finance code 001). This study has been supported in part by grants from the National Institutes of Health GM127390 and the Welch Foundation I-1505 to N.V.G.

Footnotes

LITERATURE CITED

  1. Barbosa T 2019. Photograph to be found on iNaturalist [Online database]. Available from: <https://www.inaturalist.org/observations/97192375> [Accessed: 20 October 2021].
  2. Beccaloni G, Scoble M, Kitching I, Simonsen T, Robinson G, Pitkin B, Hine A, and Lyal C. 2003. The Global Lepidoptera Names Index (LepIndex). World Wide Web electronic publication; https://www.nhm.ac.uk/our-science/data/lepindex/lepindex/ [accessed 16 October 2021]. [Google Scholar]
  3. Braun H 2019. Photograph to be found on iNaturalist [Online database]. Available from: <https://www.inaturalist.org/observations/34332923 [Accessed: 20 October 2021].
  4. Burmeister H 1878. Description physique de la République Argentine d’après des observations personnelles et étrangeres. 5. Lépidoptères. Première partie. Contenant les diurnes, crépusculaires et bombycoïdes Buenos Aires: P. E. Coni; Paris: F. Savy; Halle: E. Anton. vi + 526 pp. [Google Scholar]
  5. Calhoun JV 2018. John Abbot, Jacob Hübner and Oreas helicta (Nymphalidae: Satyrinae). News of the Lepidopterists’ Society 60(4): 159–163. [Google Scholar]
  6. Cardé RT, Shapiro AM, and Clench HK. 1970. Sibling species in the eurydice group of Lethe (Lepidoptera: Satyridae). Psyche: A Journal of Entomology 77(1): 70–103. [Google Scholar]
  7. Cong Q, and Grishin NV. 2014. A new Hermeuptychia (Lepidoptera, Nymphalidae, Satyrinae) is sympatric and synchronic with H. sosybius in southeast US coastal plains, while another new Hermeuptychia species - not hermes - inhabits south Texas and northeast Mexico. Zookeys (379): 43–91. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Cong Q, Shen J, Zhang J, Li W, Kinch LN, Calhoun JV, Warren AD, and Grishin NV. 2021. Genomics reveals the origins of historical specimens. Molecular Biology and Evolution 38(5): 2166–2176. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Cramer P 1780. De uitlandsche Kapellen voorkomende in de drie Waereld-Deelen Asia, Africa en America. Papillons exotiques des trois parties du monde l’Asie, l’Afrique et l’Amérique. Amsteldam: S.J. Baalde; Utrecht, Barthelemy Wild and J. Van Schoonhoven & Comp 4(25/26): 1–28, pls. 289–304. [Google Scholar]
  10. D’Abrera B 1988. Butterflies of the Neotropical Region. Part V. Nymphalidae (Conc.) & Satyridae Victoria, Black Rock: Hill House. [viii] + pp. 679–877. [Google Scholar]
  11. Fabricius JC 1775. Systema entomologiae, sistens insectorvm classes, ordines, genera, species, adiectis synonymis, locis, descriptionibvs, observationibvs. Flensburgi et Lipsiae: Officina Libraria Kortii. [iv] + [xii] + [xvi] + 832 pp. [Google Scholar]
  12. Fabricius JC 1781-[1782]. Species insectorvm exhibentes eorvm differentias specificas, synonyma avctorvm, loca natalia, metamorphosin adiectis observationibvs, descriptionibvs. Hamburgii et Kilonii: Carol. Ernest. Bohnii 2: 517 + [i] pp. [Google Scholar]
  13. Fabricius JC 1793. Entomologia systematica emendata et aucta. Secundum classes, ordines, genera, species adjectis synonimis, locis, observationibus, descriptionibus. Hafniae: C. G. Proft, Fil. et Soc 3(1): [vi] + 488 pp. [Google Scholar]
  14. Forster W 1964. Beiträge zur Kenntnis der Insektenfauna Boliviens XIX. Lepidoptera III. Satyridae. Veröffentlichungen der zoologischen Staatssammlung München 8: 51–188. [Google Scholar]
  15. Freitas AVL, Barbosa EP, and Carreira JYO. 2021. Immature stages and natural history of Yphthimoides borasta (Nymphalidae: Euptychiina). Tropical Lepidoptera Research 31(1): 42–47. [Google Scholar]
  16. Freitas AVL, Emery EO, and Mielke OHH. 2010. A new species of Moneuptychia Forster (Lepidoptera: Satyrinae: Euptychiina) from Central Brazil. Neotropical Entomology 39(1): 83–90. [DOI] [PubMed] [Google Scholar]
  17. Gascuel O 1997. BIONJ: an improved version of the NJ algorithm based on a simple model of sequence data. Molecular Biology and Evolution 14(7): 685–695. [DOI] [PubMed] [Google Scholar]
  18. Gilbert P 2000. Butterfly collectors and painters: four centuries of colour plates from the library collections of The Natural History Museum, London. Singapore: Beaumont. 166 pp., 60 pl. [Google Scholar]
  19. Godart JB [1824]. [Papillons]. pp. 329–828. In: Latreille PA, and Godart JB (Eds.). Encyclopédie Méthodique. Histoire naturelle. Entomologie, ou Histoire Naturelle des Crustacés, des Arachnides et des Insectes Paris: veuve Agasse. 9(2). [Google Scholar]
  20. Hemming AF 1937. Hübner. A bibliographical and systematic account of the entomological works of Jacob Hübner and of the supplements thereto by Carl Geyer, Gottfried Franz von Fröhlich and Gottlieb August Wilhelm Herrich-Schäffer. London, Royal Entomological Society. 1: xxxiv + 605 pp., frontisp; 2: ix + [1] + 270 pp. [Google Scholar]
  21. Hübner J 1823. Zuträge zur Sammlung exotischer Schmettlinge, bestehend in Bekundigung einzelner Fliegmuster neuer oder rarer nichteuropäischer Gattungen. Augsburg: Jacob Hübner. 2: 1–40. [Google Scholar]
  22. ICZN [International Commission on Zoological Nomenclature]. 1999. International Code of Zoological Nomenclature. Fourth edition. London: The International Trust for Zoological Nomenclature. xxx + 306 pp. [Google Scholar]
  23. Jukes TH, and Cantor CR. 1969. Evolution of protein molecules. pp. 21–132 In: Munro HN (Ed.). Mammalian Protein Metabolism. New York: Academic Press. [Google Scholar]
  24. Lamas G 2004. Nymphalidae. Satyrinae. Tribe Satyrini. Subtribe Euptychiina. pp. 217–223. In: Lamas G (Ed.). Checklist: Part 4A. Hesperioidea - Papilionoidea In: Heppner JB (Ed.), Atlas of Neotropical Lepidoptera. Volume 5A. Gainesville: Association for Tropical Lepidoptera / Scientific Publishers. [Google Scholar]
  25. Miller LD, and Brown FM. 1981. A catalogue / checklist of the butterflies of America north of Mexico. Memoir. The Lepidopterists’ Society 2: vii + 280 pp. [Google Scholar]
  26. Nakahara S, Tan D, Lamas G, Parus A, and Willmott KR. 2017. A distinctive new species of Hermeuptychia Forster, 1964 from the eastern tropical Andes (Lepidoptera: Nymphalidae: Satyrinae). Tropical Lepidoptera Research 26(2): 77–84. [Google Scholar]
  27. National Museums of Scotland. 2021. The collections database <https://www.nms.ac.uk/explore-our-collections/search-our-collections/> [accessed 27 October 2021].
  28. Ratnasingham S, and Hebert PD. 2007. BOLD: The Barcode of Life Data System (http://www.barcodinglife.org). Molecular Ecology Notes 7(3): 355–364. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Reakirt T [1867]. Descriptions of some new species of diurnal Lepidoptera. Series II. Proceedings of the Academy of Natural Sciences of Philadelphia 18(4): 331–336. [Google Scholar]
  30. Scudder SH 1875. Synonymic list of the butterflies of North America, North of Mexico. Part I. Nymphales. Bulletin of the Buffalo Society of Natural Sciences: 2(4): 233–269. [Google Scholar]
  31. Seraphim N, Marín MA, Freitas AVL, and Silva-Brandão KL. 2014. Morphological and molecular marker contributions to disentangling the cryptic Hermeuptychia hermes species complex (Nymphalidae: Satyrinae: Euptychiina). Molecular Ecology Resources 14(1): 39–49. [DOI] [PubMed] [Google Scholar]
  32. Tan D, Parus A, Dunbar M, Espeland M, and Willmott KR. 2021. Cytochrome c oxidase subunit I barcode species delineation methods imply critically underestimated diversity in ‘common’ Hermeuptychia butterflies (Lepidoptera: Nymphalidae: Satyrinae). Zoological Journal of the Linnean Society zlab007. [Google Scholar]
  33. University of Copenhagen. 2021. Fabricius’ collection <https://samlinger.snm.ku.dk/en/dry-and-wet-collections/zoology/entomology/fabricius-collection/> [accessed on 17 October 2021].
  34. University of Glasgow. 2021. The Hunterian Collections search <http://collections.gla.ac.uk/#/advancedsearch> [accessed 17 October 2021].
  35. Viloria AL 2021. “The Hermeuptychia Papers”. Anartia 32: 26–52. [Google Scholar]
  36. Warren AD, Davis KJ, Stangeland EM, Pelham JP, Willmott KR, and Grishin NV. 2016. Illustrated Lists of American Butterflies. [21-XI-2017].
  37. Weymer G 1910–1912. 4. Familie: Satyridae. pp. 173–280. In: Seitz A (Ed.). Die Gross-Schmetterlinge der Erde. Stuttgart: A. Kernen. 5. [Google Scholar]
  38. Zacca T, Casagrande MM, Mielke OHH, Huertas B, Barbosa EP, Freitas AVL, and Willmott KR. 2020. Description of Emeryus Zacca, Mielke & Casagrande gen. nov. (Lepidoptera: Nymphalidae) to accommodate three species formerly placed in Paryphthimoides Forster, 1964. Austral Entomology 59(3): 505–523. [Google Scholar]
  39. Zacca T, Casagrande MM, Mielke OHH, Huertas B, Freitas AVL, Marín MA, Espeland M, and Willmott KR. 2021. A new euptychiine butterfly species from south Brazil and taxonomic rearrangements for Taydebis Freitas, 2013 and Hermeuptychia Forster, 1964 (Lepidoptera: Nymphalidae: Satyrinae). Zootaxa 5023(4): 555–570. [DOI] [PubMed] [Google Scholar]
  40. Zimsen E 1964. The type material of I. C. Fabricius Copenhagen: Munksgaard. 656 pp., 3 figs. [Google Scholar]

RESOURCES