Targeting of intragraft reactive oxygen species by APP-103, a novel polymer product, mitigates ischemia/reperfusion injury and promotes the survival of renal transplants

Abstract

Inflammatory responses associated with ischemia/reperfusion injury (IRI) play a central role in alloimmunity and transplant outcomes. A key event driving these inflammatory responses is the burst of reactive oxygen species, with hydrogen peroxide (H₂O₂) as the most abundant form that occurs as a result of surgical implantation of the donor organ.

Here, we used a syngeneic rat renal transplant and IRI model to evaluate the therapeutic properties of APP-103, a copolyoxalate molecule containing vanillyl alcohol (VA) that exhibits high sensitivity and specificity towards the production of H₂O₂. We show that APP-103 is safe, effectively promotes kidney function following IRI, and survival of renal transplants. APP-103 reduces tissue injury and IRI-associated inflammatory responses in models of both warm ischemia (kidney clamping) and prolonged cold ischemia (syngeneic renal transplant). Mechanistically, we demonstrate that APP-103 exerts protective effects by specifically targeting the production of reactive oxygen species (ROS). Our data introduce APP-103 as a novel, non-toxic and site-activating therapeutic approach that effectively ameliorates the consequences of IRI in solid organ transplantation.

1. INTRODUCTION

Renal transplantation is considered the treatment of choice for patients with end‐stage renal disease. During the course of solid organ transplantation, blood flow is discontinued in order to implant a donor organ. Following implantation, vascular clamps are released, allowing the ischemic allograft to be reperfused, a process resulting in ischemia/reperfusion injury (IRI) that is characterized by sterile, non-specific, inflammatory responses, leading to transplant dysfunction while augmenting graft immunognicity.

The production of high levels of reactive oxygen species (ROS) is central to the inflammatory response during ischemia/reperfusion (I/R). ROS are toxic molecules that alter cellular proteins, lipids and ribonucleic acids, leading to cell dysfunction and tissue damage. During IRI, the burst of ROS also amplifies inflammatory responses that induce the release of pro-inflammatory cytokines and chemokines including Tumor Necrosis Factor (TNF)-α, Interleukin (IL)-1β, IL-6 and Monocyte Chemoattractant Protein 1 (MCP-1/CCL2). Those events result into congestion of the microcirculation (known as the no-reflow phenomenon), and endothelial dysfunction (1, 2). The most abundant form of ROS, H₂O₂, gives rise to highly toxic hydroxyl radicals via the Haber-Weiss reaction, facilitated by the increased availability of free iron accompanying ischemia (2–4). Thus, neutralizing the overproduction of H₂O₂ may represent an efficient and novel strategy to prevent oxidative stress in IRI. Despite continuous advances in surgical techniques, novel preservation devices, and patient management, early return of renal function and successful long‐term outcomes remain challenging. Indeed, targeted treatments that will address basic pathophysiological features of IRI are lacking and in urgent need (5–7).

Antioxidant therapies have long been hypothesized to mitigate damage incurred by IRI. However, ineffective delivery and lack of specificity has translated to disappointing clinical outcomes (8, 9).

APP-103 offers a novel, antioxidiant, anti-inflammatory, and targeted approach that is rapidly deployed to sites of high ROS production immediately following systemic administration. APP-103 is a polyoxalate-based copolymer that contains vanillyl alcohol (VA) incorporated into the hydrophobic polymer backbone retaining high sensitivity and specificity towards H₂O_2. The unique mechanism of action of APP-103 is to target H₂O₂ overproduction and inflammation (4, 10, 11).

Here, we have determined the pharmacokinetics of APP-103 and subsequently tested its efficiacy in i), a model of warm ischemia (rat renal clamping model); and, ii) a syngeneic transplantation model with clinically relevant prolonged cold ischemic times. These approaches were selected as they model important clinical hurdles that are currently experienced in solid organ transplantation. In both models, APP-103 significantly reduced intragraft pro-inflammatory responses, improved organ function, and preserved organ structure. Additionally, we demonstrate that APP-103 is non-toxic even at high doses, suggesting that clinical application of APP-103 could significantly improve outcomes for patients receiving solid organ transplants.

2. MATERIALS AND METHODS

2.1. Generation of APP-103

APP-103 was generated through an initial polymerization of the copolyoxalate molecule, which was synthesized using 1,4-cyclohexanedimethanol, 4-vanillyl alcohol (VA), and oxalyl chloride. APP-103 microparticles were then generated using an emulsion/solvent evaporation system to encapsulate the copolyoxalate polymer (10, 11). In brief, the copolyoxalate polymer dissolved in dichloromethane (DCM) was added to 5 mL of 10 (w/v) % polyvinyl alcohol (PVA) solution. Mixtures were sonicated and then homogenized to form a fine oil/water emulsion. This emulsion was transferred to a 20 mL PVA (1 w/v%) solution and homogenized for 1 min. The remaining solvent was removed using a rotary evaporator. Particles were then centrifuged and washed with de-ionized water three times to remove residual PVA. The suspension was then frozen in liquid nitrogen and lyophilized to produce a powder which could be easily re-dispersed in water or phosphate buffered solution (PBS). The average diameter of the re-dispersed particles was found to be approximately 500 nm using dynamic light scattering (10).

2.2. Animal care

Inbred male adult Sprague-Dawley rats (Charles River Laboratories, Wilmington, MA, USA) weighing 200 – 250 g were used in all studies. Experiments were approved by the Institutional Ethical Committee for Research on Animals. Use and care of animals were in accordance with National Institutes of Health and Institutional Animal Care and Use Committee guidelines.

2.3. Maximum feasible dose (IV) study

APP-103 and its diol component, vanillyl alcohol, were administered to Sprague-Dawley rats via intravenous bolus injection at a dose of 20 mg/kg. Animals were then observed for 14 days. There were 4 separate groups containing 3 female and 3 male animals per group. Each group received either APP-103 or an equimolar equivalent concentration of vanillyl alcohol. Parameters and endpoints evaluated included clinical symptoms, body weights, body weight changes, serum collections (hematology, coagulation, and clinical chemistry), and gross necropsy findings. Dosing was defined based upon the maximum blood-volume replacement known to be safe for rats with inclusion of lowest concentration of APP-103. Dosage for vanillyl alcohol was determined by the molar ratio at which it is incorporated in the polymer, APP-103.

2.4. Pharmacokinetic study

Three male Sprague-Dawley rats (8 weeks of age and weighing between 250–275 g) were used to complete the study. Animals were instrumented with a femoral vein catheter (FVC) for intravenous dosing and jugular vein catheter (JVC) for blood collections. Blood was collected after 5, 15, 30 min in addition to 1, 2, 4, 6, 8, 12, 24, 48 h after treatment. APP-103 (3 mg/mL) was administered as an intravenous bolus by way of the FVC. Collected blood was centrifuged at 2200 × g for 10 min at 5 °C to isolate plasma. Plasma samples were collected and analyzed by LC-MS/MS determining the concentration of VA. Pharmacokinetic parameters were estimated from the plasma concentrations using standard non-compartmental methods and using data analysis software.

2.5. Renal IRI

Sprague-Dawley rats weighing 200–250 g were anesthetized with an intraperitoneal injection of ketamine and placed on a heating pad to maintain a constant body temperature of 37 °C during surgery. Animals underwent a laparotomy with a subsequent right nephrectomy; the left renal pedicle was occluded with a small microvascular clamp for 45 min. APP-103 (0.3, 1.0 and 3.0 mg/kg IP) or vehicle was administered 5 min before and 15 min after reperfusion. Control animals underwent a sham procedure (laparotomy, right nephrectomy while remaining under anesthesia for 45 min). The laparotomy was closed with 4–0 silk suture. Animals were then allowed to recover with free access to food and water. Blood was collected and the left kidney was procured for analysis 24 h after reperfusion (12).

2.6. Renal transplantation surgery

All surgeries were performed under a surgical microscope using standard microsurgical instruments (13). Kidneys were kept at 4 °C until transplanted. Recipients received APP-103 (15 mg/kg IV) or vehicle (PBS) at −1 and +2 h based on pharmacokinetic studies. Recipient rats underwent a bilateral native nephrectomy. Left renal artery reconstruction was achieved by end-to-end anastomosis between donor and recipient renal artery and vein (time for anastomosis time 25 ±5 min). An 18-gauge needle was inserted into the bladder and exteriorized through the opposite wall. A fine curved pair of forceps was passed through the openings and the distal portion of the ureter was pulled into the recipient’s bladder and the adventitia of terminal ureter was attached to the edge of the bladder. The native right kidney was then removed.

2.7. Assessment of renal function and morphology after renal IRI

Serum samples were analyzed with an automated Beckman Analyzer (Beckman Instruments GmbH, Munich, Germany) (14, 15). Renal tissue specimens were fixed by immersion in formalin solution (10%), dehydrated in alcohol, paraffin embedded, cut into 4 μm thick sections using a microtome, then stained with hematoxylin and eosin and Jones’ methenamine silver stain. Two sections per kidney were evaluated under a standard light microscope by a blinded pathologist assessing the degree of IRI-induced tubule-interstitial injuries. IRI-induced tubule-interstitial injuries were defined as tubular epithelial cell swelling, tubular atrophy, tubular dilatation, vacuolization, loss of brush border, cellular infiltration, hyperemia in intratubular and glomerular blood vessels, cast formation, and desquamation. Ten areas in randomly selected renal tubules from the outer medulla of the kidney were examined at 200x magnification. Pathological scoring ranged from 0 to 5+ points based on the percentage of injury area as follows: 0, normal; 1, injury area <10%; 2, injury area>10% but <25 %; 3, injury area >25% but <50%; 4, injury area >50% but <75%; 5, injury area >75% (16).

2.8. Reverse transcriptase-polymerase chain reaction (RT-PCR)

RT-PCR was performed as described previously (10, 11); mRNA expression levels were analyzed by RT-PCR using specific primers. Ribosomal 18S primers acted as internal controls and all RT-PCR signals were normalized to the 18S signal of the corresponding RT product to eliminate the measurement error from uneven sample loading providing a semi-quantitative measure of the relative changes in gene expression. The PCR primers used in this study are listed below: sense TNF-α, 5-CCT CAG CCT CTT CTCCTT CCT-3, anti-sense TNF-α, 5-GGTGTGGGTGAGGAGCA-3; sense MCP-1, 5-CCCCACTCA CCTGCTGCTACT-3, anti-sense MCP-1, 5-GCATCACAGTCCGAGTCACA -3; sense IL-2, 5-CATGTACAGCATGCAGCTCGCATCC, anti-sense IL-2, CCACCACAGTTGCTGGCTCATCATC; sense 18S, 5-GTTAT GGTTCCTTTGTCGCTC GCTC-3, anti-sense 18S,5-TCG GCCCGAGGTTATCTAGA GTCAC-3.

2.9. Dihydroethidium (DHE) staining

Renal tissue sections were incubated with 5 μmol/L of DHE (Sigma-Aldrich, St. Louis, MO) at 37 °C for 30 min in a humidified light protected chamber with subsequent DAPI application. Images were acquired with a confocal fluorescent microscope.

2.10. Statistical analyses

Statistical significances of differences were evaluated by Kolmogorov-Smirnov, Shapiro-Wilk and d’Agostino & Pearson omnibus normality tests to verify Gaussian distribution in relevant groups. To compare groups with each other, Kruskal-Wallis test followed by Dunn’s multiple comparison have been performed; a P value < 0.05 was considered statistically significant.

3. RESULTS

3.1. APP-103 is a safe and fast-acting product that is not impacted by clinically relevant temperatures

APP-103 was originally synthesized as an H₂O₂-responsive antioxidant polymeric prodrug intercalated with VA (10, 11). To measure the sensitivity of APP-103 to H₂O_2, we encapsulated the fluorophore rubrene in APP-103 and analyzed chemiluminescence at different H₂O₂ concentrations. We observed a concentration-dependent activation of APP-103 with a linear correlation between chemiluminescence intensity and H₂O₂ concentration (Figure 1A). Since temperature plays a critical role during renal injury and potential therapeutic interventions, we next wanted to determine whether the ability of APP-103 to quench H₂O₂ was temperature sensitive. We therefore determined the responsiveness of APP-103 to H₂O₂ at 4 °C, room temperature (RT), and 37 °C. Although overall fluorescence intensity was greater with higher temperature, the sensitivity of APP-103 to H₂O₂ was not affected by differing temperatures (Figure 1B). This observation showed that APP-103 can potentially offer protection against H₂O_2, both as an additive to cold preservation solutions and as a systemic prophylactic for patients at risk for acute kidney injury (AKI).

Figure 1. Sensitivity of chemiluminescent APP-103.

Sensitivity of chemiluminescent APP-103 on various H₂O₂ concentrations (0 to 2.5 μM) (A) and temperature conditions: 4 °C, Room Temperature (RT), and 37 °C (B)

To support pre-clinical advancement, we next analyzed APP-103 stability and toxicity in vivo and determined maximum feasible dose (MFD) of APP-103 under non-GLP (Good Laboratory Practices) practices (Table 1). For this study, APP-103 was administered by intravenously (IV) injection. The anticipated clinical route of delivery and MFD was pre-determined to be 20 mg/kg based upon the maximum blood replacement volume of a rat and the current formulation of APP-103 in solution (2 mg/mL). Therefore, a single dose of 20 mg/kg was administered, and animals were followed for 14 days. Individual weights of all animals were obtained by day 8 and clinical necropsies were performed on day 14. A single intravenous bolus injection of APP-103 was well tolerated in rats at a level of 20 mg/kg without mortality or toxicological changes in any of the measured parameters. Based on these results, the no-observed-adverse-effect level (NOAEL) of APP-103 was defined as a single intravenous bolus dose of 20 mg/kg.

Table 1. Maximum Feasible Doses study of APP-103 delivered IV at 20 mg/kg.

Four individual groups of animals, distrubted equally between sexes, were delivered APP-103 at 20 mg/kg IV and observed clinically (physical appearance and body weight) over a 14 day period.

Group/Sex	Animal ID	Percentage weight gain day 8	CREAT (mg/dL)	ALT (U/L)	Calcium (mg/dL)	Clinical observation
A /male	8007	22.97	0.3	50	11.0	no abnormalities detected (days 1–11)
A /male	8008	10.25	0.3	52	10.7	no abnormalities detected (days 1–11)
A /male	8009	23.64	0.3	55	10.7	no abnormalities detected (days 1–11)
B/male	8013	18.63	0.2	42	10.2	no abnormalities detected (days 1–11) - purple at site
B/male	8014	22.01	0.2	31	11.3	no abnormalities detected (days 1–11) - purple at site
B/male	8015	19.77	0.2	47	10.6	no abnormalities detected (days 1–11) - purple at site
C/female	8010	12.15	0.3	60	11.3	no abnormalities detected (days 1–11)
C/female	8011	12.05	0.3	75	10.6	no abnormalities detected (days 1–11)
C/female	8012	15.17	0.3	36	10.4	no abnormalities detected (days 1–11)
D/female	8016	15.14	0.3	34	10.9	no abnormalities detected (days 1–11)
D/female	8017	13.7	0.3	40	10.6	no abnormalities detected (days 1–11)
D/female	8018	14.35	0.4	39	10.2	no abnormalities detected (days 1–11)

Historical control ranges and means: Male (A) Alanine Aminotransferase (ALT): 15.0–97.0; mean=29.7 IU/L; (B) Serum creatinine (SCrea): 0.09–0.67; mean=0.248 mg/dL; (C) Calcium (CA): 8.69–11.19; mean=10.01 mg/dL. Female (A) Alanine Aminotransferase (ALT): 9.0–5573.0; mean=32.8 IU/L; (B) Serum creatinine (CREAT): 0.11–0.80; mean=0.291 mg/dL; (C) Calcium (CA): 8.76–12.32; mean=10.06 mg/dL.

To further determine the dosing strategy, we also analyzed the pharmacokinetics (PK) of APP-103. As APP-103 is a polymer that that will break down to various oligomeric units once in the bloodstream, we employed a liquid chromatography mass spectrometry (LCMS) as a bioanalytical method to track VA as it is released from the polyoxalate backbone of APP-103. With this approach, we determined that APP-103 has a serum half-life of 2.9 h following an IV bolus injection of 3 mg/kg (data not shown). The PK analysis in combination with the identified NOAEL via IV infusion supported dosing APP-103 between 3 mg/kg and 20 mg/kg and ensuring that there was sufficient drug available at the time of IRI.

3.2. APP-103 preserves function and restores organ functionality in warm renal IRI

Next, we sought to determine the minimum anticipated biological effect level (MABEL) in a model of renal IRI. At the time of surgery, a single injection of APP-103 was administered intraperitoneally (IP) 10 min prior to reperfusion at different doses. Dosing was based on previous efficacy and tolerability studies, which established PK parameters, and NOAEL (10, 11, 17, 18). IP delivery was utilized in this study for ease of delivery. However, given that dosing intensity of APP-103 is anticipated to be equivalent to IV delivery, we expect that results from this study to be representatitive of IV delivery of APP-103 (19). APP-103 delivered at 3 mg/kg, was then compared with equivalent dosing of polylactic acid-co-glycolic acid (PLGA), an FDA-approved polymer which does not react with H₂O₂. IRI was induced in rats by clamping of the left renal pedicle for 45 min while sham control animals underwent a comparable surgical procedure without ischemia. After 45 min of ischemia followed by reperfusion, control (PLGA-treated) animals exhibited a dramatic increase in serum creatinine (SCrea) levels by 24 h (Figure 2A). In contrast, treatment with APP-103 (3 mg/kg APP-103) reduced SCrea levels with SCrea levels comparable to sham controls. (Figure 2A). Moreover, APP-103 treatment significantly inhibits mRNA upregulation of pro-inflammatory cytokines TNF-α and MCP-1 (Figure 2B and C).

Figure 2. Protective effects of APP-103 after kidney IRI.

(A) Serum creatinine level after IRI in animals treated with PLGA (P, 3 mg/kg) and different concentrations of APP-103 (0.5, 1, 3 mg/kg), (B) mRNA levels of pro-inflammatory cytokines associated with inflammation after IRI in animals treated with either PLGA (3 mg/kg) or APP-103 (3 mg/kg), (C) Quantification of TNF-α and MCP-1. *, P <0.05 vs Sham; †, P <0.05 vs APP-103; n=4–6/group, (D) Representative Hematoxylin and eosin (H&E) stained tissue sections of kidney and quantification of histologic score 7 days and (E) 30 days after kidney I/R subsequent to either PLGA (3 mg/kg) or APP-103 (3 mg/kg) treatment; Scale bars represent 100 μm *, P <0.05 vs Sham; †, P <0.05 vs APP-103; n=4–6/group.

Morphological analysis on days 7 and 30 post IRI indicated that animals treated with APP-103 were protected against IRI-induced tissue injuries including tubular atrophy, tubular dilatation/vacuolization, loss of brush border, cellular infiltration, cast formation, and desquamation. Moreover, IRI-induced tubule-interstitial injuries were significantly reduced by 7 and 30 days in APP-103 treated animals. In addition, APP-103 administration (3 mg/kg) significantly ameliorated morphological changes including tubulo-interstitial injury and fibrosis (Figure 2D and E).

Collectively, these results highlight the therapeutic potential of APP-103 for preventing the consequences of I/R in clinically relevant models of prolonged warm ischemia.

3.3. APP-103 mitigates IRI-associated inflammation and preserves graft function in a syngeneic renal transplant rat model

In order to determine whether APP-103 effectively ameliorated oxidative stress initiated through prolonged cold ischemia, we employed a syngeneic rat renal transplant model (Figure 3), enabling the study of the effects APP on IRI in the absence of a genetic disparity (20). Syngeneic renal transplants were performed in Sprague-Dawley rats subsequent to prolonged cold ischemic times (CIT) of 3, 6, and 12 h. SCrea was measured 24 h after transplantation (Figure 3A). As expected, we observed a gradual increase of SCrea (sCrea levels: 3 h: 1.047±0.080; 6 h: 2.163±0.266; 12 h: 3.990±0.344) with prolongation of CIT in untreated control animals (Figure 3B). Twelve hours of CIT induced irreversible tissue damage and mortality. Thus, we next focused on analyzing the therapeutic impact of APP-103 with a CIT of 6 h. Based on PK and MFD studies (Table 1), APP-103 or volume equivalent phosphate buffer saline (PBS) was administered IV at 15 mg/kg 1 h prior to injury and after + 2 h. This treatment regimen may represent future clinical delivery as a continual infusion during surgery. Notably, treatment with APP-103 significantly reduced SCre levels on post-operative day 1 (Figure 3C 1.39±0.15 vs. 2.16±0.27, p=0.019). (21).

Figure 3. APP-103 prevents kidney damage and reduces intragraft oxidative stress.

(A) Transplantation model: Kidneys were kept at 4 °C until transplanted. Recipients received APP-103 (IV 5 mg/kg) or volume-controlled vehicle (PBS); APP-103 was applied at −1 and +2 h; kidney function was assessed by serum creatinine (Screa) measured on days 1 and 7 post operative day (POD). (B) recipient graft serum creatinine levels at various cold ischemic times in vehicle group on POD 1. (C) serum creatinine levels were measured with 6 h cold ischemic time in vehicle or APP-103 treated group on POD 1 and 7. *; P <0.05, **; P <0.01, ***; P <0.001

Histopathology assessment of the transplanted kidney grafts revealed tubular injury and fibrosis with extensive chronic tubule-interstitial changes, dilation of tubules, diffuse interstitial fibrosis and residual acute tubular injury with necrotic intraluminal debris in vehicle-treated animals (Figure 4A and B). Moreover, TUNEL staining revealed excessive and diffuse apoptosis at POD 1 (Figure 4C). Conversely, animals treated with APP-103 exhibited limited tissue injury, an intact renal parenchyma and absent acute tubular injury (Figure 4A) that was associated with a dramatically decreased frequency of apoptotic cells (Figure 4C). Moreover, Jones’ methenamine silver staining indicated that APP-103 restricted fibrotic remodeling processes observed in PBS treated animals by day 7 (Figure 4B). Taken together, these findings indicate that APP-103 preserves graft function and structure in a syngeneic transplant with a prolonged cold ischemic time.

Figure 4. APP-103 reduces the severity of acute tubular injury (ATI) and fibrosis.

Recipient kidney grafts were procured; immunohistochemistry was performed on POD 1 and 7;. (A) kidney sections wer stained with H&E (A) or Jones’ methenamine silver stain (B); sections from each animal (n=5) were scored blindly and analyzed for the degree of acute tubular injury (ATI) and interstitial fibrosis (Fibrosis), respectively. Tubular injury and fibrotic remodeling were scored according to the following semiquantitative scale by day 7: 0= none; 1= mild (<25%); 2= moderate (25–50%); 3= severe (50–75%); 4= diffuse (>75%). (C) Apoptosis was assessed by quantifying the frequency of TUNEL positive cells of all cells. (D) Representative DHE stained tissue section of kidney graft with PBS and APP-103 on POD 1. DHE=red, nuclei=blue.

3.4. APP-103 improves graft function by targeting of H₂O₂

We next investigated how APP-103 exerted its protective effects and assessed intragraft ROS production using dihydroethidium (DHE) staining, a semi-quantitative oxidative/nitrative stress indicator. As we had previously demonstrated that APP-103 mitigated Scre dysfunction by day 1 (Figure 4D), we further explored whether there was a reduction in DHE staining in transplanted kidneys of APP-103 treated animals (15 mg/kg) compared to volume equivalent vehicle treated animals. Our results showed that APP-103 qualitatively mitigated ROS production subsequent to IRI that was linked to an improved kidney structure and function.

3.5. APP-103 inhibits inflammation

With a reduction of H₂O₂ production, we hypothesized whether APP-103 would also reduce the production of inflammatory markers. Indeed, kidneys from APP-103 treated animals demonstrated reduced intragraft mRNA expression of relevant pro-inflammatory cytokines including TNF-α, MCP-1 and IL-2 (Figure 5A and 5B). These data suggest that APP-103 can repress ROS leading to a reduction of proinflammatory cytokines and improved functional graft outcomes. Thus, our results demonstrate in clinical relevant models that APP-103 alleviates IRI-associated pro-inflammatory responses by targeting the effects of H₂O₂.

Figure 5. APP-103 reduces the tissue inflammatory response.

(A) mRNA levels of factors associated with inflammation after 6 h of cold ischemic time. (B) Quantification of TNF-α, MCP-1 and IL-2. *, P <0.05 vs Sham; †, P <0.05 vs APP-103. N=4–6/group,

4. DISCUSSION

IRI drives the formation of ROS in the absence of sufficient antioxidative moieties. Overactive oxidative processes have been implicated in myriad diseases and injuries, including many surgical procedures that require clamping and therefore temporary IRI. Hydrogen peroxide (H₂O₂), the most abundant form of ROS produced during IRI, plays an important pathophysiological role by inducing the release of pro-inflammatory cytokines and apoptosis potentiating tissue damage (4, 22). When the amount of H₂O₂ exceeds antioxidant capabilities for reduction, there is a high susceptibility for tissue oxidative damage. Therefore, focusing on sites of H₂O₂ overproduction is a therapeutically relevant way of ameliorating oxidative stress injury in a variety of disease pathologies. APP-103 has been developed specifically as a targeted antioxidative therapy that can be administered systemically, uniquely allowing neutralization of oxidative stress events prior to initiation of downstream pro-inflammatory cascades. In previous studies, we have shown the efficacy of this compound in models of liver, heart, and limb IRI (2, 10, 11, 18). Importantly, no signs of toxicity have been observed in any model. Here, we further demonstrate that the beneficial effect of APP-103 extends into clinically relevant models of warm renal ischemia and prolonged cold exposure prior to transplantation.

Clinical studies have shown that hypoxia and reperfusion during allogeneic kidney transplantation promoted the formation of ROS. The resulting kidney injury can augment alloimmune reactions that lead to graft rejection (23). Antioxidant treatments have been evaluated in multiple clinical settings across tens of thousands of patients, and despite demonstrable pathophysiologic, mechanistic and pre-clinical efficacy data, these trials have largely not resulted in improved clinical outcomes (8, 9). Initial clinical data showed that individuals who eat foods riched in antioxidants or who choose to take vitamin supplements benefited from a decreased risk of cardiovascular disease (CVD) (24–26). Importantly, these studies overlooked additional lifestyle choices that may have confounded outcomes, including the level of physical activity. However, these results encouraged researchers to embark on a wide range of prospective clinical studies mainly focusing on cardiovascular atherosclerotic disease. These studies were conducted comparing antioxidant vitamins (such as vitamin E and A) with placebo for the prevention of CVD. As these studies did not demonstrate sufficient efficacy, the entire hypothesis fell out of fashion despite a physiological understanding of the importance of antioxidant/anti-inflammatory processes in diseases linked to IRI. Our results suggest that these previous clinical failures may have been avoided with an appropriate antioxidant and adequate dosing. As demonstrated here, APP-103 overcomes the limitations of earlier work safely delivering very high doses of antioxidant and anti-inflammatory that enable quenching of H₂O₂ overproduction at areas of oxidative stress, and ultimately mitigate long-term negative outcomes.

Here we tested the potential of APP-103 as a targeted approach to ameliorate IRI, specifically in solid organ renal transplantation. The syngeneic model was chosen in order to demonstrate that mitigation of IRI improves the consequences of prolonged cold ischemia in the absence of genetic disparity. Our data show that APP-103 can be administered safely and within the kinetic parameters required for a maximum protective effect during the course of IRI. APP-103 was shown to improve kidney function while also preserving morphology in models of both renal warm ischemia and syngeneic renal transplantation with prolonged cold ischemic times. Antioxidant effects were through the mitigation of H₂O₂, with suppression of pro-inflammatory cytokines and chemokines (TNF-α, MCP-1/CCL2) resulting in long-term histopathological improvements, reduced cell death, and reduced fibrosis.

Our study also shows that APP-103 has clinical potential through the protection and improvement observed in syngeneic renal transplants. While it has been shown that IRI during the surgical process of transplantation exacerbates a potent inflammation response, the process clearly represents only one component of the complexity in clinical transplantation. Future studies will thus need to be conducted in models of varying allogenicity, including major and minor histocompatibility differences (27) to delineate the effects of APP on IRI and alloimmune responses.

In summary, we present a novel therapy, APP-103, that specifically targets H₂O₂ overproduction and inflammation and combats downstream tissue damage caused by IRI. Moreover, we demonstrate that APP-103 has potentially life-extending clinical applicability in renal transplantation. APP-103 is anticipated to be a clinical product that can be adjunctive; one that will enhance outcomes with current on-market anti-rejection medications and enable expansion of the donor organ pool.

Glossary

IRI

Ischemia/Reperfusion Injury

I/R

Ischemia/Reperfusion

ROS

Reactive Oxygen Species

VA

Vanillyl Alcohol

DCM

Dichloromethane

TNF

Tumor Necrosis Factor

IL

Interleukin

MCP-1

Monocyte Chemoattractant Protein 1

PVA

Polyvinyl Alcohol

FVC

Femoral Vein Catheter

JVC

Jugular Vein Catheter

CIT

Cold Ischemic Time

DHE

Dihydroethidium

FDA

Food and Drug Administration

POD

Post-Operative Day

PK

Pharmacokinetics

PBS

Phosphate Buffered Saline

AKI

Acute Kidney Injury

MFD

Maximum Feasible Dose

LCMS

Liquid Chromatography Mass Spectrometry

GLP

Good Laboratory Practices

IV

Intravenous

IP

Intraperitoneal

μm

Micrometer

mg

Milligrams

kg

Kilograms

mL

Milliliters

min

Minutes

h

Hours

d

Days