Abstract
Lactobacillus paragasseri was identified as a novel sister taxon of L. gasseri in 2018. Since the reclassification of L. paragasseri, there has been hardly any report describing the probiotic properties of this species. In this study, an L. paragasseri strain UBLG-36 was sequenced and analyzed to determine the molecular basis that may confer the bacteria with probiotic potential. UBLG-36 was previously documented as an L. gasseri strain. Average nucleotide identity and phylogenomic analysis allowed accurate taxonomic identification of UBLG-36 as an L. paragasseri strain. Analysis of the draft genome (~1.94 Mb) showed that UBLG-36 contains 5 contigs with an average G+C content of 34.85%. Genes essential for the biosynthesis of bacteriocins, adhesion to host epithelium, stress resistance, host immunomodulation, defense, and carbohydrate metabolism were identified in the genome. Interestingly, L. paragasseri UBLG-36 also harbored genes that code for enzymes involved in oxalate catabolism, such as formyl coenzyme A transferase (frc) and oxalyl coenzyme A decarboxylase (oxc). In vitro oxalate degradation assay showed that UBLG-36 is highly effective in degrading oxalate (averaging more than 45% degradation), a feature that has not been reported before. As a recently identified bacterium, there are limited genomic reports on L. paragasseri, and our draft genome sequence analysis is the first to describe and emphasize the probiotic potential and oxalate degrading ability of this species. With results supporting the probiotic functionalities and oxalate catabolism of UBLG-36, we propose that this strain is likely to have immense biotechnological applications upon appropriate characterization.
Introduction
The presence of oxalate degrading bacteria in the human gut microbiome is essential as humans lack the enzymes required to metabolize endogenous and dietary oxalate. Free oxalate in the gut is mostly eliminated via urine or feces (as insoluble calcium oxalate conjugate) or metabolized by oxalate degrading gut bacteria. However, disruption of oxalate homeostasis leads to over-accumulation of oxalate, which is a notable cause of several pathological conditions such as hyperoxaluria [1], calcium oxalate urolithiasis [2], cardiomyopathy [3], and renal failure [4]. Consequently, in recent years, there has been an increased focus on the use of probiotics for the prevention of oxalate related disorders [5], mostly those that belong to the genera Lactobacillus and Bifidobacterium [6], perhaps because they are considered generally recognized as safe (GRAS) for human consumption. Among the Lactobacillus species, strains of L. acidophilus and L. gasseri have been most widely studied for their general ability to utilize oxalate and other substrates such as glucose as a source of energy.
L. gasseri is an obligate homofermentative, facultative anaerobe in the family of lactic acid bacteria (LAB) first identified in 1980 [7]. Since the availability of the first complete genome sequence of L. gasseri, several draft-phase or complete genomes of this organism have been deposited in public databases. In a recent study by Tanizawa and colleagues [8], a distinct species of L. gasseri was identified based on whole-genome average nucleotide identity (ANI) analysis. This new species of bacteria was termed L. paragasseri, and it represents a novel sister taxon of L. gasseri. A study comparing the genetic diversity of 13 strains of L. gasseri and 79 strains of L. paragasseri showed a clear distinction between these two species, particularly in their clustered regularly interspaced short palindromic repeats (CRISPR), bacteriocins, and their carbohydrate utilization patterns [9]. However, despite the genetic differences, the comparative pan-genome analysis also indicates a higher rate of interspecies gene exchange between L. gasseri and L. paragasseri [9]. Like its sister taxon, L. paragasseri harbors genes that code for enzymes involved in oxalate catabolism. In this two-step process, formyl coenzyme A transferase (EC 2.8.3.16) encoded by the frc gene catalyzes the transfer of CoA from formyl-CoA to oxalate [10]. This activated oxalate molecule is then decarboxylated by the enzyme oxalyl coenzyme A decarboxylase (EC 4.1.1.8) encoded by the oxc gene [10]. While the oxalate utilizing abilities of L. gasseri and its probiotic relevance has been studied [11, 12], there is hardly any evidence on L. paragasseri for the same.
In this study, UBLG-36, a commercially available strain hitherto identified as L. gasseri, was sequenced and re-classified as L. paragasseri based on whole-genome relatedness. We performed several bioinformatic analyses to better understand its genomic features, specifically those that may likely contribute to the probiotic properties of the strain. We also identified genes putatively associated with oxalate catabolism and analyzed the ability of the strain to degrade oxalate in vitro.
Materials and methods
Bacterial source and identification
A commercial probiotic strain UBLG-36, initially identified as L. gasseri, was purchased from Unique Biotech Limited (Hyderabad, India). L. acidophilus DSM 20079 and L. casei ATCC 334 were purchased from the German Collection of Microorganisms and Cell Cultures GmbH (Germany) and American Type Culture Collection (USA), respectively. Strains were cultured in Lactobacillus De Man, Rogosa, and Sharpe (MRS) selective medium at 37°C under the aerobic condition for 18–24 hours. UBLG-36 was subjected to 16S rRNA sequencing, and verification of its accurate taxonomic identification was performed on the EzBiocloud (https://www.ezbiocloud.net/) online platform.
Genome sequencing, assembly, and annotation
Unless otherwise mentioned, only the default parameters were used in the software. Whole-genome sequencing of the strain UBLG-36 was performed on Illumina Miseq platform by Illume Gene India LLP Company (Bengaluru, India), and the raw sequencing reads were uploaded to Galaxy Europe genome analysis tool (http://usegalaxy.eu/). De novo assembly of the trimmed reads was performed on Unicycler 0.4.8.0 [13] using the normal bridging mode. Contigs shorter than 100 base pairs were excluded, and the assembly quality was improved using the Multi-Draft-based Scaffolder (MeDuSa) [14]. Annotation of the draft assembly was performed by the NCBI Prokaryotic Genome annotation pipeline (PGAP) [15]. The assembled genome was also analyzed using the RASTtk pipeline of the Rapid Annotations using Subsystems Technology (RAST) online platform (http//rast.nmpdr.org) [16]. EggNOG mapper 4.5 [17] was used to determine the clusters of orthologous groups (COGs) of proteins. Carbohydrate-active enzymes (CAZymes) were searched against the CAZy database using the dbCAN2 meta server [18]. Secondary metabolite-related genes/gene clusters were predicted using antiSMASH 3.0 [19]. ResFinder tool [20] and the Comprehensive Antibiotic Resistance Database (CARD) [21] was used to test for antibiotic resistance genes. Prophage genes were searched using PHASTER [22], and the prediction of the CRISPR-Cas system was carried out using CRISPRCas Finder [23]. Protein sequences that were likely to determine the putative probiotic properties of UBLG-36 were searched individually against the NCBI Conserved Domain Database [24].
Phylogenomic analysis
Representative complete genome sequences of L. gasseri and L. paragasseri were obtained from the NCBI database (S1 Table). 16S rDNA sequences were mined from these complete representative genomes, and together with the 16S rDNA sequence of UBLG-36, pairwise sequence similarities were calculated via the Type (Strain) Genome Server (TYGS) [25] available at https://tygs.dsmz.de/. Phylogenies based on maximum likelihood and maximum parsimony were inferred by the TYGS web server. Draft genome sequence of UBLG-36 and eleven representative complete genome data were uploaded to the JspeciesWS server [26] and the TYGS [25] for calculating ANI values and pairwise comparison of genome sequences, respectively.
Coding sequences (CDS) of oxc and frc from the UBLG-36 genome and the eleven representative complete genomes of L. gasseri and L. paragasseri were mined from the NCBI database. These CDS were aligned using the MAFFT webtool [27], and the residue-wise confidence scores were obtained using the GUIDANCE2 [28] application. Phylogenetic tree construction was performed by the MAFFT tool using the Neighbor-Joining method with 1000 bootstrap resampling. Default software parameters were used for all phylogenomic analyses.
Oxalate degradation assay
The oxalate degrading ability of UBLG-36 was determined in vitro. Two MRS culture media with 10 mM and 20 mM sodium oxalate (MRS-ox) (pH 5.5) were prepared as described earlier [29]. Culture broths were inoculated with 1% bacterial culture grown overnight and incubated at 37°C for 1, 5 and 10 days under aerobic conditions. MRS-ox broth without bacterial inoculum was used as a control. L. acidophillus DSM 20079 (NZ_CP020620; harboring both oxc and frc) was used as the positive control, while L. casei ATCC 334 (NC_008526; lacking oxc and frc) served as the negative control. Before the analysis, culture broth and control media were centrifuged at 4000 g for 10 minutes, and the supernatant was filtered through a 0.45-micron filter. Oxalate concentration in the filtrate was measured in triplicates using an oxalate assay kit (Sigma, USA) as per the manufacturer’s instructions.
Statistical analysis
The results are presented as mean ± standard error of mean (SEM). A one-way analysis of variance (ANOVA) followed by Tukey’s test was performed to compare the concentration of oxalate degraded by the bacterial strains. A two-way analysis of variance (ANOVA) followed by Tukey’s test was performed to compare percentage oxalate degradation at 10 mM and 20 mM MRS-Ox at three different time points by the bacterial strains. Comparison between datasets were considered statistically significant at p<0.05 (indicated as ***p<0.001, ###p<0.001, and ##p<0.01). Statistical analysis was performed on Graph Pad Prism 9.2.0 for Windows, GraphPad Software, San Diego, California USA (www.graphpad.com).
Results and discussion
Initial identification
The commercially purchased L. gasseri UBLG-36 strain was subjected to an initial verification by 16S rRNA sequencing. Sequencing identified UBLG-36 as a strain belonging to L. paragasseri and not L. gasseri. To better understand the reason behind the misidentification of species assignment, we performed a detailed phylogenomic analysis (see below) after sequencing the draft genome.
Phylogenomic analysis
To verify the result of the initial 16S rRNA sequencing, we compared the 16S rDNA sequence of UBLG-36 (obtained from the draft genome) to those of the reference genomes (comprising complete genome sequences of 4 L. paragasseri and 7 L. gasseri strains). Although UBLG-36 formed a separate clade with high similarity to four other L. paragasseri strains (JCM 5343, JV V03, NCK1347, and NCTC13720), four L. gasseri strains (EJL, MGYG-HGUT-02387, HL70, and HL75) were also found within this clade (Fig 1A). As whole-genome comparison can yield better microbial resolution and identification than 16S rDNA analysis, we performed a pairwise comparison of the UBLG-36 draft genome with all eleven available complete genome sequences. Consistent with the results of the 16S rDNA comparison, UBLG-36 showed high whole-genome relatedness with three L. gasseri strains (EJL, MGYG-HGUT-02387, and HL70) than the L. paragasseri strains (Fig 1B). ANI calculation also showed that UBLG-36 shared more than 98% identity with L. gasseri EJL, L. gasseri MGYG-HGUT-02387, L. gasseri HL70, and L. gasseri HL75 (S2 Table). According to a previous report, several strains of L. gasseri available in the public databases are misidentified and are likely members of L. paragasseri species [30]. To investigate the likelihood of the four L. gasseri strains (EJL, MGYG-HGUT-02387, HL70 and HL75HL70 and HL75) belonging to L. paragasseri species, we calculated the ANI values of their genomes on the JspeciesWS server through pairwise comparison at the 95% threshold with all other publicly available complete genomes of L. gasseri and L. paragasseri. ANI values indicated that EJL and MGYG-HGUT-02387 shared more than 97% identity with L. paragasseri strains, whereas, with L. gasseri strains, the identity was less than 95%, which is less than the widely accepted threshold (Table 1). Although UBLG-36 was purchased as an L. gasseri strain, our analyses thus provide evidence for the taxonomic identification of UBLG-36 as L. paragasseri. Also, strains EJL, MGYG-HGUT-02387, HL70, and HL75, currently identified as L. gasseri, should be considered for reclassification into L. paragasseri.
Fig 1. Phylogenomic analysis of Lactobacillus paragasseri UBLG-36.
(a) Phylogenetic relationship between Lactobacillus paragasseri UBLG-36 and other L. gasseri and L. paragasseri strains. Phylogenetic tree construction was based on the pairwise sequence similarities of the 16S rDNA sequences mined from the complete representative genome sequences and draft genome sequence of UBLG-36. Tree calculation and inference were carried out on the TYGS web server (http://tygs.dsmz.de/). L. paragasseri UBLG-36 is depicted in bold. (b) Phylogenomic comparison of Lactobacillus paragasseri UBLG-36 with representative complete genomes of other L. gasseri and L. paragasseri strains. A pairwise comparison of the whole genomes was carried out on the TYGS web server, and the tree was inferred from GBDP distances calculated from the genome sequences. L. paragasseri UBLG-36 is depicted in bold.
Table 1. ANI values of Lactobacillus gasseri EJL, L. gasseri MGYG-HGUT-02387, L. gasseri HL70 and L. gasseri HL75 with other L. gasseri and L. paragasseri strains.
| Genomes | EJL | MGYG-HGUT-02387 | HL70 | HL75 | ||||
|---|---|---|---|---|---|---|---|---|
| ANIba [%] | Aligned [%] | ANIba [%] | Aligned [%] | ANIba [%] | Aligned [%] | ANIba [%] | Aligned [%] | |
| Lactobacillus paragasseri JCM 5343 | 98.39 | 78.97 | 98.39 | 80.67 | 98.30 | 82.60 | 97.86 | 84.45 | 
| Lactobacillus paragasseri NCTC13720 | 97.86 | 77.83 | 98.10 | 79.48 | 97.94 | 83.14 | 97.81 | 85.22 | 
| Lactobacillus paragasseri JV-V03 | 98.17 | 76.24 | 98.17 | 78.36 | 98.17 | 80.76 | 97.92 | 85.16 | 
| Lactobacillus paragasseri strain NCK1347 | 97.97 | 75.72 | 97.98 | 77.89 | 97.93 | 80.30 | 97.00 | 85.78 | 
| Lactobacillus gasseri ATCC 33323 | 93.26 | 72.49 | 93.11 | 74.68 | 93.27 | 76.90 | 92.89 | 82.40 | 
| Lactobacillus gasseri DSM 14869 | 93.07 | 71.52 | 93.11 | 75.34 | 93.05 | 76.06 | 93.13 | 82.05 | 
| Lactobacillus gasseri HL20 | 93.23 | 71.53 | 93.14 | 73.88 | 93.31 | 76.27 | 93.07 | 80.85 | 
aANIb refers to Average Nucleotide Identity Blast.
General genome features
The bacterial strain UBLG-36 (henceforth referred to as L. paragasseri UBLG-36), when subjected to whole-genome sequencing using Illumina MiSeq platform generated 4,313,094 paired-end reads (2 x 151 bp) sequences. The reads were uploaded to Galaxy Europe web genome analysis platform for quality assessment and read trimming. The resulting 3,513,720 paired-end reads were de novo assembled using Unicycler 0.4.8.0, and the assembly was further improved using MeDuSa. The final draft genome sequence of UBLG-36 showed 5 contigs covering a total length of 1,941,907 bp, with a G + C content of 34.85% and an N50 of 77,703 bp (Table 2). Annotation of the draft genome using the NCBI PGAP predicted a total of 1918 genes, including 1766 protein-coding genes, 3 rRNAs, 52 tRNAs, 3 ncRNAs, 1 tmRNA and 94 pseudogenes (Table 2). There were no plasmid sequences identified in the genome. Both ResFinder and CARD revealed that the genome of UBLG-36 harbored no antibiotic-resistant genes. Analysis of the genome on RAST using the annotated genes provided a general overview of the coded biological features with a subsystem coverage of 27% (Table 3).
Table 2. General genome features of Lactobacillus paragasseri UBLG-36.
| Attribute | Value | 
|---|---|
| Genome size (bp) | 1,941,907 | 
| Number of contigs | 5 | 
| DNA G + C content (%) | 34.85 | 
| N50 (bp) | 77,703 | 
| Total number of genes | 1,918 | 
| Total number of protein-coding genes | 1,766 | 
| rRNAs | 3 | 
| tRNAs | 52 | 
| ncRNAs | 3 | 
| tmRNAs | 1 | 
| Pseudogenes | 94 | 
| Plasmid | 0 | 
| Prophages (intact) | 1 | 
| CRISPR arrays | 1 | 
Table 3. General overview of biological subsystem distribution of the annotated genes.
| Description | Value | Percent (%) | 
|---|---|---|
| Cofactors, vitamins, prosthetic groups, pigments | 46 | 6.9 | 
| Cell wall and capsule | 48 | 7.2 | 
| Virulence, disease and defense | 40 | 6 | 
| Potassium metabolism | 9 | 1.3 | 
| Miscellaneous | 3 | 0.4 | 
| Phages, prophages, transposable elements, plasmids | 18 | 2.7 | 
| Membrane transport | 25 | 3.7 | 
| Iron acquisition and metabolism | 4 | 0.6 | 
| RNA metabolism | 31 | 4.6 | 
| Nucleosides and nucleotides | 67 | 10 | 
| Protein metabolism | 123 | 18.4 | 
| Cell division and Cell cycle | 4 | 0.6 | 
| Regulation and cell signaling | 14 | 2.1 | 
| Secondary metabolism | 2 | 0.3 | 
| DNA metabolism | 57 | 8.5 | 
| Fatty acids, lipids, and isoprenoids | 25 | 3.7 | 
| Dormancy and sporulation | 5 | 0.7 | 
| Respiration | 13 | 1.9 | 
| Stress response | 6 | 0.9 | 
| Metabolism of aromatic compounds | 2 | 0.3 | 
| Amino acids and derivatives | 39 | 5.8 | 
| Sulfur metabolism | 2 | 0.3 | 
| Carbohydrates | 83 | 12.4 | 
Functional classification
Of the predicted protein sequences queried in EggNOG mapper 4.5, 1636 proteins (92.64%) were assigned to 18 clusters of orthologous groups (COG) classes (Fig 2). Function unknown (S, 362 proteins) was the most common among all categories. Other proteins were classified into functional categories such as translation, ribosomal structure and biogenesis (J, 157 proteins); transcription (K, 146 proteins); replication, recombination and repair (L, 123 proteins); cell cycle control, cell division, chromosome partitioning (D, 31 proteins); defense mechanisms (V, 53 proteins); signal transduction mechanisms (T, 29 proteins); cell wall/membrane/envelope biogenesis (M, 93 proteins); Cell motility (N, 7 proteins); intracellular trafficking, secretion, and vesicular transport (U, 42 proteins); posttranslational modification, protein turnover, chaperones (O, 38 proteins); energy production and conversion (C, 54 proteins); carbohydrate transport and metabolism (G, 142 proteins); amino acid transport and metabolism (E, 92 proteins); nucleotide transport and metabolism (F, 87 proteins); coenzyme transport and metabolism (H, 39 proteins); lipid transport and metabolism (I, 36 proteins); inorganic ion transport and metabolism (P, 97 proteins); secondary metabolites biosynthesis, transport and catabolism (Q, 8 proteins).
Fig 2. COG functional categories assigned to the proteins of Lactobacillus paragasseri UBLG-36.
Carbohydrate-active enzymes (CAZymes)
Carbohydrate metabolism is gaining popularity as a trait supporting the probiotic potential of LAB [31]. Carbohydrate metabolism provides the main source of metabolic energy in LAB and plays an important role in the survival and fitness of Lactobacillus in their ecological niche by contributing to cellular processes such as energy production and stress response [32]. For example, in L. paragasseri presence of CAZymes have been shown to degrade non-digestible oligosaccharide, such as ketose and fructo-oligosaccharides thereby, selectively promoting growth and survival of the species within the host [33]. The genome of UBLG-36 was searched for CAZymes, and only those annotations that matched two or more tools in the dbCAN meta server were considered (S1 Fig). CAZymes analysis showed that UBLG-36 contains 29 genes that encode glycoside hydrolases (GHs), 26 genes that encode glycosyltransferases (GTs), 1 gene for carbohydrate esterase (CE), and 1 gene for carbohydrate-binding modules (CBMs) (S3 Table). These genes are essential for the bacteria’s adaptation to the gastrointestinal environment and its interaction with the host since they are involved in the metabolism and assimilation of complex non-digestible carbohydrates [34]. For example, O-linked glycosylation on serines catalyzed by GTs can produce structures that are similar to mucins and may also facilitate adhesion to host cell mucoproteins [35]. Therefore, we believe that the presence of these enzymes will aid UBLG-36 in its survival, competitiveness, and persistence within the host.
Secondary metabolites
Bacteriocins constitute a significant class of antimicrobial peptides produced by LAB [36]. These heat-labile, antimicrobial peptides have been used in the diary and cosmetic industry and in human and veterinary medicine for their ability to inhibit spoilage and pathogenic bacteria [37]. Prediction of secondary metabolites related genes or gene clusters using antiSMASH showed three biosynthetic clusters of bacteriocins with high overall similarity to Gassericin-T, Gassericin-S, and Acidocin-B (S4 Table).
Prophages
Prophages are commonly found in genomes of Lactobacillus species [38]. Only one complete intact prophage locus (204,490 bp– 244,972 bp) was identified with a GC content of 36.41% (S5 Table). A 61 bp direct repeats (5’-CGGAGCGTCATATCAGTGATTTGGGTGAGATTCGAACTCACGACCCACGGTTTAG—AAGACC-3’) flanking the phage region was also identified. This represented the core regions of phage attachment sites (attL and attR). Although the exact role of phage elements in Lactobacillus is unknown, their presence may confer to the variation in the genome during the evolution of UBLG-36.
CRISPR-Cas system
CRISPR refers to the short and highly conserved repeat regions in the genome that are interspaced with variable sequences (spacers) and are often located adjacent to CRISPR-associated (Cas) genes [39]. More than 40% of sequenced bacterial genomes show the presence of CRISPR, which provides immunity to the bacteria against foreign genetic elements [40]. The genome of UBLG-36 was analyzed for the presence of the CRISPR-Cas9 system using the CRISPRcas finder. UBLG-36 genome contains 1 CRISPR locus consisting of a 761-nucleotide region with 11 spacers (S6 Table). A Cas system of Type II-A (1,626,757 bp- 1,632,979 bp) was detected with four Cas genes; cas1, cas2, cas9, and csn2.
Putative probiotic properties
The genome of UBLG-36 carries several protein-coding genes, which may determine its putative probiotic properties. Genes or proteins involved in acid and bile tolerance, adherence to the intestinal mucosa, resistance to temperature changes, host immunomodulation, antimicrobial activity, and intrinsic defense were identified (Table 4). These features can provide selective survival advantages and are important in supporting the probiotic potential of the strain [41]. The genome of UBLG-36 contains genes such as Nhac that codes for Na+-H+ antiporter (MBO3730586) as well as genes for F0F1 ATPase synthase (MBO3730797-MBO3730804), both of which are essential for tolerance to low pH [42]. Genes that code for proteins associated with bile tolerance, such as choloylglycine hydrolase (MBO3729487, MBO3730178, MBO3730995), were also found in the genome. LPXTG (MBO3730086, MBO3730467, MBO3731156), a cell wall anchor domain-containing protein and membrane lipoprotein for attachment to peptidoglycan (MBO3729742), were also identified. These proteins confer bacteria the ability to interact with the surrounding environment [43]. The bioinformatic analysis also showed that UBLG-36 encode several other adhesion proteins such as mucin binding (MucBP) proteins (MBO3731150), exopolysaccharide biosynthesis protein (EPS, MBO3730885, MBO3730887), capsular polysaccharides (CPS, MBO3730886), glyceraldehyde 3-phosphate dehydrogenase (GAPDH, MBO3730740), triosephosphate isomerase (MBO3730742) and elongation factor Tu (MBO3730873). EPS and CPS can facilitate binding to biotic and abiotic surfaces [44]. Although GAPDH and triosephosphate isomerase participates in the glycolysis pathway, they can be released by the cell, facilitating the adhesion of bacteria to the host during colonization [45]. Molecular chaperones DnaK (MBO3729503), DnaJ (MBO3729502), GroES (MBO3729844), and GroEL (MBO3729843) were identified in the genome of UBLG-36. These chaperones have been studied for their ability to provide bacteria with resistance to temperature shocks [46] and to function in bacterial adhesion to the host [47]. Apart from bacteriocins that act as strong antimicrobial agents, UBLG-36 also had gene coding for pyruvate oxidase (MBO3730233). Pyruvate oxidase in bacteria plays a major role in increasing ATP production and can also provide a fitness advantage by producing hydrogen peroxide [48]. UBLG-36 harbors genes that encode for lipoteichoic acid (LTA) synthesis (MBO3730517, MBO3730785) and D-alanyl-lipoteichoic acid biosynthesis protein (MBO3730324, MBO3730326). LTA can elicit host innate immune response by interacting with membrane toll-like receptor 2, activating nuclear transcription factor-kappa B [49]. Genes such as GlmS that code for the enzyme glucosaminefructose-6-phosphate aminotransferase (MBO3729602) and LysM that code for lysing motif domain (MBO3730936) were identified in the genome. GlmS and LysM are involved in catalyzing and binding peptidoglycan, respectively, in the bacterial cell wall [50]. GTs identified by CAZyme analysis are also crucial in the formation of bacterial surface structures [51]. Surface exposed cell wall protein (MBO3730913) that is known to play an important role in bacterial interaction with the host [52] was also found in UBLG-36.
Table 4. Proteins involved in the potential probiotic properties of Lactobacillus paragasseri UBLG-36.
| Putative function | Protein/gene name | NCBI protein accession number | 
|---|---|---|
| pH tolerance | Na+-H+ antiporter | MBO3730586 | 
| F0F1 ATP Synthase | MBO3730797—MBO3730804 | |
| Bile tolerance | MFS transporter | MBO3729588, MBO3729710, MBO3729735, MBO3729745, MBO3729780, MBO3729802, MBO3729892, MBO3730088, MBO3730176, MBO3730177, MBO3730237, MBO3730245, MBO3730263, MBO3730265, MBO3730328, MBO3730357, MBO3730588, MBO3730672 | 
| Choloylglycine hydrolase | MBO3729487, MBO3730178, MBO3730995 | |
| Adhesion | LPXTG cell wall anchor domain-containing protein | MBO3730086, MBO3730467, MBO3731156 | 
| Membrane lipoprotein lipid attachment site-containing protein | MBO3729742 | |
| Triose phosphate isomerase | MBO3730742 | |
| Exopolysaccharide biosynthesis protein | MBO3730885, MBO3730887 | |
| CpsD/CapB family tyrosine-protein kinase | MBO3730886 | |
| Glyceraldehyde-3-phosphate dehydrogenase | MBO3730740 | |
| MucBP domain-containing protein | MBO3731150 | |
| Elongation factor Tu | MBO3730873 | |
| Temperature | Co-chaperone GroES | MBO3729844 | 
| Chaperonin GroEL | MBO3729843 | |
| Molecular chaperone DnaJ | MBO3729502 | |
| Molecular chaperone DnaK | MBO3729503 | |
| Cold shock protein | MBO3730847 | |
| Immunomodulation | LTA synthase family protein | MBO3730517, MBO3730785 | 
| D-alanyl-lipoteichoic acid biosynthesis protein (DltB) | MBO3730324 | |
| D-alanyl-lipoteichoic acid biosynthesis protein (DltD) | MBO3730326 | |
| Surface exposed cell wall protein | MBO3730913 | |
| Glycosyltransferases | MBO3730551, MBO3730574 | |
| Glucosaminefructose-6-phosphate aminotransferase (GlmS) | MBO3729602 | |
| Peptidoglycan-binding domain-containing protein (LysM) | MBO3730936 | |
| Antimicrobial substances | Bacteriocin | MBO3729785, MBO3731108 | 
| Pyruvate oxidase | MBO3730233 | |
| Defense mechanism | Type II CRISPR-associated endonuclease Cas1 | MBO3730903 | 
| CRISPR-associated -endonuclease Cas2 | MBO3730904 | |
| Type II CRISPR RNA-guided endonuclease Cas9 | MBO3730902 | |
| Type II-A CRISPR-associated protein Csn2 | MBO3730905 | 
Oxalate degradation
Inspecting the whole genome sequence of L. paragasseri UBLG-36 revealed the presence of both oxc (H5J37_003070) and frc (H5J37_003075) whose products (MBO3729990, MBO3729991) are putatively involved in oxalate catabolism [10]. Having shared this unique feature with other LAB such as L. gasseri [12] and L. acidophilus [10] further emphasizes the capability of L. paragasseri UBLG-36 to degrade oxalate. To test the ability of UBLG-36 to degrade oxalate in vitro, the bacteria were grown in 10 mM and 20 mM MRS-Ox and assayed at three different time points (Fig 3). UBLG-36 showed an average of 47% and 44% degradation on day 1 in 10 mM and 20 mM MRS-Ox, respectively. There was no significant difference (p>0.05) in percentage oxalate degradation by UBLG-36 on day 1 between 10 mM and 20 mM MRS-Ox. When incubated in 10 mM MRS-Ox, UBLG-36 showed an average of 53% and 55% oxalate degradation on days 5 and 10, respectively. However, when incubated in 20 mM MRS-Ox, the average degradation significantly reduced to 48% on day 5 (p<0.01) and 10 (p<0.001) compared to that observed in 10 mM MRS-Ox on the same days. Overall, the percentage oxalate degradation in 10 mM and 20 mM MRS-Ox by UBLG-36 was significantly higher (p<0.001) than the positive control, L. acidophillus DSM 20079, at all three time points. As expected, L. casei ATCC 334 that served as the negative control, showed no degradation of oxalate.
Fig 3. Evaluation of in vitro oxalate degradation.
(a) The concentration of oxalate degraded by Lactobacillus paragasseri UBLG-36 and (b) percent oxalate degradation by Lactobacillus paragasseri UBLG-36 when incubated for 1, 5, and 10 days in 10 mM and 20 mM MRS-Ox. L. acidophilus DSM 20079 served as the positive control whereas, L. Casei ATCC 334 served as the negative control. L. Casei ATCC 334 showed no oxalate degradation. Data are presented as mean ± SEM from three experimental replicates. ***p<0.001, ###p<0.001, and ##p<0.01 denotes statistical significance. ns denotes non-significant.
To study the relatedness of oxc and frc found in UBLG-36 with all other representative L. gasseri and L. paragasseri strains, we performed a multiple sequence alignment and constructed a phylogenetic tree of all oxc and frc CDS. Phylogenetic analysis shows that CDS of oxc and frc in UBLG-36 is more closely related to L. gasseri strains HL70, EJL, and MGYG-HGUT-02387 (Fig 4), all of which have been identified as L. paragasseri strains based on our analysis (mentioned earlier in Fig 1 and Table 1). The oxc and frc CDS of UBLG-36 and other L. paragasseri strains (including L. gasseri strain HL70, HL75, EJL, and MGYG-HGUT-02387) together form a distinct sub-group (Fig 4), away from the three L. gasseri strains (HL20, ATCC33323, and DSM 14869) However, their degree of relatedness indicates a possible evolutionary inter-species exchange of oxalate catabolizing genes between L. gasseri and L. paragasseri. This observation is also supported by the result of the comparative study performed by Zhou et al. [9] that indicated a high rate of interspecies gene exchange between these sister taxa.
Fig 4. Relatedness of oxc and frc of Lactobacillus paragasseri UBLG-36 with all other representative genomes.
(a) Phylogenetic relationship of the oxc coding sequence of Lactobacillus paragasseri UBLG-36 and other L. gasseri and L. paragasseri strains. (b) Phylogenetic relationship of the frc coding sequence of Lactobacillus paragasseri UBLG-36 and other L. gasseri and L. paragasseri strains. Phylogenetic tree construction was based on the Neighbor-Joining method with 1000 bootstrap resampling performed on MAFFT webtool. L. paragasseri UBLG-36 is depicted in bold.
To the best of our knowledge, this is the first report on the oxalate degrading activity of an L. paragasseri strain. Given the recent taxonomic identification of L. paragasseri, it is not surprising that there is no research on its oxalate degrading ability. As a sister taxon of L. gasseri, it is expected of L. paragasseri strains to harbor oxc and frc and show potential oxalate metabolizing capabilities. Thus, we have observed these features not only in the genome of UBLG-36 but also in all other complete representative L. gasseri and L. paragasseri strains. When analyzed for its oxalate degrading activity in vitro, the results of oxalate degradation by UBLG-36 are consistent but not uniform with those reported earlier with L. gasseri and L. acidophillus strains [53]. The lack of uniformity in oxalate degradation is attributed to both species-to-species and strain-to-strain variations, as evidenced by multiple studies [12, 53, 54]. However, the highlighting feature of UBLG-36 is that the presence of oxc and frc in its genome may be responsible for its ability to degrade oxalate and with comparable oxalate degradation like some of the L. gasseri strains [53], UBLG-36 may prove to be an important probiotic strain.
With several potential probiotic traits discovered using bioinformatic tools, it is now essential that we also assess these traits in UBLG-36 using in vitro assays. Some critical in vitro assessments involve testing for acid and bile tolerance, cell-surface hydrophobicity, antibiotic susceptibility, immunomodulatory activity, auto-aggregation screening, production of vitamins, amines and toxins. Although our results suggest the perspective of L. paragasseri UBLG-36 as a new probiotic species with significant oxalate reducing capabilities, we should emphasize that further characterization of this strain in colon-simulated oxalate conditions and in vivo models of hyperoxaluria are necessary. Further, several other in vivo functional tests may be required before UBLG-36 can be classified as a probiotic strain. To this extent, we are currently performing transcriptional and functional analysis of oxc, frc, and other probiotic genes to determine whether L. paragasseri UBLG-36 is a probiotic strain and whether it will eventually be of use in the prophylactic treatment of renal oxalate stone.
Conclusion
In this study, analysis of the draft genome sequence has provided evidence of the potential probiotic properties of L. paragasseri UBLG-36. The presence of oxalate catabolizing genes and the ability to degrade oxalate in vitro necessitates deeper characterization of this species which is currently underway in our laboratory. Functional profiling has illustrated genes and proteins of UBLG-36 that are most commonly shared by several important lactic acid bacteria. As a sister taxon of L. gasseri, an already established probiotic bacteria of the human gut microbiome with immense commercial value, L. paragasseri UBLG-36 may also get its due recognition but would require extensive molecular and physiological characterization. The rapid development of sequencing technologies and bioinformatic analysis has made it easier to analyze and publish genomic information of a large number of microbial species. The increasing collection of genomes in public databases will provide a reliable platform for further comparative genomic analysis that will assist in expanding our knowledge on L. paragasseri UBLG-36.
Supporting information
(TIF)
(XLSX)
(XLSX)
(XLSX)
(XLSX)
(XLSX)
(XLSX)
Acknowledgments
The authors are thankful to Vellore Institute of Technology for providing the research amenities.
Data Availability
All relevant data are within the paper and its Supporting Information files.
Funding Statement
- Pragasam Viswanathan - Indian Council of Medical Research (No.5/9/1094/2013-NUT)
References
- 1.Bhasin B, Ürekli HM, Atta MG. Primary and secondary hyperoxaluria: Understanding the enigma. World J Nephrol. 2015;4: 235–44. doi: 10.5527/wjn.v4.i2.235 [DOI] [PMC free article] [PubMed] [Google Scholar]
 - 2.Khan SR, Pearle MS, Robertson WG, Gambaro G, Canales BK, Doizi S, et al. Kidney stones. Nat Rev Dis Prim. 2016;2. doi: 10.1038/nrdp.2016.8 [DOI] [PMC free article] [PubMed] [Google Scholar]
 - 3.Di Toro A, Urtis M, Giuliani L, Pellegrini C, Smirnova A, Galato R, et al. Oxalic Cardiomyopathy: Could it Influence Treatment Plans in Patients With Primary Hyperoxaluria Type 1? J Am Coll Cardiol. 2021;78: 998–999. doi: 10.1016/j.jacc.2021.06.039 [DOI] [PubMed] [Google Scholar]
 - 4.Waikar SS, Srivastava A, Palsson R, Shafi T, Hsu C, Sharma K, et al. Association of Urinary Oxalate Excretion With the Risk of Chronic Kidney Disease Progression. JAMA Intern Med. 2019;179: 542–551. doi: 10.1001/jamainternmed.2018.7980 [DOI] [PMC free article] [PubMed] [Google Scholar]
 - 5.Lieske JC. Probiotics for prevention of urinary stones. Ann Transl Med. 2017;5. doi: 10.21037/atm.2016.12.67 [DOI] [PMC free article] [PubMed] [Google Scholar]
 - 6.Abratt VR, Reid SJ. Oxalate-Degrading Bacteria of the Human Gut as Probiotics in the Management of Kidney Stone Disease. Adv Appl Microbiol. 2010;72: 63–87. doi: 10.1016/S0065-2164(10)72003-7 [DOI] [PubMed] [Google Scholar]
 - 7.Lauer E, Kandler O. Lactobacillus gasseri sp. nov., a new species of the subgenus Thermobacterium. Zentralblatt fur Bakteriol Angew und Okol Microbiol Abt1 OrigC Hyg. 1980;1: 75–78. doi: 10.1016/s0172-5564(80)80019-4 [DOI] [Google Scholar]
 - 8.Tanizawa Y, Tada I, Kobayashi H, Endo A, Maeno S, Toyoda A, et al. Lactobacillus paragasseri sp. nov., a sister taxon of Lactobacillus gasseri, based on whole-genome sequence analyses. Int J Syst Evol Microbiol. 2018;68: 3512–3517. doi: 10.1099/ijsem.0.003020 [DOI] [PubMed] [Google Scholar]
 - 9.Zhou X, Yang B, Stanton C, Ross RP, Zhao J, Zhang H, et al. Comparative analysis of Lactobacillus gasseri from Chinese subjects reveals a new species-level taxa. BMC Genomics. 2020;21: 1–16. doi: 10.1186/s12864-020-6527-y [DOI] [PMC free article] [PubMed] [Google Scholar]
 - 10.Azcarate-Peril MA, Bruno-Bárcena JM, Hassan HM, Klaenhammer TR. Transcriptional and functional analysis of oxalyl-coenzyme A (CoA) decarboxylase and formyl-CoA transferase genes from Lactobacillus acidophilus. Appl Environ Microbiol. 2006;72: 1891–1899. doi: 10.1128/AEM.72.3.1891-1899.2006 [DOI] [PMC free article] [PubMed] [Google Scholar]
 - 11.Chamberlain CA, Hatch M, Garrett TJ. Metabolomic profiling of oxalate-degrading probiotic Lactobacillus acidophilus and Lactobacillus gasseri. Motta A, editor. PLoS One. 2019;14: e0222393. doi: 10.1371/journal.pone.0222393 [DOI] [PMC free article] [PubMed] [Google Scholar]
 - 12.Azcarate-Peril MA, Altermann E, Yong JG, Tallon R, Sanozky-Dawes RB, Pfeiler EA, et al. Analysis of the genome sequence of Lactobacillus gasseri ATCC 33323 reveals the molecular basis of an autochthonous intestinal organism. Appl Environ Microbiol. 2008;74: 4610–4625. doi: 10.1128/AEM.00054-08 [DOI] [PMC free article] [PubMed] [Google Scholar]
 - 13.Wick RR, Judd LM, Gorrie CL, Holt KE. Unicycler: Resolving bacterial genome assemblies from short and long sequencing reads. Phillippy AM, editor. PLOS Comput Biol. 2017;13: e1005595. doi: 10.1371/journal.pcbi.1005595 [DOI] [PMC free article] [PubMed] [Google Scholar]
 - 14.Bosi E, Donati B, Galardini M, Brunetti S, Sagot MF, Lió P, et al. MeDuSa: A multi-draft based scaffolder. Bioinformatics. 2015;31: 2443–2451. doi: 10.1093/bioinformatics/btv171 [DOI] [PubMed] [Google Scholar]
 - 15.Tatusova T, Dicuccio M, Badretdin A, Chetvernin V, Nawrocki EP, Zaslavsky L, et al. NCBI prokaryotic genome annotation pipeline. Nucleic Acids Res. 2016;44: 6614–6624. doi: 10.1093/nar/gkw569 [DOI] [PMC free article] [PubMed] [Google Scholar]
 - 16.Aziz RK, Bartels D, Best A, DeJongh M, Disz T, Edwards RA, et al. The RAST Server: Rapid annotations using subsystems technology. BMC Genomics. 2008;9: 75. doi: 10.1186/1471-2164-9-75 [DOI] [PMC free article] [PubMed] [Google Scholar]
 - 17.Huerta-Cepas J, Forslund K, Coelho LP, Szklarczyk D, Jensen LJ, Von Mering C, et al. Fast genome-wide functional annotation through orthology assignment by eggNOG-mapper. Mol Biol Evol. 2017;34: 2115–2122. doi: 10.1093/molbev/msx148 [DOI] [PMC free article] [PubMed] [Google Scholar]
 - 18.Zhang W, Ji H, Zhang D, Liu H, Wang S, Wang J, et al. Complete Genome Sequencing of Lactobacillus plantarum ZLP001, a Potential Probiotic That Enhances Intestinal Epithelial Barrier Function and Defense Against Pathogens in Pigs. Front Physiol. 2018;9: 1689. doi: 10.3389/fphys.2018.01689 [DOI] [PMC free article] [PubMed] [Google Scholar]
 - 19.Weber T, Blin K, Duddela S, Krug D, Kim HU, Bruccoleri R, et al. AntiSMASH 3.0-A comprehensive resource for the genome mining of biosynthetic gene clusters. Nucleic Acids Res. 2015;43: W237–W243. doi: 10.1093/nar/gkv437 [DOI] [PMC free article] [PubMed] [Google Scholar]
 - 20.Bortolaia V, Kaas RS, Ruppe E, Roberts MC, Schwarz S, Cattoir V, et al. ResFinder 4.0 for predictions of phenotypes from genotypes. J Antimicrob Chemother. 2020;75: 3491–3500. doi: 10.1093/jac/dkaa345 [DOI] [PMC free article] [PubMed] [Google Scholar]
 - 21.McArthur AG, Waglechner N, Nizam F, Yan A, Azad MA, Baylay AJ, et al. The Comprehensive Antibiotic Resistance Database. Antimicrob Agents Chemother. 2013;57: 3348. doi: 10.1128/AAC.00419-13 [DOI] [PMC free article] [PubMed] [Google Scholar]
 - 22.Arndt D, Grant JR, Marcu A, Sajed T, Pon A, Liang Y, et al. PHASTER: a better, faster version of the PHAST phage search tool. Nucleic Acids Res. 2016;44: W16–W21. doi: 10.1093/nar/gkw387 [DOI] [PMC free article] [PubMed] [Google Scholar]
 - 23.Couvin D, Bernheim A, Toffano-Nioche C, Touchon M, Michalik J, Néron B, et al. CRISPRCasFinder, an update of CRISRFinder, includes a portable version, enhanced performance and integrates search for Cas proteins. Nucleic Acids Res. 2018;46: W246–W251. doi: 10.1093/nar/gky425 [DOI] [PMC free article] [PubMed] [Google Scholar]
 - 24.Marchler-Bauer A, Derbyshire MK, Gonzales NR, Lu S, Chitsaz F, Geer LY, et al. CDD: NCBI’s conserved domain database. Nucleic Acids Res. 2015;43: D222–D226. doi: 10.1093/nar/gku1221 [DOI] [PMC free article] [PubMed] [Google Scholar]
 - 25.Meier-Kolthoff JP, Göker M. TYGS is an automated high-throughput platform for state-of-the-art genome-based taxonomy. Nat Commun. 2019;10: 1–10. doi: 10.1038/s41467-018-07882-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
 - 26.Richter M, Rosselló-Móra R, Oliver Glöckner F, Peplies J. JSpeciesWS: A web server for prokaryotic species circumscription based on pairwise genome comparison. Bioinformatics. 2016;32: 929–931. doi: 10.1093/bioinformatics/btv681 [DOI] [PMC free article] [PubMed] [Google Scholar]
 - 27.Katoh K, Rozewicki J, Yamada KD. MAFFT online service: multiple sequence alignment, interactive sequence choice and visualization. Brief Bioinform. 2019;20: 1160–1166. doi: 10.1093/bib/bbx108 [DOI] [PMC free article] [PubMed] [Google Scholar]
 - 28.Sela I, Ashkenazy H, Katoh K, Pupko T. GUIDANCE2: accurate detection of unreliable alignment regions accounting for the uncertainty of multiple parameters. Nucleic Acids Res. 2015;43: W7. doi: 10.1093/nar/gkv318 [DOI] [PMC free article] [PubMed] [Google Scholar]
 - 29.Campieri C, Campieri M, Bertuzzi V, Swennen E, Matteuzzi D, Stefoni S, et al. Reduction of oxaluria after an oral course of lactic acid bacteria at high concentration. Kidney Int. 2001;60: 1097–1105. doi: 10.1046/j.1523-1755.2001.0600031097.x [DOI] [PubMed] [Google Scholar]
 - 30.Putonti C, Akhnoukh V, Anagnostopoulos Z, Bilek M, Colgan J, El Idrissi S, et al. Draft Genome Sequences of Six Lactobacillus gasseri and Three Lactobacillus paragasseri Strains Isolated from the Female Bladder. Microbiol Resour Announc. 2019;8: 973–992. doi: 10.1128/MRA.00973-19 [DOI] [PMC free article] [PubMed] [Google Scholar]
 - 31.Pugh JN, Wagenmakers AJM, Doran DA, Fleming SC, Fielding BA, Morton JP, et al. Probiotic supplementation increases carbohydrate metabolism in trained male cyclists: A randomized, double-blind, placebo-controlled crossover trial. Am J Physiol—Endocrinol Metab. 2020;318: E504–E513. doi: 10.1152/ajpendo.00452.2019 [DOI] [PubMed] [Google Scholar]
 - 32.Gänzle MG, Follador R. Metabolism of Oligosaccharides and Starch in Lactobacilli: A Review. Front Microbiol. 2012;3. doi: 10.3389/fmicb.2012.00003 [DOI] [PMC free article] [PubMed] [Google Scholar]
 - 33.Shiraishi T, Maeno S, Kishi S, Fujii T, Tanno H, Hirano K, et al. Oligosaccharide Metabolism and Lipoteichoic Acid Production in Lactobacillus gasseri and Lactobacillus paragasseri. Microorg 2021, Vol 9, Page 1590. 2021;9: 1590. doi: 10.3390/microorganisms9081590 [DOI] [PMC free article] [PubMed] [Google Scholar]
 - 34.Abriouel H, Pérez Montoro B, Casimiro-Soriguer CS, Pérez Pulido AJ, Knapp CW, Caballero Gómez N, et al. Insight into Potential Probiotic Markers Predicted in Lactobacillus pentosus MP-10 Genome Sequence. Front Microbiol. 2017;0: 891. doi: 10.3389/fmicb.2017.00891 [DOI] [PMC free article] [PubMed] [Google Scholar]
 - 35.Jia FF, Zhang LJ, Pang XH, Gu XX, Abdelazez A, Liang Y, et al. Complete genome sequence of bacteriocin-producing Lactobacillus plantarum KLDS1.0391, a probiotic strain with gastrointestinal tract resistance and adhesion to the intestinal epithelial cells. Genomics. 2017;109: 432–437. doi: 10.1016/j.ygeno.2017.06.008 [DOI] [PubMed] [Google Scholar]
 - 36.Altermann E, Russell WM, Azcarate-Peril MA, Barrangou R, Buck BL, McAuliffe O, et al. Complete genome sequence of the probiotic lactic acid bacterium Lactobacillus acidophilus NCFM. Proc Natl Acad Sci U S A. 2005;102: 3906–3912. doi: 10.1073/pnas.0409188102 [DOI] [PMC free article] [PubMed] [Google Scholar]
 - 37.C P, PD C, RP R, C H. Discovery of medically significant lantibiotics. Curr Drug Discov Technol. 2009;6: 1–18. doi: 10.2174/157016309787581075 [DOI] [PubMed] [Google Scholar]
 - 38.Ramisetty BCM, Sudhakari PA. Bacterial “grounded” prophages: Hotspots for genetic renovation and innovation. Front Genet. 2019;10: 12. doi: 10.3389/fgene.2019.00012 [DOI] [PMC free article] [PubMed] [Google Scholar]
 - 39.Hille F, Richter H, Wong SP, Bratovič M, Ressel S, Charpentier E. The Biology of CRISPR-Cas: Backward and Forward. Cell. 2018;172: 1239–1259. doi: 10.1016/j.cell.2017.11.032 [DOI] [PubMed] [Google Scholar]
 - 40.Sorek R, Kunin V, Hugenholtz P. CRISPR—A widespread system that provides acquired resistance against phages in bacteria and archaea. Nat Rev Microbiol. 2008;6: 181–186. doi: 10.1038/nrmicro1793 [DOI] [PubMed] [Google Scholar]
 - 41.Papadimitriou K, Zoumpopoulou G, Foligné B, Alexandraki V, Kazou M, Pot B, et al. Discovering probiotic microorganisms: In vitro, in vivo, genetic and omics approaches. Front Microbiolo. 2015;6:58 doi: 10.3389/fmicb.2015.00058 [DOI] [PMC free article] [PubMed] [Google Scholar]
 - 42.Mulkidjanian AY, Dibrov P, Galperin MY. The past and present of sodium energetics: May the sodium-motive force be with you. Biochim Biophysica Acta. 2008;1777: 985–992. doi: 10.1016/j.bbabio.2008.04.028 [DOI] [PMC free article] [PubMed] [Google Scholar]
 - 43.Zhang W, Wang J, Zhang D, Liu H, Wang S, Wang Y, et al. Complete Genome Sequencing and Comparative Genome Characterization of Lactobacillus johnsonii ZLJ010, a Potential Probiotic With Health-Promoting Properties. Front Genet. 2019;10: 812. doi: 10.3389/fgene.2019.00812 [DOI] [PMC free article] [PubMed] [Google Scholar]
 - 44.Caggianiello G, Kleerebezem M, Spano G. Exopolysaccharides produced by lactic acid bacteria: from health-promoting benefits to stress tolerance mechanisms. Appl Microbiol Biotechn. 2016;100: 3877–3886. doi: 10.1007/s00253-016-7471-2 [DOI] [PubMed] [Google Scholar]
 - 45.Ramiah K, van Reenen CA, Dicks LMT. Surface-bound proteins of Lactobacillus plantarum 423 that contribute to adhesion of Caco-2 cells and their role in competitive exclusion and displacement of Clostridium sporogenes and Enterococcus faecalis. Res Microbiol. 2008;159: 470–475. doi: 10.1016/j.resmic.2008.06.002 [DOI] [PubMed] [Google Scholar]
 - 46.Ye K, Li P, Gu Q. Complete genome sequence analysis of a strain Lactobacillus pentosus ZFM94 and its probiotic characteristics. Genomics. 2020;112: 3142–3149. doi: 10.1016/j.ygeno.2020.05.015 [DOI] [PubMed] [Google Scholar]
 - 47.Bergonzelli GE, Granato D, Pridmore RD, Marvin-Guy LF, Donnicola D, Corthésy-Theulaz IE. GroEL of Lactobacillus johnsonii La1 (NCC 533) is cell surface associated: Potential role in interactions with the host and the gastric pathogen Helicobacter pylori. Infect Immun. 2006;74: 425–434. doi: 10.1128/IAI.74.1.425-434.2006 [DOI] [PMC free article] [PubMed] [Google Scholar]
 - 48.Cornacchione LP, Hu LT. Hydrogen peroxide-producing pyruvate oxidase from Lactobacillus delbrueckii is catalytically activated by phosphotidylethanolamine. BMC Microbiol. 2020;20: 128. doi: 10.1186/s12866-020-01788-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
 - 49.Nguyen TTN, Seo E, Choi J, Le OTT, Kim JY, Jou I, et al. Phosphatidylinositol 4-phosphate 5-kinase α contributes to Toll-like receptor 2-mediated immune responses in microglial cells stimulated with lipoteichoic acid. Cell Signal. 2017;38: 159–170. doi: 10.1016/j.cellsig.2017.07.009 [DOI] [PubMed] [Google Scholar]
 - 50.Mathiesen G, Sveen A, Brurberg MB, Fredriksen L, Axelsson L, Eijsink VGH. Genome-wide analysis of signal peptide functionality in Lactobacillus plantarum WCFS1. BMC Genomics. 2009;10: 425. doi: 10.1186/1471-2164-10-425 [DOI] [PMC free article] [PubMed] [Google Scholar]
 - 51.Yuan Y, Barrett D, Zhang Y, Kahne D, Sliz P, Walker S. Crystal structure of a peptidoglycan glycosyltransferase suggests a model for processive glycan chain synthesis. Proc Natl Acad Sci U S A. 2007;104: 5348–5353. doi: 10.1073/pnas.0701160104 [DOI] [PMC free article] [PubMed] [Google Scholar]
 - 52.Kleerebezem M, Hols P, Bernard E, Rolain T, Zhou M, Siezen RJ, et al. The extracellular biology of the lactobacilli. FEMS Microbiol Rev. 2010;34: 199–230. doi: 10.1111/j.1574-6976.2010.00208.x [DOI] [PubMed] [Google Scholar]
 - 53.Turroni S, Vitali B, Bendazzoli C, Candela M, Gotti R, Federici F, et al. Oxalate consumption by lactobacilli: Evaluation of oxalyl-CoA decarboxylase and formyl-CoA transferase activity in Lactobacillus acidophilus. J Appl Microbiol. 2007;103: 1600–1609. doi: 10.1111/j.1365-2672.2007.03388.x [DOI] [PubMed] [Google Scholar]
 - 54.Federici F, Vitali B, Gotti R, Pasca MR, Gobbi S, Peck AB, et al. Characterization and heterologous expression of the oxalyl coenzyme A decarboxylase gene from Bifidobacterium lactis. Appl Environ Microbiol. 2004;70: 5066–73. doi: 10.1128/AEM.70.9.5066-5073.2004 [DOI] [PMC free article] [PubMed] [Google Scholar]
 




