Chronic binge alcohol and ovariectomy-mediated impaired insulin responsiveness in SIV-infected female rhesus macaques

Abstract

Aging people living with HIV (PLWH), especially postmenopausal women may be at higher risk of comorbidities associated with HIV, antiretroviral therapy (ART), hypogonadism, and at-risk alcohol use. Our studies in simian immunodeficiency virus (SIV)-infected male macaques demonstrated that chronic binge alcohol (CBA) reduced acute insulin response to glucose (AIRG), and at-risk alcohol use decreased HOMA-β in PLWH. The objective of this study was to examine the impact of ovariectomy (OVX) on glucose-insulin dynamics and integrity of pancreatic endocrine function in CBA/SIV-infected female macaques. Female macaques were administered CBA (12–15 g/kg/wk) or isovolumetric water (VEH) intragastrically. Three months after initiation of CBA/VEH administration, all macaques were infected with SIV_mac251, and initiated on antiretroviral therapy (ART) 2.5 mo postinfection. After 1 mo of ART, macaques were randomized to OVX or sham surgeries (n = 7 or 8/group), and euthanized 8 mo post-OVX (study endpoint). Frequently sampled intravenous glucose tolerance tests (FSIVGTT) were performed at selected time points. Pancreatic gene expression and islet morphology were determined at study endpoint. There was a main effect of CBA to decrease AIRG at Pre-SIV and study endpoint. There were no statistically significant OVX effects on AIRG (P = 0.06). CBA and OVX decreased the expression of pancreatic markers of insulin docking and release. OVX increased endoplasmic stress markers. CBA but not OVX impaired glucose-insulin expression dynamics in SIV-infected female macaques. Both CBA and OVX altered integrity of pancreatic endocrine function. These findings suggest increased vulnerability of PLWH to overt metabolic dysfunction that may be exacerbated by alcohol use and ovarian hormone loss.

INTRODUCTION

Highly effective antiretroviral therapy (ART) has significantly increased the life expectancy of people living with HIV (PLWH). Currently, over 50% of PLWH in the United States are 50 yr of age or older (1). Early onset of menopause is reported in HIV-infected females (2, 3). Aging and increased survival of PLWH on ART are complicated by metabolic comorbidities leading to a higher risk for insulin resistance (IR), glucose intolerance, and type 2 diabetes mellitus (T2DM) (4, 5). Though the mechanisms remain poorly understood, persistent inflammation and immune activation (6, 7), and ART (8–10) contribute to the development of metabolic dysregulation in HIV and can be exacerbated by diet, an increased overall prevalence of obesity (11–13), and at-risk alcohol use (14–16).

Impaired glucose-insulin dynamics is typified by pancreatic β-cell dysfunction. However, the potential contribution of β-cell dysfunction in HIV-related glucose dyshomeostasis remains much less characterized (17). Although most research has focused on alcohol-induced alterations of peripheral tissue insulin sensitivity, little is known on alcohol’s effects on β-cell function. In response to a glucose challenge, glucose that enters β-cells through glucose transporters is phosphorylated by glucokinase (GCK) and generates ATP. This inhibits ATP-sensitive K⁺ channels (KATP) resulting in membrane depolarization, increased Ca²⁺ influx through activated voltage-dependent Ca²⁺channels (VDCC), and exocytosis of insulin secretory granules and insulin release. Initial/acute insulin release is mediated by vesicle-associated membrane protein 2 (VAMP2), syntaxin1A, and synaptosomal-associated protein, 25 kDa (SNAP-25) (18). In parallel, increased blood glucose concentration increases insulin transcription (19) through canonical transcription factors, pancreatic and duodenal homeobox-1 (PDX-1), V-maf musculoaponeurotic fibrosarcoma oncogene homolog A (MaFA), and NKX.2 (19–21). One of the earliest manifestations of T2DM is attenuation of the acute glucose-induced insulin secretion phase, and this can be associated with decreased number of β-cell docked insulin granules and decreased expression of genes involved in vesicle docking (22).

Although mechanisms for alcohol-induced exocrine pancreatic damage are well described, increasing evidence of alcohol-induced endocrine pancreas dysregulation is emerging. Clinical (23–25) and preclinical studies (26–28) demonstrate that at-risk alcohol use is an independent risk factor for development of T2DM (29, 30) and more than 30% of all alcohol-associated deaths are due to T2DM and cardiovascular disease (31). Clinical studies show that alcohol decreases circulating basal insulin secretion (32) and decreases circulating insulin and c-peptide levels in response to glucose (33). Similarly, rodents on an alcohol diet have decreased circulating insulin levels (34), and decreased pancreatic expression of GCK and GLUT2 (35). Moreover, in vitro alcohol exposure decreases glucose-stimulated insulin secretion (GSIS) in human (36) and rodent (34, 37, 38) pancreatic islets, and increases β-cell apoptosis (29, 35, 39). These studies indicate that alcohol-mediated impaired β-cell function may negatively affect glucose homeostasis.

The hormonal changes associated with menopause alter multiple physiological processes. However, the effect of ovarian hormone loss on glucose homeostasis remains to be fully understood. Two clinical studies in postmenopausal females, the Women’s Health Initiative and the Heart and Estrogen/progestin Replacement Study, reported that supplementing estrogen significantly reduced the incidence of T2DM (40, 41), and that estrogen therapy improved GSIS (42). Preclinical studies indicate that ovariectomy (OVX) increases symptoms similar to diabetes (43) and estrogen protects β-cells against glucolipotoxicity, oxidative stress, and apoptosis (44). Estrogen is mechanistically shown to enhance GSIS both in vitro and in vivo (45), and aromatase and estradiol rodent knockout models have blunted estrogen signaling and reduced insulin expression (44).

Our previously published data from chronic binge alcohol (CBA)-administered simian immunodeficiency virus (SIV)-infected ART-treated male macaques demonstrate significant metabolic dyshomeostasis. The Frequently Sampled Intravenous Glucose Tolerance Test (FSIVGTT) with a third-phase insulin infusion (Modified Minimal Model) showed that CBA impaired endocrine pancreatic response to a glucose load and decreased disposition index, an indicator of insulin resistance (46). CBA also increased skeletal muscle proteasomal activity, impaired anabolic pathways and insulin signaling (47–50), altered mitochondrial function (51, 52), and dysregulated gene networks that maintain muscle homeostasis (53). These whole body and tissue-specific alterations observed in CBA/SIV ART-treated macaques occurred in the absence of overt dysglycemia or dyslipidemia (46, 54). Not only did these alterations precede overt glucose intolerance, but they also occurred despite the consumption of a nutritionally balanced diet, and a lack of significant alterations in body composition. In subsequent translational studies in a cohort of PLWH from the Greater New Orleans Area [New Orleans Alcohol Use in HIV (NOAH) Study] (55), we showed that 36% of subjects enrolled met criteria for metabolic syndrome and 14.5% were diagnosed with T2DM. Among nondiabetics, 50% had a homeostatic model assessment of insulin resistance (HOMA-IR) > 1.9, and HOMA-β, an indicator of β-cell function, was negatively associated with at-risk alcohol use (56). Taken together, results from our preclinical and clinical studies indicate that at-risk-alcohol use dysregulates pancreatic endocrine function. Whether ovarian hormone loss exacerbates alcohol-induced pancreatic endocrine dysfunction in HIV/SIV is not known. The objective of this study was to examine the impact of OVX on glucose-insulin dynamics and integrity of pancreatic endocrine function in CBA/SIV-infected female macaques.

METHODS

All animal experiments were approved by the Institutional Animal Care and Use Committee at the Louisiana State University Health Sciences Center in New Orleans (LSUHSC-NO), LA, which is accredited by Association for Assessment and Accreditation of Laboratory Animal Care International, were performed in accordance with the Guide for the Care and Use of Laboratory Animals, and adhered to National Institutes of Health guidelines for the care and use of animals. The animal housing rooms were maintained on a 12:12-h light:dark cycle, with a relative humidity of 30%–70% and a temperature of 64–84°F (18–29°C). All animals were fed a standard, commercially formulated nonhuman primate (NHP).

Animal Characteristics and Study Design

Adult (6–9 yr old) female Indian rhesus macaques (Macaca mulatta) were randomized based on in vitro SIV infectivity kinetics to either chronic binge alcohol (CBA) or isovolumetric water (VEH) groups. Macaques were administered alcohol at a concentration of 30% (wt/vol) in water (30 min infusion; 5 days/wk; 12–15 g/kg/wk) intragastrically. Peak plasma alcohol concentrations averaged 50–60 mM (∼230 mg%) 2 h after alcohol initiation. After 3 mo of CBA/VEH administration (Pre-SIV), animals were inoculated intravaginally with SIV_mac251. CBA/VEH administration continued throughout the study. At viral set-point (2.5 mo post-SIV infection), all macaques were initiated on daily subcutaneous injections of 20 mg/kg of Tenofovir [9-(2-phosphonomethoxypropyl) adenine, PMPA] and 30 mg/kg of emtricitabine (FTC), provided by Gilead Sciences Inc. (Foster City, CA). This drug combination and dose suppresses viral load and results in minimal toxicity in normal healthy macaques from infancy to adulthood and does not result in liver or renal toxicity in SIV-infected macaques (57). One-month postinitiation of ART, animals were randomized to either OVX or SHAM surgeries for a total of four treatment groups: VEH/SHAM (n = 8), VEH/OVX (n = 7), CBA/SHAM (n = 7), and CBA/OVX (n = 7). Food consumption was monitored and were provided with Boost/Ensure supplement or PRIMA-Burger (Labserv) if there was a 10% reduction in food intake. Physical examinations performed every week included monitoring body weight and measures of general health. Eight months after OVX or SHAM (study endpoint), after an overnight fast, all macaques were euthanized according to the American Veterinary Medical Association’s guidelines. Pancreatic samples were flash frozen, cryopreserved until further analysis, or fixed in Z-fix and paraffin-embedded for histological analysis. The total time for CBA/VEH administration was 14.5 mo, SIV infection was 11.5 mo, and all animals were on ART for 9 mo (Fig. 1).

Figure 1.

Macaque study design. Adult (6–9 yr old) female Indian rhesus macaques (Macaca mulatta) were administered chronic binge alcohol (CBA) at a concentration of 30% (wt/vol) in water (30 min infusion; 5 days/wk; 12–15 g/kg/wk) intragastrically or isovolumetric water (VEH). After 3 months of CBA/VEH administration [Pre-simian immunodeficiency virus (SIV)], all animals were inoculated intravaginally with SIV_mac251. CBA/VEH administration continued throughout the study. At viral set-point (2.5 mo post-SIV infection), all macaques were initiated on antiretroviral therapy (ART). One-month postinitiation of ART, animals were randomized to either ovariectomy (OVX) or SHAM surgeries and humanely euthanized at 8 mo following OVX or SHAM (study endpoint). The total time for CBA/VEH administration was 14.5 mo, SIV infection 11.5 mo, and ART 9 mo.

Body Composition and Blood Chemistry

Body weights were recorded using an Avery Weigh-Tronix scale with a WI-125 electronic weight indicator. Dual-energy X-ray absorptiometry scans were performed to assess total body lean and fat mass using a Prodigy Total Body Fan-Beam densitometer (GE Medical Systems, Madison, WI) with a Small Animal package of the enCORE software. Blood was collected at the relevant time points and sent to the Tulane National Primate Research Center Pathology laboratory for determining complete blood counts (CBC), and blood chemistry.

Frequently sampled intravenous glucose tolerance test (FSIVGTT) was performed as previously published (46) at baseline, Pre-SIV, and study endpoint. Briefly, macaques were preanesthetized with ketamine-xylazine and maintained under isoflurane anesthesia with oxygen supplementation throughout the experiment. Venous catheters were placed in the saphenous veins for blood sampling and cephalic veins for administration of glucose and insulin. A bolus of glucose (0.5 g/kg) was administered at time point 0 min and insulin (0.015 U/kg) 20 min later. Blood was frequently drawn between −10 and 180 min. Blood glucose levels were determined using a glucometer, serum insulin levels using ELISAs (Human Insulin ELISA, ALPCO, Salem, NH), and c-peptide using Human c-peptide ELISA (ALPCO). Minimal model software (58) was used to determine the acute insulin response to glucose (AIRG), disposition index (DI = AIRG × Si), glucose effectiveness (Sg), and insulin sensitivity index (Si). Si was adjusted for lean mass (Si/lean mass%).

The following additional formulas were also used: 1) insulinogenic index = (insulin at 18 min − insulin at 0 min)/(glucose at 18 min − glucose at 0 min); 2) C-peptide index = [C-peptide area under the curve (AUC)/glucose AUC] × 100; 3) HOMA-IR = fasting insulin (µU/mL) × fasting glucose (mg/dL)/405, (59, 60); and 4) HOMA-β = 360 × fasting insulin (µU/mL)/(fasting glucose (mg/dL) − 63) (61).

RNA Isolation and Real-Time Polymerase Chain Reaction

Total RNA was extracted from pancreatic tissue using the miRNeasy Mini Kit (Qiagen, Valencia, CA) and cDNA was synthesized from 1 µg of RNA using the Quantitect reverse transcription kit (Qiagen) according to manufacturer’s instructions. Custom primers were purchased from Integrated DNA Technologies (Coralville, IA; Table 1). Final reactions contained cDNA (50 ng), primers (500 nM), SyBr green (1:2, Quantitect SyBr Green PCR kit, Qiagen) in 20 µL. Polymerase chain reactions (qPCRs) were carried out in duplicate using a CFX96 thermal cycler (Bio-Rad, Hercules, CA) with ribosomal protein S13 (rpS13) as the endogenous control (54, 62) . Results are presented as fold change expression of target genes versus the control group (VEH/SIV/SHAM).

Table 1.

List of Macaca mulatta primers used

Gene	Forward Primer	Reverse Primer
Caspase 3	GTTCATCCAGTCGCTTTGT	TTCTGTTGCCACCTTTCG
Caspase 8	CATCTATGGCACTGATGGAC	CCCTGACAAGCCTGAATAAA
Caspase 9	CCGTTCCAGGAAGATTTGAG	AACCCGGGAAAGTAGAGTAG
Activating transcription factor 4 (ATF4)	CCACTCCAGATCATTCCTTTAG	AGGGATCATGGCAACATAAG
X-Box binding protein 1 (XBP1)	ATGGATTCTGGCCCTATTG	GGGAAGGGCATTTGAAGAA
C/EBP homologous protein (CHOP)	TTTCTCCTTCGGGACACT	TTCCAGGAGGTGAGACATAG
Insulin	GCTGGACTACTGCAACTA	GCTGGTTCAAGGGCTTTATTC
Glucose transporter (GLUT2)	GAACTGCCCACAATTGCATAC	GGGACCAGAGCATAGTGATTAG
GLUCAGON	AAGGCGAGATTTCCCAGAAG	GTCCCTGGTGGCAAGATTAT
Glucokinase (GCK)	AGATGCCATCAAACGGAGAG	GCACTGATGGTCTTCGTAGTA
Calcium voltage-gated channel subunit α1 C (VDCC)	GATAGGAGGCAGAGAAGAGT	GTGTTGGGAAAGACAGAGAG
Potassium inwardly rectifying channel subfamily J member 11 (KIR6.2)	CCCAAGTTCAGCATCTCTC	GGCTACATACCATACCACAC
Syntaxin 1 (STX1)	GGAGATTCGAGGCTTCATTG	TCCTCCTTCGTCTTCTCATC
Vesicle-associated membrane protein 2 (VAMP2)	CCTTCACCTCCTCTCTCTT	GGAGAGGAGAGGGACTATTG
Exchange protein directly activated by cAMP 2 (EPAC2)	GTTATGGAAACGGGCTATAA	CTGAAGGGACCTTGGTAATG
Homeobox protein (NKX2.1)	CTGCTGGACTTGTGCTTCT	TCGGAGAACGATGAAGAGGA
MAF BZIP Transcription Factor A (MAFA)	GCGGAGAACGGTGATTT	AAGGTGGGAACGGAGAA
Pancreatic and duodenal homeobox 1 (PDX1)	GATACAGGATTGGCGTTGT	GAAGAGTCGGCTTCTCTAAAC
Peroxisome proliferator-activated receptor γ coactivator-1A (PGC1A)	GAGCGCCGTGTGATTTAT	CATCATCCCGCAGATTTACT
Peroxisome proliferator-activated receptor γ coactivator-1B (PGC1B)	CTCATTCGGTGCTGTGTATT	TCTGGGTTACTCCTCAGTTT
Ribosomal protein S 13 (RPS13)	CCCACTTGGTTGAAGTTGA	CAGGATCACACCGATTTGT

Immunofluorescence

Paraffin sections were sliced at 5 µm, deparaffinized, and rehydrated in graded alcohols. Slides were placed in boiling sodium citrate buffer (0.1 M, pH 6.0) for 4 min for antigen detection. Tissue was permeabilized with 0.1% Triton-X 100 in phosphate-buffered saline (PBS). Samples were blocked for 1 h in 10% normal goat serum (NGS) in PBS 0.1% Tween (PBST)-5% BSA in a humidified chamber and incubated with insulin antibody (1:1,000; No. NBP2-34260, Novus, Dallas, TX) in 10% NGS-PBST-BSA overnight at 4°C. They were then incubated in secondary antibody (AlexaFluor 568 goat anti-mouse, 1:1,000; No. A-11004 Invitrogen, Carlsbad, CA) for 1 h at room temperature. Sections were washed before incubating with rabbit anti-glucagon (1:1,000; No. 2760S, Cell Signaling, Danvers, MA) overnight at 4°C, incubated in secondary antibody (AlexaFluor 488 goat anti-rabbit, 1:1,000; No. A-11034, Invitrogen) for 1 h at room temperature, and mounted with Vectashield Hardset mounting media with DAPI (Vector Labs, Burlingame, CA). Cell Signaling Technology uses different validation steps for antibodies (https://www.cellsignal.com/about-us/our-approach-process/antibody-validation-immunohistochemistry). In addition, when antibodies were optimized in the laboratory, tissue sections with secondary antibody but no primary antibody, or primary antibody with no secondary antibody were included to ensure specificity of positive staining. Using a Nikon TE2000U microscope, 25 images of islets per animal were taken at ×40 magnification. Images were analyzed using FIJI (ImageJ) software to calculate the integrated density (area × mean gray value). Corrected total cell fluorescence (CTCF) was calculated by subtracting the product of the selected cell area and mean background fluorescence intensity from integrated density. Mean CTCF values from each animal were used to calculate mean CTCF values for each corresponding treatment group. Islets were imaged at ×20 and the size of 30 islets measured. Islet number was calculated from four images at ×20 of random areas of the pancreas. Average islet size was multiplied by islet number to calculate the average islet area per pancreatic area (63).

DNA Fragment End Labeling Using Terminal Deoxynucleotidyl Transferase Enzyme Staining

Staining was performed using the Fragment End Labeling (FragEL) DNA Fragmentation Detection Kit, Colorimetric—terminal deoxynucleotidyl transferase (TdT) Enzyme (QIA33; Millipore Sigma) according to manufacturer’s instructions with slight modifications. Paraffin sections were sliced at 5 µm, deparaffinized, and rehydrated in graded alcohols. Tissue sections were permeabilized in 20 µg/mL proteinase K for 20 min and endogenous peroxidases inactivated with 3% hydrogen peroxide for 30 min. After the samples were incubated in equilibration buffer for 20 min, samples were incubated in 60 µL of TdT labeling reaction mixture at 37°C for 20 min. The reaction was stopped by incubating in 100 µL stop solution for 20 min and rinsed with Tris-buffered saline (TBS). The samples were blocked with 100 µL blocking buffer for 10 min and then 100 µL of diluted 1× conjugate for 30 min and detected using 3,3′-diaminobenzidine (DAB) Substrate Kit Peroxidase (HRP), (SK-4100 Vector laboratories, Burlingame, CA). For positive controls, samples were incubated with 1 µg/µL DNase I in 1× TBS/1 mM MgSO₄ for 20 min. For negative controls, TdT enzyme was substituted with water. Number of positive cells in 25 islets were counted for each animal to calculate average positive cells for each corresponding treatment group.

Statistical Analyses

Data were checked for outliers using Grubbs’ test and for normality using the Kolmogorov–Smirnov test. Differences in metabolic measures at Pre-SIV were determined using independent samples t test. Metabolic measures and gene expression were analyzed using a two-way analysis of variance (ANOVA) at study endpoint. When appropriate, the post hoc pairwise comparisons were conducted using the Tukey’s honestly significant difference (HSD) test. Differences in glucose, insulin, and c-peptide levels overtime during the first 18 and 180 min of FSIVGTT were determined using two-way repeated measures ANOVA. Differences in body composition were determined using three-way repeated measures ANOVA with Sidak post hoc. All analyses were performed using Prism Graph Pad Version 7 (La Jolla, CA) and the α level of significance was set at 0.05.

RESULTS

Body Composition and Blood Chemistry

Macaques were separated into the assigned treatment groups at baseline, Pre-SIV, and study endpoint. There were no differences in body weight at baseline, but there was a main effect of OVX to decrease body weight at Pre-SIV and study endpoint (Fig. 2A). Thus, although it appears that OVX decreased body weight at study endpoint, this does not appear to be due to biological effects of OVX. Moreover, there were no significant differences in body weight gain between Pre-SIV and Study endpoint (Fig. 2B). There was a main effect of time to increase total body fat percentage, with no significant differences between treatment groups (Fig. 2C). There were no differences between treatment groups for measures of serum triglycerides, cholesterol, aspartate aminotransferase (AST), alanine aminotransferase (ALT), and lactate dehydrogenase (LDH) at study endpoint. All the blood chemistry values were in the normal range of rhesus macaques (Table 2).

Figure 2.

Body composition of simian immunodeficiency virus (SIV)-infected female rhesus macaques. A: body weights at baseline, after 3 mo of chronic binge alcohol (CBA) and isovolumic water (VEH) administration (Pre-SIV), and 11 mo after SIV-infection (study endpoint). Macaques in the ovariectomy (OVX) groups had decreased body weight at Pre-SIV and study endpoint. B: change in body weight at Pre-SIV and study endpoint. Macaques in the OVX groups had decreased body weight gain at Pre-SIV, and study endpoint compared with baseline. There was no difference in weight gain between Pre-SIV and study endpoint. C: total body fat percent at baseline, pre-SIV, and study endpoint. There was a main effect of timepoint to increase body fat. Data analyzed using three-way repeated measures ANOVA. VEH/SIV/SHAM (n = 8), VEH/SIV/OVX (n = 7), CBA/SIV/SHAM (n = 7), and CBA/SIV/OVX (n = 7) animals. *,#P < 0.05.

Table 2.

Blood chemistries in SIV-infected female rhesus macaques

	Study Endpoint
Metabolic Measures	VEH/SHAM	VEH/OVX	CBA/SHAM	CBA/OVX
Triglycerides	118.9 ± 38.4	102.3 ± 29.1	61.86 ± 11.2	55.71 ± 13.9
Cholesterol	104 ± 7.1	136.9 ± 11.1	123.6 ± 9.2	119.4 ± 7.5
AST	24.8 ± 3.3	26 ± 3.5	21 ± 2	32.4 ± 6.5
ALT	21.9 ± 2.6	28.3 ± 5.3	28 ± 5.1	29.4 ± 3.8
LDH	436.1 ± 97.2	351.3 ± 56.5	471 ± 116.5	350.9 ± 39.3

Triglycerides (mg/dL), cholesterol (mg/dL), aspartate aminotransferase (AST, U/L), alanine aminotransferase (ALT, U/L), lactate dehydrogenase (LDH, U/L) levels. Data shown as means ± SE isovolumetric water (VEH)/ simian immunodeficiency virus (SIV)/SHAM (n = 8), VEH/SIV/ovariectomy (OVX, n = 7), chronic binge alcohol (CBA)/SIV/SHAM (n = 7), and CBA/SIV/OVX (n = 7) groups at 11 mo after SIV-infection (study endpoint) and analyzed using two-way ANOVA.

Frequently Sampled Glucose Tolerance Tests and MinMod Analysis

The means ± SE of baseline average values were 71.7 ± 4.3 (mU·min)/mL for AIRG, 867.1 ± 437.8 arbitrary units for DI, 0.2 ± 0.001 for Sg, and 0.004 ± 0.002 for adjusted Si, respectively. There were no statistically significant differences between macaques randomized to CBA/VEH or SHAM/OVX groups. At Pre-SIV, AIRG was significantly decreased in the CBA compared with the VEH group (P = 0.02, Fig. 3A). At study endpoint, there was a main effect of CBA to decrease AIRG (P = 0.04, Fig. 3B) and a nonsignificant trend for OVX to decrease AIRG (P = 0.06). There were no statistically significant differences between the groups in DI, Sg, or Si at any of the time points (Fig. 3, A and B). There was a main effect of CBA to decrease insulin levels during the first 18 min after glucose administration (Fig. 4A) and the insulinogenic index (Fig. 4E) at study endpoint. The glucose, insulin, and c-peptide AUC or c-peptide index were not significantly different between treatment groups at study endpoint (Table 3).

Figure 3.

MinMod analysis of metabolic measures from frequently sampled intravenous glucose tolerance tests in simian immunodeficiency virus (SIV)-infected female rhesus macaques. A: acute insulin response to glucose (AIRG; 73.3 ± 17.79 and 26.6 ± 6.9), Disposition index (502.7 ± 147.9 and 385.6 ± 186.1), glucose effectiveness (Sg, 0.02 ± 0.001 and 0.02 ± 0.001), and adjusted insulin sensitivity index (Si adjusted for lean mass, 0.01 ± 0.01 and 0.003 ± 0.001) after 3 mo of chronic binge alcohol (CBA, n = 15) and isovolumic water (VEH, n = 14) administration (Pre-SIV). CBA decreased AIRG compared with VEH. B: AIRG (109.1 ± 33.8, 53.7 ± 16, 43.7 ± 2.4 and 15.98 ± 6.8), Disposition index (1,062 ± 623.8, 217.4 ± 68.9, 739.7 ± 402.7, 2,142 ± 2,498), Sg (0.018 ± 0.002, 0.02 ± 0.001, 0.017 ± 0.002 and 0.016 ± 0.002), and adjusted insulin sensitivity index (0.003 ± 0.002, 0.01 ± 0.009 0.0009 ± 0.0002 and 0.04 ± 0.03) in VEH/SIV/SHAM (n = 8), VEH/SIV/ovariectomy (OVX, n = 7), CBA/SIV/SHAM (n = 7), and CBA/SIV/OVX (n = 7) groups, 11 mo after SIV-infection (study endpoint). There was a main effect of CBA to decrease AIRG. Data shown as means ± SE and analyzed using t tests at Pre-SIV, and two-way ANOVA at study endpoint. *P < 0.05.

Figure 4.

Insulin (μU/mL), glucose levels (mg/dL), and insulinogenic index during frequently sampled intravenous glucose tolerance tests (FSIVGTT) in simian immunodeficiency virus (SIV)-infected female rhesus macaques. A: insulin (μU/mL) tracing of the first 18 min of FSIVGTT. There was a main effect of chronic binge alcohol (CBA) to decrease insulin. B: insulin (μU/mL) tracing of the 180 min of FSIVGTT. C: glucose (mg/dL) tracing of the first 18 min of FSIVGTT. D: glucose (mg/dL) tracing of the 180 min of FSIVGTT. E: there was a main effect of CBA to decrease insulinogenic index. Data at study endpoint (11 mo after SIV-infection) are shown in isovolumic water (VEH)/SIV/SHAM (n = 8), VEH/SIV/ovariectomy (OVX, n = 7), CBA/SIV/SHAM (n = 7), and CBA/SIV/OVX (n = 7) groups. Data analyzed using two-way repeated-measures ANOVA test for A–D and two-way ANOVA for E. *P < 0.05.

Table 3.

Glucose area under the curve, insulin AUC, c-peptide AUC, and c-peptide index during frequently sampled intravenous glucose tolerance tests in SIV-infected female rhesus macaques

	Study Endpoint
Metabolic Measures	VEH/SIV/SHAM	VEH/SIV/OVX	CBA/SIV/SHAM	CBA/SIV/OVX
Glucose AUC	4,434 ± 282.7	3,877 ± 223.6	4,117 ± 180.5	4,544 ± 303.1
Insulin AUC	856.4 ± 285.6	429.1 ± 98.2	430.4 ± 102.8	494.6 ± 151.4
C-peptide AUC	4.7 ± 0.6	3.7 ± 0.9	4.3 ± 1.1	5.4 ± 1.9
C-peptide index	0.1 ± 0.02	0.09 ± 0.02	0.1 ± 0.02	0.1 ± 0.03

There were no significant differences between isovolumic water (VEH)/SIV/SHAM (n = 8), VEH/SIV/ovariectomy (OVX, n = 7), chronic binge alcohol (CBA)/SIV/SHAM (n = 7), and CBA/SIV/OVX (n = 7) treatment groups 11 mo after SIV infection (study endpoint). Data analyzed using two-way ANOVA. AUC, area under the curve; SIV, simian immunodeficiency virus.

Fasting plasma glucose, insulin, and HOMA-IR were not significantly different between the treatment groups at Pre-SIV or study endpoint (Supplemental Fig. S1, A–F; see https://doi.org/10.6084/m9.figshare.14754588). There was a main effect of OVX to decrease HOMA-β at study endpoint (Supplemental Fig. S1H).

mRNA Expression of Pancreatic Genes

Expression of genes implicated in insulin synthesis (GLUT2, GCK, EPAC, KIR6.2, VDCC, MAFA, PDX1, NKX2.1), insulin docking and release [Syntaxin1 (STX1), VAMP2], insulin and glucagon, mitochondrial homeostasis (PGC-1A, PGC-1B, TFAM), endoplasmic reticulum (ER) stress (XBP1, ATF4, CHOP), and apoptosis (Caspase-3, -8, -9) were determined.

Two-way ANOVA showed an interaction between CBA and OVX to change the expression of KIR6.2, STX1, and VAMP2. Post hoc analysis demonstrated that STX1 and KIR6.2 were significantly decreased in VEH/SIV/OVX and CBA/SIV/SHAM compared with VEH/SIV/SHAM and CBA/SIV/OVX groups (Fig. 5, A and C). The expression of VAMP2 was significantly decreased in VEH/SIV/OVX and CBA/SIV/SHAM compared with VEH/SIV/SHAM group, and the expression in CBA/SIV/OVX was not different from the other three treatment groups (Fig. 5B). There was a main effect of OVX to increase XBP1 and ATF4 expression (Fig. 5, D and E). There were no statistically significant differences in the expression of any of the other genes determined (data not shown).

Figure 5.

Pancreatic gene expression in simian immunodeficiency virus (SIV)-infected female rhesus macaques. A: Syntaxin1 (STX1) was decreased in isovolumic water (VEH)/SIV/ ovariectomy (OVX) and chronic binge alcohol (CBA)/SIV/SHAM compared with VEH/SIV/SHAM and CBA/SIV/OVX groups. B: vesicle-associated membrane protein 2 (VAMP2) was decreased in VEH/SIV/OVX and CBA/SIV/SHAM compared with VEH/SIV/SHAM group. VAMP2 was not different in CBA/SIV/OVX compared with the other three groups. C: KIR6.2, major isoform of ATP-sensitive potassium channel (KATP), was decreased in VEH/SIV/OVX and CBA/SIV/SHAM compared with VEH/SIV/SHAM and CBA/SIV/OVX groups. There was a main effect of OVX to increase X-Box binding protein 1 (XBP1) (D) and Activating transcription factor 4 (ATF4) (E). Data shown as means ± SE VEH/SIV/SHAM (n = 8), VEH/SIV/ovariectomy (OVX, n = 7), CBA/SIV/SHAM (n = 7), and CBA/SIV/OVX (n = 7) groups at 11 mo after SIV-infection (study endpoint) and analyzed using two-way ANOVA. *P < 0.05.

Pancreatic Islet Morphology

Representative images of insulin and glucagon immunostaining in the pancreas are shown in Fig. 6A. There were no significant differences in the islet size, number, or area (Fig. 6, B–D). The corrected total cell fluorescence (CTCF) of insulin was significantly higher than glucagon; however, there were no differences in the insulin and glucagon expression between treatment groups (Fig. 6, E and F). Representative images of FragEL immunostaining in the pancreas are shown in Fig. 7A. There were very few apoptotic cells and no significant differences between treatment groups.

Figure 6.

Pancreatic morphology in simian immunodeficiency virus (SIV)-infected female rhesus macaques. A: representative images of insulin and glucagon immunostaining of isovolumic water (VEH)/SHAM, VEH/ovariectomy (OVX), chronic binge alcohol (CBA)/SHAM, CBA/OVX groups. Insulin (red) and glucagon (green) staining. B: pancreatic islet size. C: islet number. D: islet area. E: corrected total cell fluorescence of insulin. F: corrected total cell fluorescence (CTCF) of glucagon. Data shown as means ± SE VEH/SIV/SHAM (n = 8), VEH/SIV/ovariectomy (OVX, n = 7), CBA/SIV/SHAM (n = 7), and CBA/SIV/OVX (n = 7) groups at 11 mo after SIV-infection (study endpoint) and analyzed using two-way ANOVA. Scale bar = 50 µm.

Figure 7.

DNA Fragment End Labeling (FragEL) using terminal deoxynucleotidyl transferase (TdT) enzyme staining of pancreas in SIV-infected female rhesus macaques. Representative images of FragEL staining of isovolumic water (VEH)/SHAM, VEH/ovariectomy (OVX), chronic binge alcohol (CBA)/SHAM, CBA/OVX groups. There were very few apoptotic cells with no significant differences between treatment groups. Arrows indicate apoptotic cells. Scale bar = 50 µm.

DISCUSSION

We examined the effects of chronic binge alcohol (CBA) and ovariectomy (OVX) on glucose-insulin dynamics and the integrity of pancreatic endocrine function in SIV-infected female rhesus macaques. Results indicate that CBA decreased the acute insulin response to glucose (AIRG). This was associated with a CBA-mediated decrease in insulin levels during the first 18 min after intravenous glucose administration, and insulinogenic index. In addition, CBA and OVX independently, but not synergistically, decreased pancreatic expression of markers of insulin release.

Although the risk for alcohol-induced exocrine pancreatic damage is recognized (64, 65), at-risk alcohol use is also a known independent risk factor for insulin resistance and T2DM (56). Our results agree with our previous report in male macaques (46) showing that CBA decreased AIRG. Neither CBA nor OVX altered the basal expression of insulin or glucagon in the fasted state. Rodent studies have also shown that chronic alcohol administration reduces insulin in response to a glucose challenge without any changes in basal expression of insulin and glucagon (66). CBA did not alter islet size or numbers, indicating that there was no overt β cell damage. Because there was no evidence of hyperglycemia or hyperinsulinemia, our findings suggest that alcohol-induced endocrine pancreas damage precedes whole body glucose intolerance. This pathophysiological framework is consistent with “pancreatogenic diabetes” (67), since CBA or OVX did not significantly affect insulin resistance, as indicated by HOMA-IR, insulin sensitivity, and disposition index.

The ATP-sensitive potassium (KATP) channel mediated-mechanism is a major pathway influencing the first phase of insulin secretion. KIR6.2 and SUR1 are the major subunits of the KATP channel (68), and our results demonstrate that CBA and OVX decreased KIR6.2 expression. Ongoing studies will determine whether the decreased KATP channel expression decreases Ca influx and ultimately GSIS (69). Similarly, CBA and OVX decreased the expression of insulin docking molecules, Syntaxin 1 and VAMP2. Downregulation of these genes is demonstrated in T2DM organ donors, and studies with islets derived from T2DM subjects indicate that decreased acute insulin release is one of the earliest manifestations (22).

Multiple mechanisms are proposed for alcohol-mediated pancreatic changes, especially of the acinar cells—including autodigestion, oxidant stress, and generation of alcohol metabolites (65). The unfolded protein response (UPR) and subsequent ER stress is a major cause of alcoholic pancreatic injury (65). Pancreatogenic diabetes generally presents secondary to pancreatitis or exocrine pancreatic dysfunction. However, our results do not indicate CBA-mediated increased ER stress or inflammation (data not shown) indicating that these mechanisms are not a major cause for the observed endocrine pancreatic dysfunction. However, OVX increased the expression of XBP1, a protein that, when spliced, acts as a transcription factor necessary for proper protein folding (70), indicating a potential increase in ER stress following ovarian hormone loss. ATF4, a cAMP-response element-binding protein that migrates to the nucleus when a cell is undergoing chronic ER stress, was also increased due to OVX. There were no significant effects of OVX to increase C/EBP homologous protein (CHOP), a proapoptotic transcription factor (71). This corresponds to our observed results that there were no significant effects of OVX or CBA on Caspase-3, -8, and -9, markers in the apoptotic pathway, nor changes in islet size and numbers.

The role that ovarian hormones play in maintaining endocrine pancreatic function remains somewhat elusive, partly due to multiple confounding factors such as adiposity and age of menopause onset (42). Studies show that estrogen aids in maintaining insulin secretion, preventing IR, and reducing diabetes incidence (42, 44, 69). The loss of ovarian hormones is significant in the context of HIV since female PLWH develop menopause earlier in life (72) and a meta-analysis reported that early-onset menopause is associated with a higher risk of T2DM (73). In our study, there was a modest (nonsignificant) decrease in AIRG due to OVX (P = 0.06). Furthermore, OVX decreased markers of insulin secretion, and increased markers of ER stress providing evidence for OVX to impair glucose-insulin dynamics in SIV infection.

There were no significant differences in total fat or body weight due to CBA or OVX, and results do not implicate body composition to be associated with the observed metabolic alterations. This is similar to our observed results in PLWH with at-risk alcohol use where body composition was not associated with dysglycemia and concords to clinical studies that suggest weaker associations between anthropometric measures and dysglycemia than other variables such as age and/or sex (74).

There are some limitations to our study. We have used intravenous glucose tolerance tests, potentially masking any contribution of incretins to the insulin response. We believe, this allows us to conclude that the observed CBA and OVX-mediated impaired glucose-insulin dynamics are due to direct effects on the pancreas. Ovarian hormone loss was achieved by surgical menopause, which does not truly mimic loss of hormones that characterize natural aging and menopause. The studies were performed under controlled experimental conditions with macaques given a healthy control diet, monitored for food consumption, and body weight changes. Future studies will include diet manipulations to more closely model dietary intake reported in PLWH to determine how alcohol or ovarian hormone loss exacerbate metabolic dysregulation. Additional in vitro studies in isolated pancreatic islets are needed to complement the study findings and to mechanistically provide evidence for the role of decreased insulin release mechanisms and their contribution to decreases in the AIRG.

Perspectives and Significance

Our data indicate that CBA contributes to impaired glucose-insulin dynamics through inadequate insulin secretion to a glucose challenge most likely mediated by impaired markers of insulin docking and release in female SIV-infected macaques. These results share similarities with those obtained from studies with male SIV-infected macaques (46) and recently in PLWH (56). Considering the findings from these studies, reducing/limiting alcohol use should be a strong recommendation for PLWH. Whether hormone replacement, physical activity, and dietary manipulations can improve metabolic dysregulation among PLWH, and people with at-risk alcohol use remains to be determined. Moreover, these data support proactive implementation of oral glucose tolerance tests to assess insulin secretory response and effectiveness among PLWH, particularly those at high risk for developing T2DM.

SUPPLEMENTAL DATA

Supplemental Fig. S1: https://doi.org/10.6084/m9.figshare.14754588.

GRANTS

The research was supported by National Institute on Alcohol Abuse and Alcoholism Grants P60AA009803 (to P. E. Molina), R25GM121189 (D. Torres).

DISCLOSURES

No conflicts of interest, financial or otherwise, are declared by the authors.

AUTHOR CONTRIBUTIONS

L.S., A.M.A., and P.E.M. conceived and designed research; L.S., D.T., A.S., C.V.S., H.M., L.C., and J.P.D. performed experiments; L.S., D.T., A.S., D.E.L., C.V.S., H.M., and L.C. analyzed data; L.S., D.T., A.S., D.E.L., and P.E.M. interpreted results of experiments; L.S. and D.T. prepared figures; L.S. and D.T. drafted manuscript; L.S., D.T., A.S., D.E.L., C.V.S., H.M., L.C., J.P.D., A.M.A., and P.E.M. edited and revised manuscript; L.S., D.T., A.S., D.E.L., C.V.S., H.M., L.C., J.P.D., A.M.A., and P.E.M. approved final version of manuscript.