Skip to main content
Molecular and Cellular Biology logoLink to Molecular and Cellular Biology
. 2000 Sep;20(17):6426–6434. doi: 10.1128/mcb.20.17.6426-6434.2000

Protein Kinase A and Mitogen-Activated Protein Kinase Pathways Antagonistically Regulate Fission Yeast fbp1 Transcription by Employing Different Modes of Action at Two Upstream Activation Sites

Lori A Neely 1,, Charles S Hoffman 1,*
PMCID: PMC86118  PMID: 10938120

Abstract

A significant challenge to our understanding of eukaryotic transcriptional regulation is to determine how multiple signal transduction pathways converge on a single promoter to regulate transcription in divergent fashions. To study this, we have investigated the transcriptional regulation of the Schizosaccharomyces pombe fbp1 gene that is repressed by a cyclic AMP (cAMP)-dependent protein kinase A (PKA) pathway and is activated by a stress-activated mitogen-activated protein kinase (MAPK) pathway. In this study, we identified and characterized two cis-acting elements in the fbp1 promoter required for activation of fbp1 transcription. Upstream activation site 1 (UAS1), located approximately 900 bp from the transcriptional start site, resembles a cAMP response element (CRE) that is the binding site for the atf1-pcr1 heterodimeric transcriptional activator. Binding of this activator to UAS1 is positively regulated by the MAPK pathway and negatively regulated by PKA. UAS2, located approximately 250 bp from the transcriptional start site, resembles a Saccharomyces cerevisiae stress response element. UAS2 is bound by transcriptional activators and repressors regulated by both the PKA and MAPK pathways, although atf1 itself is not present in these complexes. Transcriptional regulation of fbp1 promoter constructs containing only UAS1 or UAS2 confirms that the PKA and MAPK regulation is targeted to both sites. We conclude that the PKA and MAPK signal transduction pathways regulate fbp1 transcription at UAS1 and UAS2, but that the antagonistic interactions between these pathways involve different mechanisms at each site.


Transcriptional regulation is both an essential and a universal biological process. At any given time, a cell must express only a subset of its genes at appropriate levels in order to function properly. The control of transcription in eukaryotes involves the activities of both activators and repressors that directly bind DNA, as well as complexes of coactivators and corepressors that associate with the DNA-binding proteins (33, 41, 54). These activation and repression complexes can change the chromatin structure within a promoter, thus altering the ability of other activators or repressors to bind nearby target sequences (25, 64). An additional layer of control comes from signal transduction pathways that influence the activity of the DNA-binding proteins by altering their cellular location or DNA-binding affinity (23). A signaling pathway can promote transcription by stimulating an activator, inhibiting a repressor, or both. Conversely, a signaling pathway can repress transcription by inhibiting an activator, stimulating a repressor, or both. Thus, the transcriptional regulatory mechanisms of genes controlled by divergently acting signaling pathways may entail any of a large number of “wiring” patterns.

The fission yeast Schizosaccharomyces pombe regulates transcription of the fbp1 gene, encoding fructose-1,6-bisphosphatase, over a 200-fold range in response to changes in carbon source through glucose repression (19, 20, 59). Previous studies have identified two signal transduction pathways that coordinately regulate fbp1 transcription along with several other biological processes that are subject to regulation by nutrient monitoring (3, 5, 18, 22, 53, 55).

Glucose detection results in the activation of adenylate cyclase, and the resulting cyclic AMP (cAMP) signal activates a cAMP-dependent protein kinase A (PKA) to repress fbp1 transcription (3, 18, 21). Elevated PKA activity serves as an indicator of nutrient-rich growth conditions, inhibiting conjugation and sporulation, stationary-phase entry, thermotolerance, and the uptake of gluconate as an alternative carbon source (4, 9, 12, 31, 32, 43). Mutations in genes required for glucose detection and PKA activation cause cells to transcribe fbp1, conjugate and sporulate, and transport gluconate while growing in glucose- and nitrogen-rich media. These mutations also confer enhanced thermotolerance and a delay in exit from the stationary phase and spore germination. Mutations in the cgs1 gene, which encodes the regulatory subunit of PKA, lead to unregulated PKA activity that inhibits fbp1 transcription, conjugation and sporulation, stationary-phase entry, and gluconate transport (9, 18, 37; J. I. Stiefel and C. S. Hoffman, unpublished observations).

Glucose starvation creates an environmental stress signal that, like nitrogen starvation, osmotic stress, oxidative stress, and heat stress, activates a stress-activated mitogen-activated protein kinase (MAPK) pathway. MAPK cascades are highly conserved signal transduction pathways possessing three protein kinases, the MAPK, a MAPK kinase (MAPKK), and a MAPKK kinase (MAPKKK). This S. pombe pathway is composed of the win1 and wis4/wik1/wak1 MAPKKKs, the wis1 MAPKK, and the spc1/sty1 MAPK (7, 36, 45, 46, 4951, 53, 60). A downstream target of the MAPK, a heterodimeric bZIP transcriptional activator encoded by the atf1/gad7 and the pcr1 genes, is required to derepress fbp1 transcription (22, 50, 55, 63). The spc1/sty1 MAPK pathway is required for many processes that are also negatively regulated by PKA, including mating and sporulation, gluconate transport, and thermotolerance. However, data from these studies suggest that these two pathways work in parallel (22, 53, 55) and that the PKA pathway has little or no influence on the function of the atf1-pcr1 activator.

To investigate how the PKA and stress-activated MAPK pathways coordinately regulate fbp1 transcription, we conducted an analysis of the fbp1 promoter. Using a combination of promoter deletions and site-directed mutations, we have identified two elements, upstream activation site 1 (UAS1) and UAS2, required for full derepression of fbp1 transcription. Electrophoretic mobility shift assays (EMSAs) demonstrate that the protein-DNA interactions at UAS1 and UAS2 are regulated by both the MAPK and PKA pathways. However, these signaling pathways accomplish their regulation at these two sites by different mechanisms. We discuss the implications of these results with regard to the ability of signaling pathways to elicit quantitative differences in transcriptional regulation of genes that are qualitatively controlled in a similar fashion.

MATERIALS AND METHODS

Yeast strains and growth media.

The S. pombe strains used in this study are listed in Table 1. The ura4::fbp1-lacZ allele is a disruption of the ura4 gene by an fbp1-lacZ translational fusion (19). This translational fusion includes approximately 1.5 kb of sequence 5′ to the fbp1 transcriptional start site. Changes to the fbp1 promoter sequence in the derivatives constructed in this study are indicated in parentheses within the fbp1-lacZ allele designation (Table 1). Defined PM medium (61) and standard rich yeast extract medium (YEL) (15) were used for culturing cells with glucose present at 8% (repressing conditions), 3% (standard culturing conditions), or 0.1% (derepressing conditions; with 3% glycerol added). Required nutrients were added to PM medium at a concentration of 75 mg/liter, except for leucine, which was present at 150 mg/liter. 5-Fluoroorotic acid (5FOA) solid medium was used to identify homologous insertions of fbp1-lacZ constructs into the ura4 locus (2). Strain constructions were carried out by mating on SPA (15) for tetrad dissection. All yeast strains were grown at 30°C.

TABLE 1.

Genotypes of the strains used in this study

Strain   Genotype
LAN70 h ura4::fbp1-lacZ
LAN170 h ade6-M216 ura4::fbp1(Δ−1399 to −336)-lacZ
LAN171 h ura4::fbp1(Δ−1399 to −100)-lacZ
LANPac h ura4::fbp1(Δ−1399 to −216)-lacZ
LAN6P h ura4::fbp1(Δ−429 to −179)-lacZ
LAN6P-Pm1 h ura4::fbp1(Δ−1399 to −179)-lacZ
LANSca h ura4::fbp1(Δ−1399 to −876/Δ−429 to −179)-lacZ
LANSP h ade6-M216 ura4::fbp1(Δ−1399 to −876)-lacZ
LAN70mut1 h ura4::fbp1(−893G → C)-lacZ
LAN170mut2 h ura4::fbp1(Δ−1399 to −336/−262C → G)-lacZ
LANpka1 h pka1Δ::ura4+ ura4::fbp1-lacZ
LAN170pka1 h pka1Δ::ura4+ ura4::fbp1(Δ−1399 to −336)-lacZ
LAN170atf1 h atf1Δ::ura4+ ura4::fbp1(Δ−1399 to −336)-lacZ
LAN6Ppka1 h pka1Δ::ura4+ ura4::fbp1(Δ−429 to −179)-lacZ
LAN6Pscr1 h+ scr1Δ::ura4+ leu1-32 his2 ura4::fbp1(Δ−429 to −179)-lacZ
LAN170scr1 h scr1Δ::ura4+ ade6-M216 ura4::fbp1(Δ−1399 to −336)-lacZ
FWP72 h leu1-32 fbp1::ura4+ ura4::fbp1-lacZ
CHP704 h+ pka1-261 leu1-32 sty1HA::ura4+ ura4::fbp1-lacZ
CHP709 h+ cgs1-1 leu1-32 sty1HA::ura4+ ura4::fbp1-lacZ
CHP720 h wis1Δ::LEU2+ leu1-32 ade6-M210 ura4::fbp1-lacZ
CHP726 h sty1-1 leu1-32 fbp1::ura4+ ura4::fbp1-lacZ
CHP751 h+ atf1Δ::ura4+ ura4::fbp1(Δ−429 to −179)-lacZ
KS1479 h atf1HA6H::ura4+ leu1-32 ura4-D18
TP367-1C h atf1Δ::ura4+ leu1-32 his7-366 ad36-M216 ura4-D18
RJP47 h+ scr1Δ::ura4+ leu1-32 ade6-M216 his2 ura4::fbp1-lacZ

fbp1-lacZ promoter constructs.

Recombinant DNA manipulations were performed by using restriction enzymes and T4 DNA ligase from New England Biolabs according to the manufacturer's instructions. Synthetic oligonucleotides were purchased from Integrated DNA Technologies. Escherichia coli transformations were performed by using electroporation-competent XL1-Blue cells (Stratagene).

Plasmid pCH150 carries the fbp1-lacZ translational fusion inserted at the StuI site within the S. pombe ura4 gene on a pUC8 vector (19). Digestion of this plasmid with HindIII generates an fbp1-lacZ fusion flanked by ura4 sequences that can be used for homologous integration into the ura4 locus. Promoter variants were constructed as follows. Promoters 170, Pac, SP, and 171 were constructed by digesting plasmid pCH150 with PmlI and either NgoMIV (for 170), PacI (for Pac), NdeI (for 171), or ScaI (partial digest; for SP) blunting the ends with Klenow fragment, and recircularizing with T4 DNA ligase. The 6P promoter was constructed by digesting pCH150 with NgoMIV, followed by treatment with BAL 31 exonuclease. The BAL 31-digested DNA was ligated in the presence of XbaI linkers (New England Biolabs). This DNA was digested with XbaI and recircularized with T4 DNA ligase to incorporate a unique XbaI site at the deletion junction. Deletion endpoints were confirmed by DNA sequencing with the CircumVent Thermal Cycle DNA Sequencing kit (New England Biolabs). The fbp1-lacZ fusions were integrated in single copy into the ura4 genomic locus in S. pombe strains by digesting the plasmids with HindIII and transforming host cells to 5FOA resistance as previously described (19), with a transformation protocol that enhances the frequency of homologous recombination in S. pombe (24). Homologous integration of the fbp1-lacZ constructs into ura4 was verified by Southern blot analysis.

Site-directed mutagenesis of UAS1 was conducted by using the MegaPrimer protocol, as described previously (47). PCR amplification of plasmid pCH150 with primers MutUAS1-1 (5′-GAGTACTAATGCTTTGTGAGGTAGATGATTGGGAAGTGCTAAAGGTGGG-3′; the altered base is underlined) and UAS1-2 (5′-GCTAATAGGAAGGGCGGG-3′) created the megaprimer that was used in a second round of PCR with pCH150 as a template and primer UAS1-3 (5′-TCAACGAAGCCGGCTTAC-3′). This PCR product was digested with AflII and NgoMIV and ligated with AflII-NgoMIV-cut pCH150 DNA.

Site-directed mutagenesis of UAS2 was accomplished with oligonucleotides UAS2-1 (5′-GCCGGCTTCGTTGAATTGCAGTATGTCATTTGTTTAGCA GGCTGAAACAGCATTGCCCTG-3′) and MutUAS2-2 (5′-CGCTTAAT TAAAAATGCATACACGATAAACCTAATCTTCAAAAAACGATGGG CCTTGCAATGAAAACTACAGGGCAATGCTGTTTCAGCCTGC-3′; the altered base is underlined). The oligonucleotides were annealed, filled in with Klenow fragment, digested with PacI, and ligated into a PacI-PmlI-digested pCH150 vector. Base changes in UAS1 and UAS2 were confirmed by DNA sequencing. The fusions were integrated into S. pombe strains at the ura4 locus as described above.

β-Galactosidase assays.

Cells were grown for approximately 24 h in PM medium containing 8% glucose (repressing conditions). The cells were counted to determine the cell density, pelleted, washed twice with sterile distilled water, and subcultured into PM medium under repressing (8% glucose) and derepressing (0.1% glucose plus 3% glycerol) conditions. These cultures were grown for 24 h to a density of 5.0 × 106 to 1.0 × 107 cells/ml. β-Galactosidase activity was measured as described previously (18). Results are presented as the mean ± standard error from two to four independent assays and represent specific activity per milligram of soluble protein.

EMSAs.

Yeast cells were grown for 18 to 24 h in YEL (8% glucose) medium. The cells were counted to determine cell density and subcultured into 100 ml of YEL medium under repressing (8% glucose) and derepressing (0.1% glucose plus 3% glycerol) conditions. Exponential-phase cells were rapidly harvested at 4°C. The cells were washed twice in chilled sterile distilled water and resuspended on ice in 50 μl of chilled lysis buffer (63), although urea was omitted and Triton X-100 was present at 0.2%. Chilled acid-washed glass beads were added to just below the meniscus, and the cells were lysed at 4°C in a mini BeadBeater (Biospec Products, Inc.). When approximately 70% cell lysis was observed, the lysate was removed, the beads were washed with 50 μl of lysis buffer, and the 100-μl cell lysate was cleared by centrifugation at 16,000 × g for 15 min. The protein concentration of the supernatant was determined by using a Pierce bicinchoninic acid protein quantitation kit (Pierce Chemical Co.). The supernatant was diluted to 10 μg/μl with lysis buffer. Lysates were aliquoted in 10-μl volumes, flash frozen in liquid nitrogen, and stored at −80°C.

Synthetic oligonucleotides used in the EMSA studies are listed in Table 2. The annealed oligonucleotides were labeled by filling in with Klenow fragment and deoxynucleoside triphosphates (dNTPs), including [α-32P]dATP or [α-32P]dCTP, and purified by passage through a Sephadex G-25 column. Binding reaction mixtures containing 10 μg of protein lysate (unless otherwise indicated), 5 μg of bovine serum albumin, and 2 to 3 μg of poly(dI-dC) were preincubated in 20 μl of binding buffer (25 mM HEPES [pH 7.6], 34 mM KCl, 5 mM MgCl2) for 10 min on ice, after which 10,000 cpm (∼1 ng) of probe was added. The binding reaction mixtures were then incubated for 20 min at room temperature. The reactions were electrophoresed at 25 mA for 2.5 h in a 5% 0.5× Tris-borate-EDTA nondenaturing polyacrylamide gel. The binding reaction mixtures used in supershift experiments were the same as those described above, except for the addition of mouse anti-hemagglutinin (anti-HA) antibody (Roche Molecular Biochemicals) or mouse antiactin antibody (as a nonspecific control; Amersham Pharmacia Biotech). For antibody clearing experiments, protein extracts were incubated overnight with anti-atf1 or anti-pcr1 antibodies (62) coupled to protein A-Sepharose beads (Sigma) and cleared by centrifugation prior to the addition of probe to the cleared extracts.

TABLE 2.

EMSA probes used in this study

Probe   Sequencea
UAS1-wt 5′ TTCCCAATCATCTACGTCACAAAGCATTAGtact 3′
3′ aaggGTTAGTAGATGCAGTGTTTCGTAATCATGA 5′
UAS1-mcore 5′ TTCCCAATCATCTACCTCACAAAGCATTAGtact 3′
3′ aaggGTTAGTAGATGGAGTGTTTCGTAATCATGA 5′
UAS1-mleft 5′ TTCCCACTCATCTACGTCACAAAGCATTAGtact 3′
3′ aaggGTGAGTAGATGCAGTGTTTCGTAATCATGA 5′
UAS1-mright 5′ TTCCCAATCATCTACGTCACACAGCATTAGtact 3′
3′ aaggGTTAGTAGATGCAGTGTGTCGTAATCATGA 5′
UAS2-wt 5′ TCATTGCAAGCCCCTCGTTTTTTGCCGATTAGGTTTa 3′
3′ agtaaCGTTCGGGGAGCAAAAAACTTCTAATCCAAAT 5′
UAS2-mSTRE 5′ TCATTGCAAGGCCCTCGTTTTTTGCCGATTAGGTTTa 3′
3′ agtaaCGTTCCGGGAGCAAAAAACTTCTAATCCAAAT 5′
a

Uppercase letters denote the sequence of the oligonucleotides used to make probes for EMSA experiments. Lowercase letters denote nucleotides added to the probe during the labeling reaction. Sequences resembling the consensus CRE (UAS1) and the combined STRE-Mig1 binding site (UAS2) are underlined. Base changes relative to the wild-type probes are indicated in boldface. 

RESULTS

Deletions in the fbp1 promoter identify two regions required for full derepression.

S. pombe fbp1 transcription is tightly regulated over a 200-fold range, depending on the carbon source. To identify the cis-acting elements required for this transcriptional regulation, we constructed a series of deletions within the 1.5 kb of sequence 5′ to the transcriptional start site of an fbp1-lacZ reporter and measured β-galactosidase expression from these constructs when integrated in single copy (Fig. 1A). Data from this deletion series indicate that at least two key sites are required for full derepression of the fbp1 gene. UAS1 falls within a deletion from −1399 to −876 that causes a fivefold decrease in the β-galactosidase activity measured under derepressing conditions (compare the SP construct with the full-length promoter 70 construct; Fig. 1A). UAS2 lies within a deletion interval from −336 to −216. Loss of this element from a promoter lacking UAS1 causes an eightfold decrease in fbp1-lacZ expression under derepressed conditions (compare the 170 construct with Pac; Fig. 1A). Deletion of both UAS1 and UAS2 (Sca construct; Fig. 1A) causes a 20-fold reduction in fbp1 derepression. While additional sites of activation and repression are likely present in the fbp1 promoter, we focused our efforts on identifying the specific sites of activation within the UAS1 and UAS2 deletion intervals due to the importance of these two elements in fbp1 transcription.

FIG. 1.

FIG. 1

Schematic of fbp1-lacZ constructs and β-galactosidase assay data. (A) A deletion series was constructed within the fbp1 promoter of the fbp1-lacZ reporter to identify cis-acting elements involved in the regulation of fbp1 transcription. β-Galactosidase activity was determined in exponentially growing cells in both glucose-rich (repressed) and glucose-limited (derepressed) media (see Materials and Methods). β-Galactosidase activity is expressed as specific activity per milligram of protein ± standard deviation. (B) Site-directed mutagenesis of UAS1 (70mut1) and UAS2 (170mut2; see Materials and Methods) identifies two elements important for fbp1 derepression. The sequences of the wild-type elements and the mutated elements are given.

Site-directed mutagenesis identifies cis-acting elements in UAS1 and UAS2.

The DNA sequences within the UAS1 and UAS2 deletion intervals were analyzed in silico by using the MatInspector program (42) to identify sequences similar to previously characterized cis-acting elements. The UAS1 deletion interval (−1399 to −876) contains the sequence TGACGTAG on the complementary strand that resembles the cAMP response element (CRE) consensus sequence TGACGT(C/A)A (1). The atf1-pcr1 heterodimeric activator, required for fbp1 transcription, has been shown to bind CRE consensus sequences (22, 55, 62). We therefore tested whether or not this sequence is responsible for UAS1-driven fbp1 transcription by constructing an fbp1-lacZ fusion carrying a base change within the core ACGT sequence of this CRE-like element. To our surprise, this change, creating the 70mut1 promoter construct, reduces fbp1 expression to a greater degree (27-fold; Fig. 1B) than deletions of this region do. Relative to the 70mut1 construct, the SP deletion causes a fivefold increase in fbp1 derepression, while the larger 170 deletion causes an eightfold increase in fbp1 derepression (Fig. 1A). Therefore, both of these deletions appear to remove UAS1 and additional negatively acting elements within the fbp1 promoter.

The UAS2 deletion interval (−336 to −216) contains the sequence AAAAAACGAGGGG on the complementary strand, which resembles an S. cerevisiae stress response element (STRE), AGGGG (34, 48), that is bound by the stress-induced activators Msn2 and Msn4 (11). This sequence also resembles the binding site for three S. cerevisiae glucose repressors: Mig1, which binds the sequence (A/T)4AT(G/C)(C/T)GGGG (28, 39); Mig2, which acts as a redundant repressor with Mig1 (29, 30); and Nrg1, which recognizes the sequence AGGGG and/or GAGGG (40). A base change was introduced into the shortened 170 promoter, changing a base pair that is absolutely conserved in the STRE and Mig1-like consensus sequences. This single-base change reduces the β-galactosidase activity under derepressing conditions eightfold (Fig. 1B). We have therefore identified cis-acting elements within the UAS1 and UAS2 deletion intervals required for derepression of fbp1 transcription.

UAS1 is bound by the atf1-pcr1 transcriptional activator.

To characterize the UAS1 binding activity from S. pombe whole-cell extracts, we conducted EMSAs by using a double-stranded oligonucleotide probe identical in sequence to the −908 to −875 region of the fbp1 promoter (see Table 2 for probe sequences). We observed a slowly migrating complex in binding reactions using extracts from cells grown under glucose-starved conditions that is not present in similar reactions using extracts from cells grown under glucose-rich conditions (Fig. 2A). This novel band is not present when the probe carries a base change within the CRE-like core sequence (the same change that inhibits transcriptional activation; Fig. 1B), but is present when using probes carrying a base change to either side of the CRE-like element (Fig. 2B).

FIG. 2.

FIG. 2

EMSA studies of UAS1. (A) Whole-cell extracts prepared from cells grown in glucose-rich (8% glucose) or glucose-limited (0.1% glucose plus 3% glycerol) media were incubated with a double-stranded oligonucleotide probe (Table 2 [UAS1-wt]) identical in sequence to the −908 to −875 region of the fbp1 promoter. The following protein extracts were used (by lane): 1, no protein added; 2, strain FWP72 (wild type) repressed; 3, strain FWP72 (derepressed); 4, strain KS1479 (atf1HA6H) repressed; 5, KS1479 (atf1HA6H) derepressed. An arrow indicates the position of the starvation-induced complex. (B) Binding reactions were carried out by using protein extracts from derepressed cells of strain FWP72 (wild type) and various probes to determine binding site specificity. The probes (Table 2) were as follows (by lane): 1, UAS1-wt; 2, UAS1-mcore; 3, UAS1-mleft; 4, UAS1-mright. An arrow indicates the position of the starvation-induced complex. (C) A supershift experiment was conducted with protein extracts from derepressed cells of strain KS1479 (atf1HA6H). Additions to the binding reactions were as follows (by lane); 1, 1 μg of a mouse antiactin antibody per ml (nonspecific control); 2, no addition; 3, 0.5 μg of a mouse anti-HA antibody per ml. Arrows indicate the positions of the starvation-induced complex (S) and the supershifted complex (SS). (D) Antibody clearing of UAS1 binding activity. Antibodies to atf1 and pcr1 (62) were used to clear the UAS1 binding activity from extracts of derepressed FWP72 cells. Binding reactions with UAS1-wt probe included the following extracts (by lane): 1, no protein; 2, untreated protein extract; 3, anti-atf1 antibody-cleared protein extract; 4, anti-pcr1 antibody-cleared protein extract. An arrow indicates the position of the starvation-induced complex.

Since the atf1-pcr1 heterodimeric transcriptional activator is required for fbp1 transcription and has been shown to bind the CRE consensus sequence (22, 55, 62), we tested whether this activator is physically present in any of the UAS1-binding complexes. Extracts from a strain expressing an HA-tagged form of atf1 produce the same band shift pattern with the UAS1 probe as extracts from a wild-type strain (Fig. 2A). The tagged protein is functional and is expressed from a construct that replaces the wild-type atf1+ allele in the S. pombe genome (50). The addition of anti-HA antibody to the binding reaction causes a supershift of the starvation-specific band (Fig. 2C). Conversely, anti-atf1 and anti-pcr1 antibodies (62) are able to deplete wild-type extracts of the starvation-induced UAS1 binding activity (Fig. 2D). Therefore, the starvation-induced complex contains atf1 and pcr1 and binds in a sequence-specific manner to the UAS1 CRE-like element. Additional higher-mobility complexes are eliminated by anti-atf1 and anti-pcr1 clearing of the protein extracts (Fig. 2D, lanes 3 and 4). Since these complexes are not supershifted by the anti-HA antibody (Fig. 2C, lane 3), they may represent complexes containing pcr1 and atf21, a bZIP protein related to atf1 (50) which may cross-react with the anti-atf1 antibodies.

PKA and MAPK pathways regulate atf1-pcr1 binding to UAS1.

Having shown that the atf1-pcr1 activator is present in the starvation-induced UAS1-binding complex, we examined the effects of mutations in the MAPK and PKA pathways on this interaction. As expected, the starvation-induced complex is not present in cells lacking the atf1 gene (Fig. 3, lanes 4 and 5) or the pcr1 gene (data not shown). Extracts prepared from a wis1 MAPKK deletion strain also lack this activity (Fig. 3, lanes 6 and 7). Conversely, this activity is increased in extracts from a pka1 mutant strain and is even present in cells growing under repressed conditions (Fig. 3, lanes 8 and 9). Finally, extracts prepared from a cgs1 deletion strain produce a shift pattern similar to that seen with wild-type extracts (Fig. 3, lanes 10 and 11). These data suggest that glucose-rich conditions cause PKA to inhibit atf1-pcr1 binding to UAS1, while glucose starvation conditions cause the spc1/sty1 MAPK to promote atf1-pcr1 binding to UAS1 (see Discussion).

FIG. 3.

FIG. 3

Starvation-induced UAS1 binding activity is altered by mutations in the PKA and MAPK pathways. The binding reaction mixtures contained 10 μg of extract prepared from strains grown in glucose-rich (lanes 2, 4, 6, 8, and 10) or glucose-limited (lanes 3, 5, 7, 9, and 11) media. Lanes: 1, no protein; 2 and 3, strain FWP72 (wild type); 4 and 5, strain TP367-1C (atf1Δ); 6 and 7, strain CHP720 (wis1Δ); 8 and 9, strain CHP704 (pka1-261); and 10 and 11, strain CHP709 (cgs1-1).

UAS2 is bound by multiple factors.

To characterize the UAS2 binding activity from S. pombe whole-cell extracts, we conducted EMSAs using probes representing the −272 to −235 region of the fbp1 promoter (see Table 2 for probe sequences). Binding reactions using wild-type protein extracts and the UAS2 probe reveal at least four complexes designated A, B, C, and D (Fig. 4A, lanes 1 and 2). Glucose starvation causes an increase in the intensity of complex D, little change in complexes B and C, and a reduction in the intensity of complex A. In addition, upon glucose starvation, complex A becomes a doublet with the appearance of a slower-migrating band. Binding reactions using a probe that contains the same base change that eliminates transcriptional activation by UAS2 (UAS2-mut; Table 2 and Fig. 1B) result in a significant reduction in complexes A and B under both glucose-rich and glucose starvation conditions (Fig. 4A, lanes 3 and 4).

FIG. 4.

FIG. 4

EMSA studies of UAS2. (A) Changes in the growth conditions and the sequence of the probe alter the relative intensity of four protein-DNA complexes (indicated on the left as A, B, C, and D). Protein extracts prepared from wild-type strain FWP72 grown in glucose-rich (lanes 1 and 3) or glucose-limited (lanes 2 and 4) media were incubated with double-stranded oligonucleotide probes that are either identical in sequence to the −272 to −235 region of the fbp1 promoter (lanes 1 and 2 [Table 2; UAS2-wt]) or carry the C-to-G base change that eliminates transcriptional activation by UAS2 in the 170mut2 construct shown in Fig. 1B (lanes 3 and 4 [Table 2; UAS2-mSTRE]). (B) The scr1 repressor is required for maintaining the relative intensities of UAS2-binding complexes A through D. The binding reaction mixtures contained 10 μg of extract prepared from strains grown in glucose-rich (lanes 1 and 3) or glucose-limited (lanes 2 and 4) media. Lanes: 1 and 2, strain FWP72 (wild type); 3 and 4, strain RJP47 (scr1Δ).

The UAS2 sequence resembles the binding sites for both transcriptional activators and repressors in S. cerevisiae. Because these proteins share similar zinc finger DNA-binding motifs, we tested the effect of a deletion of the scr1 gene (56), encoding the closest S. pombe homolog to the S. cerevisiae Mig1 repressor, on both fbp1 transcription and on the formation of UAS2-specific complexes. Loss of scr1 causes a ninefold increase in fbp1 expression in glucose-repressed cells (Table 3), as well as a decrease in the formation of complexes A, B, and C, and an increase in complex D in EMSAs using extracts from glucose-repressed cells (Fig. 4B, lane 3). Therefore, scr1 appears to act as a repressor of fbp1 transcription; however, we cannot establish whether scr1 directly binds to UAS2 at this time. In addition, since the loss of scr1 results in the derepression of both UAS1- and UAS2-driven fbp1-lacZ fusions (Table 3), scr1 must exert its effect through multiple sites in the fbp1 promoter, either directly or indirectly.

TABLE 3.

Effects of gene deletions on transcriptional activation by UAS1 and UAS2a

Strain Promoter UAS1 UAS2 Relevant genotype Mean ± SE β-galactosidase activityb
Repressed Derepressed
LAN70 70 + + Wild type 14 ± 3 3,031 ± 192
RJP47 70 + + scr1Δ 124 ± 1 2,875 ± 179
LAN6P 6P + Wild type 32 ± 8 1,733 ± 115
LAN6Pscr1 6P + scr1Δ 167 ± 0 2,037 ± 148
LAN6Ppka1 6P + pka1Δ 2,034 ± 294 2,516 ± 231
CHP751 6P + atf1Δ 8 ± 3 10 ± 3
LAN170 170 + Wild type 15 ± 0 902 ± 81
LAN170scr1 170 + scr1Δ 175 ± 30 1,268 ± 86
LAN170pka1 170 + pka1Δ 753 ± 13 844 ± 58
LAN170atf1 170 + atf1Δ 10 ± 1 50 ± 1
a

Schematics of the 70, 170, and 6P promoter constructs are shown in Fig. 1

b

β-Galactosidase activity was determined from at least two independent cultures as described in Materials and Methods. The values are given as specific activity per milligram of soluble protein ± standard error. 

PKA and MAPK pathways regulate UAS2 binding activities.

To study the relationship between UAS2 activation and the PKA and MAPK signaling pathways, we examined the effects of mutations in these pathways on UAS2 binding activities. Unexpectedly, extracts from a pka1 mutant strain show only a modest reduction in complexes B and D under glucose starvation conditions (Fig. 5A, lanes 3 and 4). On the contrary, extracts from a cgs1 mutant strain display significant changes in the UAS2 binding activity in glucose-starved cells, with the loss of complexes B and C, as well as the upper band of the complex A doublet (Fig. 5A, lane 6). An additional band of slightly lower mobility than complex D is also present. Finally, extracts from a cgs1 mutant strain grown under glucose-rich conditions show a reduction in complex D (Fig. 5A, lane 5).

FIG. 5.

FIG. 5

UAS2 binding activities are regulated by the MAPK and PKA pathways, yet do not contain atf1 itself. (A) Binding reactions were carried out with the UAS2-wt probe (Table 2) and extracts prepared from strains grown in glucose-rich (lanes 1, 3, and 5) or glucose-limited (lanes 2, 4, and 6) media. Lanes: 1 and 2, strain FWP72 (wild type); 3 and 4, strain CHP704 (pka1-261); and 5 and 6, strain CHP709 (cgs1-1). The mobilities of complexes A through D are indicated on the left. (B) Binding reactions were performed as in panel A with extracts from strains grown in glucose-rich (lanes 1, 3, and 5) or glucose-limited (lanes 2, 4, and 6) media. Lanes: 1 and 2, strain CHP720 (wis1Δ); 3 and 4, strain TP367-1C (atf1Δ); 5 and 6, strain CHP726 (sty1-1). (C) A supershift experiment was conducted as in Fig. 2C with protein extract from strain KS1479 (atf1HA6H) grown in glucose-rich (lanes 1 to 3) or glucose-limited (lanes 4 to 6) media. Additions to the binding reactions were as follows (by lane): 1 and 3, no addition; 2 and 4, 1 μg of a mouse antiactin antibody per ml (as a nonspecific control); 3 and 6, 0.5 μg of a mouse anti-HA antibody per ml.

We have also examined the effects of mutations in genes encoding the wis1 MAPKK, the spc1/sty1 MAPK, and the atf1 transcriptional activator on UAS2 binding activities. Mutations affecting MAPKK and MAPK produce similar results. These include the loss of complex B in both glucose-repressed and glucose-starved cells, the loss of complex C and the upper band of the complex A doublet in glucose starved cells, a reduction in complex D in glucose-starved cells, and an increase in complex D in glucose-repressed cells (Fig. 5B, lanes 1, 2, 5, and 6). Complex formation using extracts from cells lacking atf1 does not resemble that of either wild-type cells or MAPK pathway mutants. Complex A appears to be migrating slightly faster, while complexes B and C are replaced by a band of slightly slower mobility than complex C (Fig. 5B, lanes 3 and 4). While these data do not lend themselves to a simple model of how the protein-DNA interactions at UAS2 regulate fbp1 transcription, it is clear that all four complexes are affected by mutations in the PKA and/or MAPK pathway.

atf1 is not a component of the UAS2 binding activities.

Since loss of either atf1 or signaling from the MAPK pathway alters the UAS2 binding activity (Fig. 5B), we questioned whether or not atf1 is physically present in any of the UAS2 binding complexes, as had been shown with UAS1. Contrary to the results obtained with the UAS1 probe (Fig. 2C), we were unable to supershift UAS2 complexes formed by extracts from repressed or derepressed cells by using HA-atf1 and anti-HA antibodies (Fig. 5C). Therefore, atf1 is not physically part of the UAS2 binding complexes.

PKA and MAPK pathways regulate transcriptional activation from both UAS1 and UAS2.

The EMSA data (Fig. 2 to 5) suggest that signaling through the PKA and MAPK pathways regulates both UAS1 and UAS2 binding activities. To determine if in vivo activation of fbp1 transcription by each element is also regulated by both pathways, we crossed fbp1-lacZ constructs containing only UAS1 (6P) or UAS2 (170) into pka1Δ and atf1Δ backgrounds and assayed β-galactosidase activity in repressing and derepressing cultures (Table 3). The results of these assays corroborate the data from the in vitro binding experiments. Both the UAS1-driven (6P) and the UAS2-driven (170) promoters become fully derepressed by the loss of PKA. As expected, the UAS1-driven promoter is almost totally inactive in cells lacking the atf1 transcriptional activator.

While expression from the UAS2-driven promoter is reduced 18-fold by the loss of atf1, β-galactosidase activity is still induced 5-fold by glucose starvation (strain LAN170atf1; Table 3). This reduction in expression is consistent with in vitro data showing that atf1 is indirectly required for UAS2 binding activity in glucose-starved cells (Fig. 5B); however, the remaining induction suggests that glucose repression by PKA involves both atf1-dependent and atf1-independent mechanisms. Further support for this proposal comes from our observation that a pka1 deletion causes a sixfold increase in fbp1-lacZ (using the full-length 70 promoter) expression in an atf1 deletion background (data not shown). Thus, both the PKA and MAPK pathways regulate fbp1 transcription by at least two mechanisms each.

DISCUSSION

Transcription of the S. pombe fbp1 gene is under the control of PKA and MAPK signaling pathways that are largely responsible for glucose repression and glucose starvation-induced derepression, respectively. In this study, we examined the fbp1 promoter and identified two elements required for transcriptional activation. Both of the signaling pathways regulate protein-DNA interactions at each element, although the mechanisms by which these pathways exert their control differ at the two sites.

UAS1, located 900 bp upstream from the fbp1 transcriptional start site, resembles a CRE that is bound by members of the ATF and CREB family of bZIP transcriptional activators (16, 44). The discovery of this site as a key element in fbp1 transcription is not surprising, since the atf1-pcr1 bZIP transcriptional activator is required for fbp1 derepression (22, 55, 62). A base change in the core of this sequence greatly reduces fbp1 transcriptional activation in vivo (170mut2 promoter construct; Fig. 1B) and eliminates the in vitro binding by a starvation-induced protein complex (Fig. 2A and B). This base change reduces fbp1 derepression to a greater extent than do deletions of this region (170 and SP deletion constructs; Fig. 1A), suggesting that additional sequences in this region negatively regulate fbp1 transcription. As expected, the atf1-pcr1 heterodimer is responsible for the starvation-induced UAS1 binding activity (Fig. 2C and D).

Further characterization of the UAS1 binding activity shows that both the MAPK and PKA pathways regulate this protein-DNA interaction. Deletion of the wis1 MAPKK gene results in a loss of UAS1 binding activity similar to that to that conferred by an atf1 deletion (Fig. 3). Furthermore, loss of PKA activity allows for binding in the absence of a starvation signal, while PKA activation by a mutation affecting the cgs1 regulatory subunit of PKA has little effect. These data suggest that PKA activity inhibits atf1-pcr1 binding to UAS1, while the spc1/sty1 MAPK activity overcomes this inhibitory effect. Therefore, activation of the MAPK pathway is not required for atf1-pcr1 binding to UAS1 in a pka1 mutant, while the elevated PKA activity in a cgs1 mutant does not prevent starvation-induced MAPK stimulation of atf1-pcr1 binding to UAS1. Yet, we previously showed that cgs1 mutants are grossly defective in derepression of fbp1 transcription (18), indicating that activation of the MAPK pathway is not sufficient to overcome the elevated PKA activity. This apparent contradiction may be explained by our discovery here that both the MAPK and PKA pathways exert multiple regulatory effects on fbp1 transcription. These varied interactions might also explain why a mutation that eliminates the only consensus PKA phosphorylation site within atf1 (gad7) was seen to have only a moderate effect on mating efficiency (22).

While the S. pombe PKA and MAPK pathways have been previously shown to antagonistically regulate a wide range of biological processes (4, 9, 12, 31, 32, 43), this is the first demonstration of a direct interaction between these pathways and control of atf1 activity at the level of DNA binding. Previous studies have suggested that the atf1-pcr1 heterodimer is constitutively bound to DNA (6, 63) and that mutations in the PKA pathway do not affect transcriptional activation by this complex (55). One possible explanation for the discrepancy between those studies and this one comes from the fact that we are examining binding to an endogenous site rather than a consensus CRE. Signaling through the MAPK and PKA pathways might only confer a detectable change in atf1-pcr1 binding affinity to suboptimal binding sites. The atf1-pcr1 heterodimer may bind a consensus CRE site with such a high affinity that this interaction is insensitive to PKA action. Loss of regulation due to the optimization of a protein binding site has been observed for the E. coli cAMP receptor protein (CRP), which activates transcription of a large number of operons subject to glucose repression. The CRP binds an optimized palindromic sequence with a 450-fold greater affinity than it binds the endogenous sequence from the lac operon promoter (10). In vivo, a galP1 promoter bearing an optimized CRP binding site is no longer subject to glucose repression (13).

The one study that has shown a positive role for the spc1/sty1 MAPK on DNA binding by atf1-pcr1 (also known as mts1-mts2) (26) examined a site involved in meiotic hot spot recombination. While a mutation in the spc1/sty1 gene reduced binding to a similar DNA element at the ade6-M26 recombination hot spot, this element is not involved in transcriptional regulation (27). There is no evidence for a role of the PKA pathway in this interaction.

UAS2, located 250 bp upstream from the transcriptional start site, contains overlapping consensus sequences for both transcriptional activators and repressors. A base change in the STRE-like sequence CCCCT eliminates the in vivo derepression of fbp1 transcription from this element (compare the Fig. 1A Pac construct with the Fig. 1B 170 and 170mut2 constructs) and alters in vitro binding to a probe carrying this sequence by S. pombe extracts (Fig. 4A). While the CCCCT element is clearly required for transcriptional activation, adjacent sequences may also positively or negatively regulate fbp1 transcription.

The pattern of protein-DNA complexes present in EMSAs using a UAS2-containing probe is surprisingly complex. At least four distinct complexes appear to be affected by changes in the sequence of the probe (Fig. 4A), the loss of the scr1 glucose repressor (Fig. 4B), mutations affecting the PKA pathway (Fig. 5A), or mutations affecting the MAPK pathway or atf1 (Fig. 5B). However, unlike the UAS1 binding activity, atf1 does not appear to be a component of the UAS2 binding activity (Fig. 5C). The most likely candidates for the UAS2-specific activators and repressors are members of a family of proteins containing two zinc fingers that resemble the DNA binding domains of the S. cerevisiae Msn2 and Msn4 transcriptional activators, as well as the Mig1, Mig2, and Nrg1 repressors (35, 39, 40). These transcriptional regulators are all associated with either stress-induced transcription or glucose repression and bind to sequences similar to that of UAS2. Analysis of the S. pombe genome reveals at least seven gene products with similar zinc fingers, including the scr1 repressor (56), the rsv1 activator (17), and several uncharacterized proteins. Figure 6 displays an alignment of the zinc fingers from five of these proteins, along with those of the S. cerevisiae transcriptional regulators mentioned above. To further complicate matters, two pairs of these S. pombe proteins, one that includes scr1, differ in length by only three residues. Further work will be needed to determine what if any redundant functions are carried out by these proteins.

FIG. 6.

FIG. 6

Alignment of zinc fingers from related S. cerevisiae and S. pombe proteins. Pairs of zinc fingers from S. cerevisiae proteins Msn2 (6323680), Mig1 (6321403), Mig2 (6321229), and Nrg1 (6320248) and S. pombe proteins C3H1.11 (Q10076), scr1 (CAB10978), rsv1 (AAB87047), SPAC11D3.17 (Q10096), and SPAC6G10.12c (O14258) were aligned by using the Clustal W version 1.7 sequence alignment program (57) and displayed by using BOXSHADE. Asterisks indicate the positions of conserved cysteines and histidines in the two zinc fingers predicted for each sequence.

Since the EMSA studies conducted here utilize whole-cell extracts, it is quite possible that we are detecting binding activities that are cytoplasmic at the time of extract preparation. This complicates our ability to assign roles for any of the UAS2 complexes in either transcriptional activation or repression. It has been shown that phosphorylation of the S. cerevisiae Mig1 repressor and Msn2 activator determines whether these proteins are nuclear or cytoplasmic (8, 14, 52). However, even though similar regulation is likely to occur in S. pombe, this does not detract from our evidence that UAS2 is the target of both transcriptional activators and repressors. Introduction of a base change in the set of four C's results in the loss of transcriptional activation from this site (Fig. 1B) and dramatically reduces complex A and B formation (Fig. 4A). Conversely, loss of the Mig1-like scr1 repressor also alters the protein-DNA interactions at UAS2 (Fig. 4B) and causes an increase in expression from both the full-length promoter and a UAS2-driven promoter (Table 3). The Mig1 protein, responsible for glucose repression of many S. cerevisiae genes, binds to a sequence resembling the UAS2 element and recruits the corepressor Ssn6-Tup1 (58). The scr1 repressor may function in a similar manner, because we and others have observed that S. pombe possesses two TUP1-like genes that encode redundant repressors of fbp1 transcription (38; R. Janoo and C. S. Hoffman, unpublished observations). However, since a promoter lacking the UAS2 sequence is also partially derepressed by the loss of scr1 (Table 3), UAS2 cannot represent a unique site for scr1 action within the fbp1 promoter.

Our data suggest that the PKA and MAPK pathways each employ at least two independent mechanisms to antagonistically regulate fbp1 transcription. PKA negatively regulates transcriptional activation from both UAS1 and UAS2. At UAS1, PKA inhibits atf1-pcr1 binding; however, PKA must have additional roles, since we have observed that an atf1Δ strain is partially derepressed for fbp1-lacZ expression by the subsequent deletion of pka1 (data not shown). PKA could stimulate the activity of a repressor such as scr1 and/or inhibit the activity of a UAS2-specific activator. The MAPK pathway stimulates atf1-pcr1 binding at UAS1 and promotes the expression or function of other activators at UAS2. These two distinct roles for atf1 are confirmed by the in vivo activation data. UAS1-driven expression is absolutely dependent upon atf1 (Table 3), as expected, since the UAS1 site is an atf1-pcr1 binding site (Fig. 2). On the other hand, while UAS2-driven expression is largely atf1 dependent, some regulation is still evident in an atf1Δ strain, consistent with an indirect role for atf1.

While it seems unnecessarily complicated that both the PKA and MAPK pathways employ multiple mechanisms to regulate fbp1 transcription, such mechanistic diversity would allow cells to regulate a collection of genes by the same two pathways, but with different degrees of sensitivity. The fbp1-lacZ constructs (Fig. 1) are all subject to glucose regulation, yet display regulation over a 5-fold to 200-fold range, with a 3-fold range in absolute repressed levels (excluding the virtually inactive 171 construct). As with these different constructs, the S. pombe genes controlled by the PKA and MAPK pathways in response to nutrient and stress conditions may utilize only subsets of the mechanisms observed here. This is likely to be a general theme of eukaryotic transcriptional regulation, allowing a finite number of signaling pathways to exert qualitatively different outcomes in gene expression over a large number of genes that are subject to the same environmental signals.

ACKNOWLEDGMENTS

We thank Kazuhiro Shiozaki, Peter Fantes, Takashi Toda, Maureen McLeod, and Kaoru Takegawa for providing strains and Masayuki Yamamoto for providing antibodies to atf1 and pcr1. We thank Steve Buratowski, Thomas Chiles, and Steve Howes for insightful discussions and critical evaluation of the manuscript.

This work was supported by NIH grant R01 GM46226 and a Research Expense grant from Boston College to C.S.H.

REFERENCES

  • 1.Benbrook D M, Jones N C. Different binding specificities and transactivation of variant CRE's by CREB complexes. Nucleic Acids Res. 1994;22:1463–1469. doi: 10.1093/nar/22.8.1463. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Boeke J D, Trueheart J, Natsoulis G, Fink G R. 5-Fluoroorotic acid as a selective agent in yeast molecular genetics. Methods Enzymol. 1987;154:164–175. doi: 10.1016/0076-6879(87)54076-9. [DOI] [PubMed] [Google Scholar]
  • 3.Byrne S M, Hoffman C S. Six git genes encode a glucose-induced adenylate cyclase activation pathway in the fission yeast Schizosaccharomyces pombe. J Cell Sci. 1993;105:1095–1100. doi: 10.1242/jcs.105.4.1095. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Caspari T. Onset of gluconate-H+ symport in Schizosaccharomyces pombe is regulated by the kinases Wis1 and Pka1, and requires the gti1+ gene product. J Cell Sci. 1997;110:2599–2608. doi: 10.1242/jcs.110.20.2599. [DOI] [PubMed] [Google Scholar]
  • 5.Dal Santo P, Blanchard B, Hoffman C S. The Schizosaccharomyces pombe pyp1 protein tyrosine phosphatase negatively regulates nutrient monitoring pathways. J Cell Sci. 1996;109:1919–1925. doi: 10.1242/jcs.109.7.1919. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Degols G, Russell P. Discrete roles of the Spc1 kinase and the Atf1 transcription factor in the UV response of Schizosaccharomyces pombe. Mol Cell Biol. 1997;17:3356–3363. doi: 10.1128/mcb.17.6.3356. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Degols G, Shiozaki K, Russell P. Activation and regulation of the Spc1 stress-activated protein kinase in Schizosaccharomyces pombe. Mol Cell Biol. 1996;16:2870–2877. doi: 10.1128/mcb.16.6.2870. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.De Vit M J, Waddle J A, Johnston M. Regulated nuclear translocation of the Mig1 glucose repressor. Mol Biol Cell. 1997;8:1603–1618. doi: 10.1091/mbc.8.8.1603. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.DeVoti J, Seydoux G, Beach D, McLeod M. Interaction between ran1+ protein kinase and cAMP dependent protein kinase as negative regulators of fission yeast meiosis. EMBO J. 1991;10:3759–3768. doi: 10.1002/j.1460-2075.1991.tb04945.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Ebright R H, Ebright Y W, Gunasekera A. Consensus DNA site for the Escherichia coli catabolite gene activator protein (CAP): CAP exhibits a 450-fold higher affinity for the consensus DNA site than for the E. coli lac DNA site. Nucleic Acids Res. 1989;17:10295–10305. doi: 10.1093/nar/17.24.10295. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Estruch F, Carlson M. Two homologous zinc finger genes identified by multicopy suppression in a SNF1 protein kinase mutant of Saccharomyces cerevisiae. Mol Cell Biol. 1993;13:3872–3881. doi: 10.1128/mcb.13.7.3872-3881.1993. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Fernandez J, Soto T, Vicente-Soler J, Cansado J, Gacto M. Heat-shock response in Schizosaccharomyces pombe cells lacking cyclic AMP-dependent phosphorylation. Curr Genet. 1997;31:112–118. doi: 10.1007/s002940050183. [DOI] [PubMed] [Google Scholar]
  • 13.Gaston K, Kolb A, Busby S. Binding of the Escherichia coli cyclic AMP receptor protein to DNA fragments containing consensus nucleotide sequences. Biochem J. 1989;261:649–653. doi: 10.1042/bj2610649. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Gorner W, Durchschlag E, Martinez-Pastor M T, Estruch F, Ammerer G, Hamilton B, Ruis H, Schuller C. Nuclear localization of the C2H2 zinc finger protein Msn2p is regulated by stress and protein kinase A activity. Genes Dev. 1998;12:586–597. doi: 10.1101/gad.12.4.586. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Gutz H, Heslot H, Leupold U, Loprieno N. Schizosaccharomyces pombe. In: King R C, editor. Handbook of genetics. New York, N.Y: Plenum Press; 1974. pp. 395–446. [Google Scholar]
  • 16.Hai T W, Liu F, Allegretto E A, Karin M, Green M R. A family of immunologically related transcription factors that includes multiple forms of ATF and AP-1. Genes Dev. 1988;2:1216–1226. doi: 10.1101/gad.2.10.1216. [DOI] [PubMed] [Google Scholar]
  • 17.Hao Z, Furunobu A, Nagata A, Okayama H. A zinc finger protein required for stationary phase viability in fission yeast. J Cell Sci. 1997;110:2557–2566. doi: 10.1242/jcs.110.20.2557. [DOI] [PubMed] [Google Scholar]
  • 18.Hoffman C S, Winston F. Glucose repression of transcription of the Schizosaccharomyces pombe fbp1 gene occurs by a cAMP signaling pathway. Genes Dev. 1991;5:561–571. doi: 10.1101/gad.5.4.561. [DOI] [PubMed] [Google Scholar]
  • 19.Hoffman C S, Winston F. Isolation and characterization of mutants constitutive for expression of the fbp1 gene of Schizosaccharomyces pombe. Genetics. 1990;124:807–816. doi: 10.1093/genetics/124.4.807. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Hoffman C S, Winston F. A transcriptionally regulated expression vector for the fission yeast Schizosaccharomyces pombe. Gene. 1989;84:473–479. doi: 10.1016/0378-1119(89)90523-4. [DOI] [PubMed] [Google Scholar]
  • 21.Jin M, Fujita M, Culley B M, Apolinario E, Yamamoto M, Maundrell K, Hoffman C S. sck1, a high copy number suppressor of defects in the cAMP-dependent protein kinase pathway in fission yeast, encodes a protein homologous to the Saccharomyces cerevisiae SCH9 kinase. Genetics. 1995;140:457–467. doi: 10.1093/genetics/140.2.457. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Kanoh J, Watanabe Y, Ohsugi M, Iino Y, Yamamoto M. Schizosaccharomyces pombe gad7+ encodes a phosphoprotein with a bZIP domain, which is required for proper G1 arrest and gene expression under nitrogen starvation. Genes Cells. 1996;1:391–408. doi: 10.1046/j.1365-2443.1996.d01-247.x. [DOI] [PubMed] [Google Scholar]
  • 23.Karin M. Signal transduction and gene control. Curr Opin Cell Biol. 1991;3:467–473. doi: 10.1016/0955-0674(91)90075-a. [DOI] [PubMed] [Google Scholar]
  • 24.Keeney J B, Boeke J D. Efficient targeted integration at leu1-32 and ura4-294 in Schizosaccharomyces pombe. Genetics. 1994;136:849–856. doi: 10.1093/genetics/136.3.849. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Kingston R E, Bunker C A, Imbalzano A N. Repression and activation by multiprotein complexes that alter chromatin structure. Genes Dev. 1996;10:905–920. doi: 10.1101/gad.10.8.905. [DOI] [PubMed] [Google Scholar]
  • 26.Kon N, Krawchuk M D, Warren B G, Smith G R, Wahls W P. Transcription factor Mts1/Mts2 (Atf1/Pcr1, Gad7/Pcr1) activates the M26 meiotic recombination hotspot in Schizosaccharomyces pombe. Proc Natl Acad Sci USA. 1997;94:13765–13770. doi: 10.1073/pnas.94.25.13765. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Kon N, Schroeder S C, Krawchuk M D, Wahls W P. Regulation of the Mts1-Mts2-dependent ade6-M26 meiotic recombination hot spot and developmental decisions by the Spc1 mitogen-activated protein kinase of fission yeast. Mol Cell Biol. 1998;18:7575–7583. doi: 10.1128/mcb.18.12.7575. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Lundin M, Nehlin J O, Ronne H. Importance of a flanking AT-rich region in target site recognition by the GC box-binding zinc finger protein MIG1. Mol Cell Biol. 1994;14:1979–1985. doi: 10.1128/mcb.14.3.1979-1985.1994. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Lutfiyya L L, Iyer V R, DeRisi J, DeVit M J, Brown P O, Johnston M. Characterization of three related glucose repressors and genes they regulate in Saccharomyces cerevisiae. Genetics. 1998;150:1377–1391. doi: 10.1093/genetics/150.4.1377. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Lutfiyya L L, Johnston M. Two zinc-finger-containing repressors are responsible for glucose repression of SUC2 expression. Mol Cell Biol. 1996;16:4790–4797. doi: 10.1128/mcb.16.9.4790. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Maeda T, Mochizuki N, Yamamoto M. Adenylyl cyclase is dispensable for vegetative cell growth in the fission yeast Schizosaccharomyces pombe. Proc Natl Acad Sci USA. 1990;87:7814–7818. doi: 10.1073/pnas.87.20.7814. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Maeda T, Watanabe Y, Kunitomo H, Yamamoto M. Cloning of the pka1 gene encoding the catalytic subunit of the cAMP-dependent protein kinase in Schizosaccharomyces pombe. J Biol Chem. 1994;269:9632–9637. [PubMed] [Google Scholar]
  • 33.Mannervik M, Nibu Y, Zhang H, Levine M. Transcriptional coregulators in development. Science. 1999;284:606–609. doi: 10.1126/science.284.5414.606. [DOI] [PubMed] [Google Scholar]
  • 34.Marchler G, Schuller C, Adam G, Ruis H. A Saccharomyces cerevisiae USA element controlled by protein kinase A activates transcription in response to a variety of stress conditions. EMBO J. 1993;12:1997–2003. doi: 10.1002/j.1460-2075.1993.tb05849.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Martinez-Pastor M T, Marchler G, Schuller C, Marchler-Bauer A, Ruis H, Estruch F. The Saccharomyces cerevisiae zinc finger proteins Msn2p and Msn4p are required for transcriptional induction through the stress response element (STRE) EMBO J. 1996;15:2227–2235. [PMC free article] [PubMed] [Google Scholar]
  • 36.Millar J B, Buck V, Wilkinson M G. Pyp1 and Pyp2 PTPases dephosphorylate an osmosensing MAP kinase controlling cell size at division in fission yeast. Genes Dev. 1995;9:2117–2130. doi: 10.1101/gad.9.17.2117. [DOI] [PubMed] [Google Scholar]
  • 37.Mochizuki N, Yamamoto M. Reduction in the intracellular cAMP level triggers initiation of sexual development in fission yeast. Mol Gen Genet. 1992;233:17–24. doi: 10.1007/BF00587556. [DOI] [PubMed] [Google Scholar]
  • 38.Mukai Y, Matsuo E, Roth S Y, Harashima S. Conservation of histone binding and transcriptional repressor functions in a Schizosaccharomyces pombe Tup1p homolog. Mol Cell Biol. 1999;19:8461–8468. doi: 10.1128/mcb.19.12.8461. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Nehlin J O, Ronne H. Yeast MIG1 repressor is related to the mammalian early growth response and Wilms' tumour finger proteins. EMBO J. 1990;9:2891–2898. doi: 10.1002/j.1460-2075.1990.tb07479.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Park S H, Koh S S, Chun J H, Hwang H J, Kang H S. Nrg1 is a transcriptional repressor for glucose repression of STA1 gene expression in Saccharomyces cerevisiae. Mol Cell Biol. 1999;19:2044–2050. doi: 10.1128/mcb.19.3.2044. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Ptashne M, Gann A. Transcriptional activation by recruitment. Nature. 1997;386:569–577. doi: 10.1038/386569a0. [DOI] [PubMed] [Google Scholar]
  • 42.Quandt K, Frech K, Karas H, Wingender E, Werner T. MatInd and MatInspector: new fast and versatile tools for detection of consensus matches in nucleotide sequence data. Nucleic Acids Res. 1995;23:4878–4884. doi: 10.1093/nar/23.23.4878. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Ribeiro M J, Reinders A, Boller T, Wiemken A, De Virgilio C. Trehalose synthesis is important for the acquisition of thermotolerance in Schizosaccharomyces pombe. Mol Microbiol. 1997;25:571–581. doi: 10.1046/j.1365-2958.1997.4961856.x. [DOI] [PubMed] [Google Scholar]
  • 44.Roesler W J, Vandenbark G R, Hanson R W. Cyclic AMP and the induction of eukaryotic gene transcription. J Biol Chem. 1988;263:9063–9066. [PubMed] [Google Scholar]
  • 45.Samejima I, Mackie S, Fantes P A. Multiple modes of activation of the stress-responsive MAP kinase pathway in fission yeast. EMBO J. 1997;16:6162–6170. doi: 10.1093/emboj/16.20.6162. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Samejima I, Mackie S, Warbrick E, Weisman R, Fantes P A. The fission yeast mitotic regulator win1+ encodes an MAP kinase kinase kinase that phosphorylates and activates Wis1 MAP kinase kinase in response to high osmolarity. Mol Biol Cell. 1998;9:2325–2335. doi: 10.1091/mbc.9.8.2325. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Sarkar G, Sommer S S. The “megaprimer” method of site-directed mutagenesis. BioTechniques. 1990;8:404–407. [PubMed] [Google Scholar]
  • 48.Schuller C, Brewster J L, Alexander M R, Gustin M C, Ruis H. The HOG pathway controls osmotic regulation of transcription via the stress response element (STRE) of the Saccharomyces cerevisiae CTT1 gene. EMBO J. 1994;13:4382–4389. doi: 10.1002/j.1460-2075.1994.tb06758.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Shiozaki K, Russell P. Cell-cycle control linked to extracellular environment by MAP kinase pathway in fission yeast. Nature. 1995;378:739–743. doi: 10.1038/378739a0. [DOI] [PubMed] [Google Scholar]
  • 50.Shiozaki K, Russell P. Conjugation, meiosis, and the osmotic stress response are regulated by Spc1 kinase through Atf1 transcription factor in fission yeast. Genes Dev. 1996;10:2276–2288. doi: 10.1101/gad.10.18.2276. [DOI] [PubMed] [Google Scholar]
  • 51.Shiozaki K, Shiozaki M, Russell P. Mcs4 mitotic catastrophe suppressor regulates the fission yeast cell cycle through the Wik1-Wis1-Spc1 kinase cascade. Mol Biol Cell. 1997;8:409–419. doi: 10.1091/mbc.8.3.409. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Smith A, Ward M P, Garrett S. Yeast PKA represses Msn2p/Msn4p-dependent gene expression to regulate growth, stress response and glycogen accumulation. EMBO J. 1998;17:3556–3564. doi: 10.1093/emboj/17.13.3556. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Stettler S, Warbrick E, Prochnik S, Mackie S, Fantes P. The wis1 signal transduction pathway is required for expression of cAMP-repressed genes in fission yeast. J Cell Sci. 1996;109:1927–1935. doi: 10.1242/jcs.109.7.1927. [DOI] [PubMed] [Google Scholar]
  • 54.Struhl K. Yeast transcriptional regulatory mechanisms. Annu Rev Genet. 1995;29:651–674. doi: 10.1146/annurev.ge.29.120195.003251. [DOI] [PubMed] [Google Scholar]
  • 55.Takeda T, Toda T, Kominami K, Kohnosu A, Yanagida M, Jones N. Schizosaccharomyces pombe atf1+ encodes a transcription factor required for sexual development and entry into stationary phase. EMBO J. 1995;14:6193–6208. doi: 10.1002/j.1460-2075.1995.tb00310.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Tanaka N, Ohuchi N, Mukai Y, Osaka Y, Ohtani Y, Tabuchi M, Bhuiyan M S, Fukui H, Harashima S, Takegawa K. Isolation and characterization of an invertase and its repressor genes from Schizosaccharomyces pombe. Biochem Biophys Res Commun. 1998;245:246–253. doi: 10.1006/bbrc.1998.8406. [DOI] [PubMed] [Google Scholar]
  • 57.Thompson J D, Higgins D G, Gibson T J. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 1994;22:4673–4680. doi: 10.1093/nar/22.22.4673. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Treitel M A, Carlson M. Repression by SSN6-TUP1 is directed by MIG1, a repressor/activator protein. Proc Natl Acad Sci USA. 1995;92:3132–3136. doi: 10.1073/pnas.92.8.3132. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Vassarotti A, Friesen J D. Isolation of the fructose-1,6-bisphosphatase gene of the yeast Schizosaccharomyces pombe. Evidence for transcriptional regulation. J Biol Chem. 1985;260:6348–6353. [PubMed] [Google Scholar]
  • 60.Warbrick E, Fantes P A. The wis1 protein kinase is a dosage-dependent regulator of mitosis in Schizosaccharomyces pombe. EMBO J. 1991;10:4291–4299. doi: 10.1002/j.1460-2075.1991.tb05007.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Watanabe Y, Lino Y, Furuhata K, Shimoda C, Yamamoto M. The S. pombe mei2 gene encoding a crucial molecule for commitment to meiosis is under the regulation of cAMP. EMBO J. 1988;7:761–767. doi: 10.1002/j.1460-2075.1988.tb02873.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Watanabe Y, Yamamoto M. Schizosaccharomyces pombe pcr1+ encodes a CREB/ATF protein involved in regulation of gene expression for sexual development. Mol Cell Biol. 1996;16:704–711. doi: 10.1128/mcb.16.2.704. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63.Wilkinson M G, Samuels M, Takeda T, Toone W M, Shieh J C, Toda T, Millar J B, Jones N. The Atf1 transcription factor is a target for the Sty1 stress-activated MAP kinase pathway in fission yeast. Genes Dev. 1996;10:2289–2301. doi: 10.1101/gad.10.18.2289. [DOI] [PubMed] [Google Scholar]
  • 64.Workman J L, Kingston R E. Alteration of nucleosome structure as a mechanism of transcriptional regulation. Annu Rev Biochem. 1998;67:545–579. doi: 10.1146/annurev.biochem.67.1.545. [DOI] [PubMed] [Google Scholar]

Articles from Molecular and Cellular Biology are provided here courtesy of Taylor & Francis

RESOURCES