ABSTRACT
Autotrophic bacteria utilizing Fe(II) as their energy and electron sources for growth affect multiple biogeochemical cycles. Some chemoheterotrophic bacteria have also been considered to exhibit an Fe(II) oxidation phenotype. For example, several Marinobacter strains have been reported to oxidize Fe(II) based on formation of oxidized iron bands in semi-solid gradient tubes that produce opposing concentration gradients of Fe(II) and oxygen. While gradient tubes are a simple and visually compelling method to test for Fe(II) oxidation, this method alone cannot confirm if, and to what extent, Fe(II) oxidation is linked to metabolism in chemoheterotrophic bacteria. Here we probe the possibility of protein-mediated and metabolic by-product-mediated Fe(II) oxidation in Marinobacter subterrani JG233, a chemoheterotroph previously proposed to oxidize Fe(II). Results from conditional and mutant studies, along with measurements of Fe(II) oxidation rates, suggest M. subterrani is unlikely to facilitate Fe(II) oxidation under microaerobic conditions. We conclude that the Fe(II) oxidation phenotype observed in gradient tubes inoculated with M. subterrani JG233 is a result of oligo-heterotrophic activity, shifting the location where oxygen dependent chemical Fe(II) oxidation occurs, rather than a biologically mediated process.
IMPORTANCE Gradient tubes are the most commonly used method to isolate and identify neutrophilic Fe(II)-oxidizing bacteria. The formation of oxidized iron bands in gradient tubes provides a compelling assay to ascribe the ability to oxidize Fe(II) to autotrophic bacteria whose growth is dependent on Fe(II) oxidation. However, the physiological significance of Fe(II) oxidation in chemoheterotrophic bacteria is less well understood. Our work suggests that oligo-heterotrophic activity of certain bacteria may create a false-positive phenotype in gradient tubes by altering the location of the abiotic, oxygen-mediated oxidized iron band. Based on the results and analysis presented here, we caution against utilizing gradient tubes as the sole evidence for the capability of a strain to oxidize Fe(II) and that additional experiments are necessary to ascribe this phenotype to new isolates.
KEYWORDS: Marinobacter, Fe(II) oxidation, oligo-heterotrophy, gradient tubes, iron oxidizers
INTRODUCTION
Fe(II) oxidation impacts multiple biogeochemical cycles including metals, carbon, nitrogen, phosphorus, and sulfur (1, 2). Under neutrophilic-aerobic conditions, both microbially mediated enzymatic Fe(II) oxidation and oxygen driven chemical oxidation of Fe(II) occur concurrently (3–8). Therefore, aerobic Fe(II) oxidizing bacteria typically thrive under low oxygen concentrations where they can outcompete chemical oxidation of Fe(II) by oxygen (3–8). Isolation of microaerophilic Fe(II) oxidizers is challenging given the specific requirements for optimum oxygen and Fe(II) concentrations. Gradient tubes, consisting of a semi-solid medium overlaying a solid Fe(II) source in a tube with air in the headspace to establish opposing gradients of dissolved Fe(II) and oxygen (9, 10), are commonly used to isolate bacteria capable of Fe(II) oxidation. Once inoculated, Fe(II)-oxidizing bacteria thrive in a specific location in the gradient tube providing appropriate oxygen and Fe(II) concentrations, resulting in a distinct rust-colored oxidized iron band, which is considered positive phenotypic evidence for the ability to oxidize Fe(II) (9, 10). In contrast, oxidized iron bands resulting from oxygen dependent chemical oxidation of Fe(II) at oxic-anoxic interfaces in abiotic controls appear diffuse and closer to the Fe(II) source at the bottom of the tubes (9, 10).
The gradient tube method has been used to associate both chemoautotrophic (4–8) and chemoheterotrophic bacteria (11–15) with Fe(II) oxidation. Obligate autotrophic bacteria grown in gradient tubes demonstrate that these bacteria oxidize Fe(II) as the sole electron and energy source while fixing carbon dioxide to obtain a clear growth and metabolic benefit (4–8). However, chemoheterotrophic bacteria that have been associated with Fe(II) oxidation using gradient tubes have largely been ignored and it is unclear if they obtain any metabolic benefit from Fe(II) oxidation.
Members of the genus Marinobacter are an example of chemoheterotrophic bacteria reported to oxidize Fe(II) based on gradient tubes (11–15). Marinobacter are metabolically versatile, found ubiquitously in aquatic and terrestrial salinous environments (11–23) and detailed studies to probe their association with Fe(II) oxidation are of environmental and ecological interest. Marinobacter subterrani JG233, isolated from an abandoned iron mine, has been proposed to perform Fe(II) oxidation and has an established genetic system (11), making it a good candidate to probe potential linkages between metabolism and Fe(II) oxidation in chemoheterotrophic bacteria. Here we explore a range of potential mechanisms and metabolic benefits of Fe(II) oxidation in M. subterrani, however, we determine that the Fe(II) oxidation phenotype in gradient tubes is driven indirectly by oligo-heterotrophy.
RESULTS AND DISCUSSION
We initially hypothesized that M. subterrani JG233 can facilitate Fe(II) oxidation via either a protein-mediated mechanism or mediated by a metabolic by-product. The electrons released through protein-mediated Fe(II) oxidation may directly, or indirectly via quinone pools, reduce oxygen, providing a direct energetic benefit through the production of either proton motive force alone or through the production of both proton motive force and ATP. The potential energetic benefit obtained from Fe(II) oxidation may provide a growth and/or survival benefit to the cell. However, there is a possibility that protein mediated Fe(II) oxidation may not confer any energetic advantage, or a clear growth/survival benefit as has been observed in some bacteria capable of manganese oxidation (28). Bacteria may also produce metabolic by-products that can chemically oxidize Fe(II). For example, Fe(II) oxidation is innate to anaerobic nitrate-reducing organisms actively producing nitrite as their metabolic by-product that chemically oxidizes Fe(II) (29, 30). We performed experiments to probe the possibilities of protein-mediated Fe(II) oxidation and reactive metabolic by-product driven chemical Fe(II) oxidation by M. subterrani JG233.
Fe(II) oxidation does not provide an energetic benefit to M. subterrani JG233.
Because M. subterrani JG233 does not grow autotrophically (11), we hypothesized Fe(II) oxidation may provide an energetic benefit during heterotrophic growth that could manifest as either an increase in growth rate or higher cell density. Such growth benefits have been reported for heterotrophic organisms grown in the presence of inorganic electron donors such as sulfur species (31–33). We quantified the heterotrophic growth of M. subterrani JG233 in the presence of 500 μM Fe(II) since Fe(II) oxidizing bacteria have been shown to oxidize Fe(II) in the same concentration range (4–8). However, the addition of Fe(II) to the medium resulted in growth defects on acetate and fumarate (Fig. 1). Because protein-mediated Fe(II) oxidation may provide an energetic advantage without showing a clear growth benefit, we also quantified the cellular ATP concentrations of M. subterrani JG233 in gradient tubes. Consistent with the detrimental effect of Fe(II) on growth, ATP concentration of M. subterrani JG233 in gradient tubes decreased in the presence of Fe(II) (Fig. 2) as did survival (Fig. 3). These results suggest that Fe(II) is toxic to M. subterrani JG233 and that Fe(II) oxidation does not provide this strain with an energetic benefit.
FIG 1.
Effect of Fe(II) on growth of M. subterrani JG233. Heterotrophic growth was quantified in the presence of 500 μM Fe(II) (closed symbols) or absence of Fe(II) (open symbols) in microaerobic liquid MIM medium added with either 100 μM sodium acetate (○, ●) or sodium fumarate (△, ▴). Error bars represent standard deviation from the mean of three independent biological replicates.
FIG 2.
Effect of Fe(II) on cellular ATP (ATP) concentrations in gradient tubes. ATP concentrations were quantified in the absence of Fe(II) (red) and presence of Fe(II) provided as either ferrous carbonate (green) or ferrous sulfide (blue). Error bars represent standard deviation from the mean of three independent biological replicates.
FIG 3.
Persistence of M. subterrani JG233 in gradient tubes. Long-term viability was quantified in the gradient tubes containing MIM with no additional organic carbon source, with (closed symbols) and without (open symbols) Fe(II) plugs. Error bars represent standard deviation from the mean of three independent biological replicates.
M. subterrani lacks a clear ferroxidase.
The genome of M. subterrani JG233 (NCBI accession number PRJNA284629) (11) lacks genes encoding homologs for the four proposed ferroxidases including Cyc2 (34, 35), PioA (36), FoxE (37), and MtoA (38). He et al. (39) proposed that a putative multicopper oxidase (Msub_12632) can access the extracellular environment through an associated porin (Msub_12631), to oxidize Fe(II) outside M. subterrani JG233. Msub_12632 is a homolog of PcoA that has been shown to facilitate assimilatory Fe(II) oxidation in Pseudomonas aeruginosa (40). Homologs of PcoA have also been speculated to have ferroxidase activity in Fe(II) oxidizing Zetaproteobacteria (41) and other multicopper oxidases have been implicated in manganese oxidation activity (42, 43). However, deletion of Msub_12632 did not eliminate or alter the Fe(II)-oxidation phenotype of M. subterrani in gradient tubes (Fig. 4). These observations suggested either an unknown pathway was functioning in Fe(II) oxidation or that a nonenzymatic mechanism may be responsible for the banding pattern observed in gradient tubes.
FIG 4.
Deletion of putative multicopper oxidase encoding gene Msub_12632 does not eliminate oxidized iron band formation in gradient tubes. M. subterrani JG233 (A and B), ΔMsub_12632 M. subterrani (C and D) and abiotic control with no cells (E).
M. subterrani produces metabolic by-products that are known to chemically oxidize Fe(II).
Lacking evidence of a protein-mediated mechanism for Fe(II) oxidation prompted experiments to investigate potential metabolic by-products produced by M. subterrani that can chemically oxidize Fe(II) such as nitrite or superoxide. The M. subterrani JG233 genome encodes for a putative nitrate reductase (Msub_2280-2282), which could produce nitrite from nitrate, and a putative ammonia monooxygenase (Msub_20060), which could produce nitrite from ammonium. We determined that M. subterrani JG233 produces 8.72 ± 3.54 μM nitrite when inoculated in Marinobacter Iron Medium (MIM) without carbon source to produce a final cell density of 106 cells/ml approximately. The amount of nitrite produced increased to 44.33 ± 4.93 μM when 20 mM lactate was added as an electron donor and carbon source to MIM, also resulting in more growth (final cell density of 3 × 108 cells/ml approximately). However, strains lacking the putative ammonia monooxygenase (Msub_20060) or the putative nitrate reductase (Msub_2280-2282) had no effect on formation of the oxidized iron band in gradient tubes (data not shown) and generated similar levels of nitrite as wild type (data not shown) suggesting alternative mechanisms are responsible for nitrite production.
Members of the genus Marinobacter have been reported to produce extracellular superoxide (44), a capability also observed in M. subterrani JG233 (Fig. 5). Superoxide production and decay rates equilibrate resulting in steady state concentration, which is observed as a stable luminescence signal during qualification (Fig. 5) (26). The initial peak in the luminescence signal for the treatments containing either the sample or the internal standards (Fig. 5) is due to the reaction of the probe with superoxide that accumulated in the tube before adding the probe (26). Treatments containing superoxide dismutase along with cells showed no initial peak and produced a much lower luminescence signal compared to either the treatment containing cells only or the internal standard treatments (Fig. 5). However, addition of superoxide dismutase to gradient tubes did not eliminate the oxidized bands produced by M. subterrani JG233 (data not shown), suggesting that production of superoxide is unlikely to be the primary driver of Fe(II) oxidation.
FIG 5.
Superoxide production by M. subterrani JG233. Treatments containing M. subterrani JG233 cells (green) produced a strong luminescence signal that was quenched by addition of superoxide dismutase (red). Controls for superoxide produced by xanthine oxidase at concentrations of 1.2 mU/liter (blue), 1.5 mU/liter (purple) and 8 mU/liter (black) respectively. Data shown are representative of every treatment performed in triplicate.
M. subterrani JG233 does not facilitate Fe(II) oxidation in resting cell assays.
Under aerobic conditions, bacteria would need to oxidize Fe(II) faster than chemical Fe(II) oxidation by oxygen to drive any reduction reaction coupled to Fe(II) oxidation. We therefore quantified Fe(II) oxidation rates under micro-aerobic conditions expecting to observe higher rates, compared to abiotic controls, if cells were actively catalyzing the reaction. However, Fe(II) oxidation rates were lower when cells were present (Fig. 6) suggesting that M. subterrani JG233 does not facilitate Fe(II) oxidation under the conditions tested. Notably, the iron oxidized band produced in gradient tubes in the presence of M. subterrani is diffuse, similar to abiotic controls, compared with the relatively tight banding pattern reported for autotrophic Fe(II) oxidizers (5, 6, 8).
FIG 6.
Fe(II) oxidation rate of M. subterrani JG233. Fe(II) was quantified over time for the abiotic treatments (closed circles) without cells and biotic treatments containing 109 cells/ml (open circles). Error bars represent the standard deviations from the mean of two independent biological replicates.
Oligo-heterotrophy shifts the location of Fe(II) oxidation in gradient tubes.
A previous report showed that the iron oxidation phenotype exhibited in gradient tubes by M. subterrani is dependent on the terminal oxidase activity (11) which would require an electron donor. Since we established that M. subterrani JG233 does not oxidize Fe(II) as an electron source (Fig. 6), and the iron oxidation phenotype exhibited in gradient tubes occurs in the absence of any additional carbon source (Fig. 4), we tested if M. subterrani JG233 could grow oligo-heterotrophically. Growth experiments demonstrated that M. subterrani JG233 can generate 105–106 CFU/ml from 103 CFU/ml in liquid MIM medium with no added organic carbon source (Table 1). Two-tailed Student's t test confirmed that initial cell densities at the start of growth experiments in MIM without any added organic carbon source were statistically different from final cell densities after 4 days (alpha = 0.05, P = 0.0002). Attempts to minimize the possible organic carbon contamination in MIM using new, acid and base-washed, muffle-furnace cleaned glassware, high-pressure liquid chromatography (HPLC) grade water, and new reagents were unsuccessful in eliminating the growth phenotype in MIM without added organic carbon source (Table 1). The growth observed amounts to five to eight doublings and likely cannot be explained by usage of storage compounds present in the inoculated cells. These results suggest that M. subterrani JG233 is an oligo-heterotroph which can grow on miniscule amounts of organic carbon potentially present as impurities in the medium components, as has been reported for other Marinobacter strains (12).
TABLE 1.
Oligo-heterotrophic growth of M. subterrani JG233
| Medium and glassware conditions | Cell concna (CFU/ml ± SD) |
|
|---|---|---|
| Day 0 | Day 4 | |
| MIM with no added organic carbon source | 1.3 × 104 ± 0.6 × 104 | 8 × 105 ± 1 × 105 |
| MIM with no added organic carbon source prepared using new chemicals in HPLC grade water and expt performed in new, acid and base-washed, muffle-furnaced cleaned glassware | 1.3 × 103 ± 0.6 × 103 | 4.7 × 105 ± 3.5 × 105 |
aCell concentrations (concn) represent means of three biological replicates along with standard deviations. New glassware was washed in 1 M hydrochloric acid and 1 M sodium hydroxide followed by rinsing in HPLC grade water and baking at 500°C for 5 h.
We hypothesized that oxygen consumption due to oligo-heterotrophic activity of M. subterrani would alter the redox gradient in gradient tubes to shift the location of chemical oxidation of Fe(II) by oxygen. Because we were unable to find a medium to prevent oligo-heterotrophy of M. subterrani JG233, we tested the above hypothesis by adding different concentrations of either acetate or lactate as additional organic electron donor in the gradient tubes. M. subterrani cells move upward in gradient tubes to meet the increased oxygen demand during utilization of the additional electron donors, shifting the location of the oxic-anoxic interface where abiotic Fe(II) oxidation occurs. The location of the oxidized iron band shifted upwards in the presence of either acetate or lactate, increasing with concentration (Fig. 7). The oligo-heterotrophic activity of M. subterrani cells would consume oxygen to shift the location of oxic-anoxic interface at which chemical oxidation of Fe(II) by oxygen proceeds in the gradient tubes compared to cell free conditions. Because oligo-heterotrophic activity would require oxygen reduction through terminal oxidases, our analysis is consistent with the previous observation that addition of terminal oxidase inhibitors to gradient tube cultures of M. subterrani resulted in banding patterns similar to abiotic controls (11).
FIG 7.
Upward shift of oxidized iron bands with addition of organic electron donors. The locations of oxidized iron bands shifted upwards in gradient tubes containing M. subterrani JG233 with increasing concentrations of either (A) acetate or (B) lactate. Gradient tubes shown are representatives of duplicate experiments.
Decreased growth, survival, and cellular ATP concentrations in the presence of Fe(II) along with the absence of a clear ferroxidase and the inability to oxidize Fe(II) faster than oxygen (Fig. 1, 4 and 6) suggest that M. subterrani JG233 is unlikely to oxidize Fe(II). We conclude that the Fe(II) oxidation phenotype in gradient tubes is an artifact due to a shifted redox gradient caused instead by oligo-heterotrophic activity of M. subterrani JG233. Our work suggests that gradient tubes are an unreliable method to demonstrate Fe(II) oxidation capabilities of oligo-heterotrophic strains. Although the gradient tube technique provides an easy preliminary assay to screen for Fe(II) oxidizing activity, we would warrant caution against designating a strain to be capable of Fe(II) oxidation solely based on this method.
MATERIALS AND METHODS
Bacterial strains and culture conditions.
The bacterial strains used in this study are listed in Table 2. Marine Broth (MB) was used for rich-medium cultivation of M. subterrani JG233 at 30°C. Defined-medium conditions utilized MIM (11) containing per liter: 50.0 g NaCl, 5.3 g MgCl2·6H2O, 0.75g KCl, 0.1 g MgSO4·6H2O, 50 mg K2HPO4, 1.0 g NH4Cl, 0.740 g CaCl2·2H2O, 0.42 g NaHCO3, 2.38 g HEPES (4-(hydroxyethyl)-1-piperazineethanesulfonic acid), and pH adjusted to 7.0. Escherichia coli cultures were grown at 37°C in Lysogeny Broth (LB) and LB agar medium containing 50 μg/ml kanamycin sulfate (Fisher Scientific, MA) for growth under selection. Diaminopimelic acid was used at a concentration of 360 μM when growing E. coli strain WM3064 for conjugation (24).
TABLE 2.
Strains used in this study
Bacterial mutant construction.
Plasmid vectors and primers used in this study are listed in Table 3. DNA modification enzymes were purchased from New England BioLabs (MA, USA), and primers were purchased from Integrated DNA Technologies (IA). New England BioLabs Monarch DNA purification kits were used for all DNA purification steps. Mutant construction was performed using the protocol reported earlier employing allelic exchange (11). Briefly, DNA regions flanking the gene of interest were amplified by PCR in two reactions, one using primers UF/UR, and the other with DF/DR corresponding to the region of interest. Purified upstream and downstream amplicons were digested with the corresponding restriction endonucleases and ligated using T4 ligase into a similarly digested and purified pSMV3 vector (24) followed by transformation into E. coli strain UQ950. Purified vector from E. coli UQ950 was then used to transform donor strain E. coli WM3064 (24), which was then used to conjugate plasmids into M. subterrani JG233 recipients. M. subterrani cells containing the deletion vector were selected on MB plates devoid of diaminopimelic acid and containing 50 μg/ml kanamycin sulfate for selection against the donor strain and for merodiploid mutants, respectively. Further selection on MB plates amended with 400 mM sucrose yielded kanamycin-sensitive colonies. Deletion mutants were confirmed by sequencing across the modified region amplified using the corresponding UF/DR primers listed in Table 3.
TABLE 3.
Vectors and primers used in this study
| Vector or primer | Relevant trait or sequence | Source |
|---|---|---|
| Vector | ||
| pSMV3 | Broad range cloning vector, Kmr | 21 |
| pSMV3ΔMsub_12632 | ΔMsub_12632 deletion construct | This study |
| pSMV3ΔMsub_20060 | ΔMsub_20060 deletion construct | This study |
| pSMV3ΔMsub_2280-2282 | ΔMsub_2280-2282 deletion construct | This study |
| Primer | ||
| ΔMsub_10588-10600 UF | CATGGGATCCCTTGGCTTTGTCGAATGGGTGG | This study |
| ΔMsub_10588-10600 UR | CATGCTCGAGGGTTAGACTAATCTCAGCGG | This study |
| ΔMsub_12632 UF | CGATACTAGTCTTGCTCACCCAGAACAACGGC | This study |
| ΔMsub_12632 UR | CGATCTTAAGCATCTGTGTTACTCCAAACTACACG | This study |
| ΔMsub_12632 DF | CGATCTTAAGGAGGTATGAGCTGTATTCG | This study |
| ΔMsub_12632 DR | CGATGAGCTCCCTGCAATGTGCCATTTGGC | This study |
| ΔMsub_20060 UF | ACGTGGATCCGGAGGTTCTCCACTGTAAGTGGG | This study |
| ΔMsub_20060 UR | ACGTCTTAAGAATCACGTCAGTCTAATCATGG | This study |
| ΔMsub_20060 DF | ACGTCTTAAGAATTGAGGTAGTGCCGTTGCCC | This study |
| ΔMsub_20060 DR | ACGTGAGCTCGCAACTACATCTGCTCAGCGG | This study |
| ΔMsub_2280-2282 UF | GCTAGGATCCCTCGGTCAGGGTCCTGCTGCG | This study |
| ΔMsub_2280-2282 UR | CGTACTTAAGACTCATGGTCTCTCTCTCCG | This study |
| ΔMsub_2280-2282 DF | CGATCTTAAGGCGTAATGGTGTGAATTGAGGC | This study |
| ΔMsub_2280-2282 DR | CGATGAGCTCCGGCTCTCGATCAGTTCCG | This study |
Gradient tube Fe(II)-oxidation assay.
Fe(II)-oxidation gradient tube assays were performed as reported earlier (11). Briefly, ferrous sulfide or ferrous carbonate stabilized in 1.0% agarose was deposited in the bottom of sterile Balch tubes and allowed to solidify. Fe(II) plugs were overlaid with 10 ml of MIM medium containing 0.15% of low-melt agarose (SeaKem LE Agarose, Lonza, ME), followed by sparging for 1 min using a N2:CO2 (80:20) gas mixture. Tubes were then sealed with butyl rubber stoppers and allowed to set overnight at ambient temperature. Overnight cultures of M. subterrani were washed with MIM medium before inoculation into the gradient tubes. Inoculation was performed by removing the butyl rubber stoppers from the tube, allowing the air into the headspace, and injecting cells throughout the length of the tube to obtain approximately 107 cells/ml of initial cell concentration. Gradient tubes were incubated statically in the dark at 30°C. To determine CFU density in gradient tubes, the entire content of the gradient tube was homogenized by passage through a 25-gauge needle immediately prior to plating on MB medium. Superoxide dismutase (532.5 mU/ml final concentration) was added to the gradient tubes to scavenge superoxide while testing the effect of metabolically produced superoxide on Fe(II) oxidation.
Heterotrophic cultivation with Fe(II).
Cultivation experiments in liquid culture were done in 60 ml serum bottles containing 20 ml MIM medium supplemented with 100 μM either sodium acetate or sodium fumarate. The bottles were made anoxic by sparging with N2:CO2 (80:20) gas mixture and sealed with butyl rubber stoppers followed by crimping with aluminum seals and autoclaved. When cool, 1 ml of filtered air was added to all the sealed bottles to introduce oxygen as the electron acceptor. For Fe(II)-containing treatments, filtered ferrous chloride was added to achieve a 500 μM concentration in the serum bottles. Overnight cultures of M. subterrani JG233 were grown in MB, washed three times with MIM, and inoculated into the serum bottles using sterile syringes and needles to achieve approximately 107 cells/ml of initial cell concentrations. One hundred microliters of the samples were removed from the serum bottles periodically and plated on MB medium plates to quantify CFU.
Cellular ATP quantification.
M. subterrani cells were inoculated into gradient tubes containing either ferrous sulfide or ferrous carbonate plugs at the bottom for Fe(II) containing treatments. No Fe(II) plugs were added to gradient tubes for the treatments to measure ATP in the absence of Fe(II). Aliquots of M. subterrani JG233 cells from gradient tube cultures were first centrifuged at 10,000 × g for 5 min, the liquid supernatant removed, and the gel pellet resuspended in 400 μl 1% trichloroacetic acid before a 2-h incubation on ice. Ten microliters of extracted sample was assayed according to the manufacturer’s protocol with the ENLITEN ATP Assay System (Promega, WI) using a GloMax 20/20 Luminometer (Promega, WI).
Extracellular nitrite quantification.
Samples from the liquid cultures were centrifuged at 16,000 × g for 2 min and the supernatants used for nitrite quantification. Nitrite concentrations in the samples were quantified using a previously published method (25). Briefly, 100 μl of the samples were mixed with 50 μl each of 58 mM sulfanilamide (Sigma-Aldrich, MO) in 3.6 N hydrochloric acid and 3.86 mM N-(1-naphthyl) ethylenediamine dihydrochloride (Sigma-Aldrich, MO) in 96-well plates. Absorbance was measured at 540 nm after incubating the mixtures for 15 min at room temperature. Nitrite was quantified by converting the absorbances to concentrations using a standard curve generated using known concentrations of sodium nitrite in MIM.
Extracellular superoxide detection.
Detection of superoxide used a method adapted from (26). 10 μl of ambient temperature 3 mM stock solution of diethylenetriaminepentaacetic acid (DTPA) and 3 μl of xanthine (final concentration of 50 μM) was added to the bottom of a sterile 1.5 ml microcentrifuge tube. In the blank treatment, 5 μl of a 3 kU/ml superoxide dismutase (Fisher Scientific, NH) stock was added. For positive controls, internal standards were amended to 1.2 mU/liter, 1.5 mU/liter and 8 mU/liter final concentration of freshly prepared 3 U/liter xanthine oxidase (Roche Diagnostics, IN) solution in phosphate-buffered saline, but with the drop suspended on the wall of the microcentrifuge tube, as to prevent premature mixing with the DTPA. No xanthine oxidase was added for the treatment containing only the cells as sample. Just prior to total luminescence detection in a Promega GloMax 20/20 Luminometer, 280 μl of the M. subterrani JG233 suspended in MIM (OD600 = 0.2) was added, allowing the contents to mix thoroughly. Following the addition of 12 μl of 250 μM red-CLA ([2-[4-[4-[3,7-dihydro-2-methyl-3-oxoimi-dazo[1,2-a]pyrazin-6-yl]phenoxy]butyramido]ethylamino]sulforhodamine101) in 50% (vol/vol) ethanol in water, the sample was assayed for total luminescence over 1 min, with a 1-s data acquisition time.
Resting cell Fe(II)-oxidation assays.
Fe(II)-oxidation assays were performed in 25 ml Balch tubes containing 5 ml of the MIM medium. Tubes containing the medium were made anaerobic by sparging with N2:CO2 (80:20) gas mixture followed by sealing with butyl rubber stoppers and aluminum crimps. Fe(II)-oxidation assays were performed using cells grown in MIM medium. Cells were pelleted by centrifugation at 16,000 × g for 3 min followed by washing with MIM medium. Resuspended cells were added anaerobically to achieve a final cell concentrations of 109 cells/ml. Filtered ferrous chloride solution was added anaerobically to achieve a final Fe(II) concentrations of approximately 1 mM. Filtered air (0.5 ml) was added to the tubes and incubated at 30°C. One hundred microliters of the samples were periodically collected anaerobically and added to 900 μl of 0.5 N HCl. Fe(II) in the samples was quantified using ferrozine (27).
ACKNOWLEDGMENTS
This research was supported by the Office of Naval Research (Award N00014-12-1-0309 to J.A.G.) and the Minnesota Environment and Natural Resources Trust Fund.
Contributor Information
Jeffrey A. Gralnick, Email: gralnick@umn.edu.
Jennifer B. Glass, Georgia Institute of Technology
REFERENCES
- 1.Ghiorse WC. 1984. Biology of iron-and manganese-depositing bacteria. Annu Rev Microbiol 38:515–550. 10.1146/annurev.mi.38.100184.002503. [DOI] [PubMed] [Google Scholar]
- 2.Konhauser KO, Kappler A, Roden EE. 2011. Iron in microbial metabolisms. Elements 7:89–93. 10.2113/gselements.7.2.89. [DOI] [Google Scholar]
- 3.McAllister SM, Moore RM, Gartman A, Luther GW, III, Emerson D, Chan CS. 2019. The Fe(II)-oxidizing Zetaproteobacteria: Historical, ecological, and genomic perspectives. FEMS Microbiol Ecol 95:fiz015. 10.1093/femsec/fiz015. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Emerson D, Rentz JA, Lilburn TG, Davis RE, Aldrich H, Chan CS, Moyer CL. 2007. A novel lineage of proteobacteria involved in formation of marine Fe-oxidizing microbial mat communities. PLoS One 2:e667. 10.1371/journal.pone.0000667. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Singer E, Emerson D, Webb EA, Barco RA, Kuenen JG, Nelson WC, Chan CS, Comolli LR, Ferriera S, Johnson J, Heidelberg JF, Edwards KJ. 2011. Mariprofundus ferrooxydans PV-1 the first genome of a marine Fe(II) oxidizing Zetaproteobacterium. PLoS One 6:e25386. 10.1371/journal.pone.0025386. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Chiu BK, Kato S, McAllister SM, Field EK, Chan CS. 2017. Novel pelagic iron-oxidizing Zetaproteobacteria from the Chesapeake Bay oxic–anoxic transition zone. Front Microbiol 8:1280. 10.3389/fmicb.2017.01280. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Krepski ST, Hanson TE, Chan CS. 2012. Isolation and characterization of a novel biomineral stalk‐forming iron‐oxidizing bacterium from a circumneutral groundwater seep. Environ Microbiol 14:1671–1680. 10.1111/j.1462-2920.2011.02652.x. [DOI] [PubMed] [Google Scholar]
- 8.Emerson D, Moyer C. 1997. Isolation and characterization of novel iron-oxidizing bacteria that grow at circumneutral pH. Appl Environ Microbiol 63:4784–4792. 10.1128/aem.63.12.4784-4792.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Kucera S, Wolfe RS. 1957. A selective enrichment method for Gallionella ferruginea. J Bacteriol 74:344–349. 10.1128/jb.74.3.344-349.1957. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Lueder U, Druschel G, Emerson D, Kappler A, Schmidt C. 2018. Quantitative analysis of O2 and Fe2+ profiles in gradient tubes for cultivation of microaerophilic iron(II)-oxidizing bacteria. FEMS Microbiol Ecol 94:fix177. 10.1093/femsec/fix177. [DOI] [PubMed] [Google Scholar]
- 11.Bonis BM, Gralnick JA. 2015. Marinobacter subterrani, a genetically tractable neutrophilic Fe(II)-oxidizing strain isolated from the Soudan Iron Mine. Front Microbiol 6:719. 10.3389/fmicb.2015.00719. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Smith AR. 2011. Subsurface igneous mineral microbiology: iron-oxidizing organotrophs on olivine surfaces and the significance of mineral heterogeneity in basalts. (MS thesis, Portland State University, Portland, Oregon). https://pdxscholar.library.pdx.edu/open_access_etds/294/. [Google Scholar]
- 13.Leslie K, Sturm A, Stotler R, Oates CJ, Kyser TK, Fowle DA. 2015. Marinobacter bacteria associated with a massive sulphide ore deposit affect metal mobility in the deep subsurface. Geochem-Exploration Env A 15:319–326. 10.1144/geochem2014-275. [DOI] [Google Scholar]
- 14.Edwards KJ, Rogers DR, Wirsen CO, McCollom TM. 2003. Isolation and characterization of novel psychrophilic, neutrophilic, Fe-oxidizing, chemolithoautotrophic α-and γ-Proteobacteria from the deep sea. Appl Environ Microbiol 69:2906–2913. 10.1128/AEM.69.5.2906-2913.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Sudek LA. 2011. Ecology of microbe/basaltic glass interactions: mechanisms and diversity (Doctoral dissertation, University of Califonia, San Diego, La Jolla, California). https://escholarship.org/uc/item/5k68b0md. [Google Scholar]
- 16.Wang H, Li H, Shao Z, Liao S, Johnstone L, Rensing C, Wang G. 2012. Genome sequence of deep-sea manganese-oxidizing bacterium Marinobacter manganoxydans Mnl7-9. J Bacteriol 194:899–900. 10.1128/JB.06551-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Liu C, Chen C, Zhang X, Yu Y, Liu A, Li G, Chen X, Chen B, Zhou B, Zhang Y. 2012. Marinobacter antarcticus sp. nov. a halotolerant bacterium isolated from Antarctic intertidal sandy sediment. Int J Syst Evol Microbiol 62:1838–1844. 10.1099/ijs.0.035774-0. [DOI] [PubMed] [Google Scholar]
- 18.Mikucki JA, Priscu JC. 2007. Bacterial diversity associated with Blood Falls, a subglacial outflow from the Taylor glacier, Antarctica. Appl Environ Microbiol 73:4029–4039. 10.1128/AEM.01396-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Kaeppel EC, Gärdes A, Seebah S, Grossart HP, Ullrich MS. 2012. Marinobacter adhaerens sp. nov. isolated from marine aggregates formed with the diatom Thalassiosira weissflogii. Int J Syst Evol Microbiol 62:124–128. 10.1099/ijs.0.030189-0. [DOI] [PubMed] [Google Scholar]
- 20.Bagheri M, Amoozegar MA, Didari M, Makhdoumi-Kakhki A, Schumann P, Spröer C, Sánchez-Porro C, Ventosa A. 2013. Marinobacter persicus sp. nov., a moderately halophilic bacterium from a saline lake in Iran. Antonie Van Leeuwenhoek 104:47–54. 10.1007/s10482-013-9923-3. [DOI] [PubMed] [Google Scholar]
- 21.Daly RA, Borton MA, Wilkins MJ, Hoyt DW, Kountz DJ, Wolfe RA, Welch SA, Marcus DN, Trexler RV, Macrae JD, Krzycki JA, Cole DR, Mouser PJ, Wrighton KC. 2016. Microbial metabolisms in a 2.5-km-deep ecosystem created by hydraulic fracturing in shales. Nat Microbiol 1:16146. 10.1038/nmicrobiol.2016.146. [DOI] [PubMed] [Google Scholar]
- 22.Liebgott PP, Casalot L, Paillard S, Lorquin J, Labat M. 2006. Marinobacter vinifirmus sp. nov., a moderately halophilic bacterium isolated from a wine-barrel-decalcification wastewater. Int J Syst Evol Microbiol 56:2511–2516. 10.1099/ijs.0.64368-0. [DOI] [PubMed] [Google Scholar]
- 23.Singer E, Webb EA, Nelson WC, Heidelberg JF, Ivanova N, Pati A, Edwards KJ. 2011. Genomic potential of Marinobacter aquaeolei, a biogeochemical “opportunitroph. Appl Environ Microbiol 77:2763–2771. 10.1128/AEM.01866-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Saltikov CW, Newman DK. 2003. Genetic identification of a respiratory arsenate reductase. Proc Natl Acad Sci USA 100:10983–10988. 10.1073/pnas.1834303100. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Ringuet S, Sassano L, Johnson ZI. 2011. A suite of microplate reader-based colorimetric methods to quantify ammonium, nitrate, orthophosphate and silicate concentrations for aquatic nutrient monitoring. J Environ Monit 13:370–376. 10.1039/c0em00290a. [DOI] [PubMed] [Google Scholar]
- 26.Godrant A, Rose AL, Sarthou G, Waite TD. 2009. New method for the determination of extracellular production of superoxide by marine phytoplankton using the chemiluminescence probes MCLA and red-CLA. Limnol Oceanogr Methods 7:682–692. 10.4319/lom.2009.7.682. [DOI] [Google Scholar]
- 27.Stookey LL. 1970. Ferrozine—a new spectrophotometric reagent for iron. Anal Chem 42:779–781. 10.1021/ac60289a016. [DOI] [Google Scholar]
- 28.Tebo BM, Johnson HA, McCarthy JK, Templeton AS. 2005. Geomicrobiology of manganese (II) oxidation. Trends Microbiol 13:421–428. 10.1016/j.tim.2005.07.009. [DOI] [PubMed] [Google Scholar]
- 29.Carlson HK, Clark IC, Blazewicz SJ, Iavarone AT, Coates JD. 2013. Fe(II) oxidation is an innate capability of nitrate-reducing bacteria that involves abiotic and biotic reactions. J Bacteriol 195:3260–3268. 10.1128/JB.00058-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Klueglein N, Kappler A. 2013. Abiotic oxidation of Fe(II) by reactive nitrogen species in cultures of the nitrate-reducing Fe(II) oxidizer Acidovorax sp. BoFeN1 – questioning the existence of enzymatic Fe(II) oxidation. Geobiology 11:180–190. 10.1111/gbi.12019. [DOI] [PubMed] [Google Scholar]
- 31.Boden R, Hutt LP. 2018. Chemolithoheterotrophy: means to higher growth yields from this widespread metabolic trait, p 1–25. In Rojo F (ed), Aerobic utilization of hydrocarbons, oils and lipids. Springer, Cham, Switzerland. [Google Scholar]
- 32.Sorokin DY, Tourova TP, Muyzer G. 2005. Citreicella thiooxidans gen. nov., sp. nov., a novel lithoheterotrophic sulfur-oxidizing bacterium from the Black Sea. Syst Appl Microbiol 28:679–687. 10.1016/j.syapm.2005.05.006. [DOI] [PubMed] [Google Scholar]
- 33.Suylen GMH, Stefess GC, Kuenen JG. 1986. Chemolithotrophic potential of a Hyphomicrobium species, capable of growth on methylated sulphur compounds. Arch Microbiol 146:192–198. 10.1007/BF00402350. [DOI] [Google Scholar]
- 34.Castelle C, Guiral M, Malarte G, Ledgham F, Leroy G, Brugna M, Giudici-Orticoni MT. 2008. A new iron-oxidizing/O2-reducing supercomplex spanning both inner and outer membranes, isolated from the extreme acidophile Acidithiobacillus ferrooxidans. J Biol Chem 283:25803–25811. 10.1074/jbc.M802496200. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Barco RA, Emerson D, Sylvan JB, Orcutt BN, Jacobson Meyers ME, Ramírez GA, Zhong JD, Edwards KJ. 2015. New insight into microbial iron oxidation as revealed by the proteomic profile of an obligate iron-oxidizing chemolithoautotroph. Appl Environ Microbiol 81:5927–5937. 10.1128/AEM.01374-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Jiao Y, Newman DK. 2007. The pio operon is essential for phototrophic Fe(II) oxidation in Rhodopseudomonas palustris TIE-1. J Bacteriol 189:1765–1773. 10.1128/JB.00776-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Croal LR, Jiao Y, Newman DK. 2007. The fox operon from Rhodobacter strain SW2 promotes phototrophic Fe(II) oxidation in Rhodobacter capsulatus SB1003. J Bacteriol 189:1774–1782. 10.1128/JB.01395-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Liu J, Wang Z, Belchik SM, Edwards MJ, Liu C, Kennedy DW, Merkley ED, Lipton MS, Butt JN, Richardson DJ, Zachara JM, Fredrickson JK, Rosso KM, Shi L. 2012. Identification and characterization of MtoA: a decaheme c-type cytochrome of the neutrophilic Fe(II)-oxidizing bacterium Sideroxydans lithotrophicus ES-1. Front Microbiol 3:37. 10.3389/fmicb.2012.00037. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.He S, Barco RA, Emerson D, Roden EE. 2017. Comparative genomic analysis of neutrophilic iron(II) oxidizer genomes for candidate genes in extracellular electron transfer. Front Microbiol 8:1584. 10.3389/fmicb.2017.01584. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Huston WM, Jennings MP, McEwan AG. 2002. The multicopper oxidase of Pseudomonas aeruginosa is a ferroxidase with a central role in iron acquisition. Mol Microbiol 45:1741–1750. 10.1046/j.1365-2958.2002.03132.x. [DOI] [PubMed] [Google Scholar]
- 41.Blackwell N, Bryce C, Straub D, Kappler A, Kleindienst S. 2020. Genomic insights into two novel Fe(II)-oxidizing Zetaproteobacteria isolates reveal lifestyle adaption to coastal marine sediments. Appl Environ Microbiol 86:e01160-20. 10.1128/AEM.01160-20. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Corstjens PLAM, De Vrind JPM, Goosen T, Jong EDVD. 1997. Identification and molecular analysis of the Leptothrix discophora SS‐1 mofA gene, a gene putatively encoding a manganese‐oxidizing protein with copper domains. Geomicrobiol J 14:91–108. 10.1080/01490459709378037. [DOI] [Google Scholar]
- 43.Geszvain K, McCarthy JK, Tebo BM. 2013. Elimination of manganese (II, III) oxidation in Pseudomonas putida GB-1 by a double knockout of two putative multicopper oxidase genes. Appl Environ Microbiol 79:357–366. 10.1128/AEM.01850-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Diaz JM, Hansel CM, Voelker BM, Mendes CM, Andeer PF, Zhang T. 2013. Widespread production of extracellular superoxide by heterotrophic bacteria. Science 340:1223–1226. 10.1126/science.1237331. [DOI] [PubMed] [Google Scholar]