Skip to main content
Journal of Environmental Health Science and Engineering logoLink to Journal of Environmental Health Science and Engineering
. 2021 May 3;19(2):2047–2055. doi: 10.1007/s40201-021-00670-5

Systematic review and metal analysis on three important fungal group (dermatophytes, yeasts and saprophytes) isolated from Iranian swimming pools

Pouran Makhdoumi 1, Parya Akbari 1, Nezam Mirzaei 2,, Hooshyar Hossini 3,, Edris Hoseinzadeh 4
PMCID: PMC8617221  PMID: 34900322

Abstract

The swimming pool particularly has been considered in tropical area and warm seasons in order to recreational actives and also different exercises. Therefore, poor management and unhealthy behavior of swimmers could be a cause of fungal diseases transmission among swimmers. The present study has addressed the literatures on the topic of fungal contamination of indoor/outdoor swimming pools in Iran. Based on the literature review, most common fungal contaminations were on the list of sporophytes fungus. The majority of the reported and isolated fungal were Aspergillus spp.(50 %), Rhizopus spp., Cladosporium spp.kand Penicillium spp. In addition, E. flucosom and T. mentagrophytes were the most abundant dermatophytes. Meta-analyzing of the results showed that dermatophytes, yeasts and saprophytes can be found in the swimming pool samples with a percent of 2.78 %, 14.29 and 73.73 %, respectively. High heterogeneity rate between studies was found for all types of fungal categories by I2, and a p-value < 0.0001. The results of outdoor pools (hot spring pools) showed Aspergillus spp. as a predominating species and other types such as A. fumigatusm, A.feltus and A.niger with penicillium spp. as the most abundant funguses in the next order pool type. It can be concluded that the swimming pools (both indoor and outdoor) are considerable reservoir of human diseases caused by fungi, especially a potential source of dermatophyte infection.

Keywords: Swimming Pool, Fungal contamination, Dermatophytes, Systematic review, Yeast

Introduction

Swimming and recreational activities have received more attention than ever before by considering them as a rehabilitative treatment, sport and also for fun. The swimming pools have played an important role to promote water-based recreational activities as a healthy place with welfare. According to world health organization (WHO) reported, these places can create some health hazards such as drowning, trauma and injuries, as well as the risk of pathogenic microorganism, and chemical contaminations [1]. The most related risks of microbiological are made by fecal- and non-fecal pathogens including bacteria, fungal, protozoa, and viruses which may be presented from swimmers’ bodies or fecal releases [2]. Approximately 10 to 20 % of the general population worldwide is infected by dermatophytes, that are a type of fungus living on the external skin, within hair, and skin lesions. They can be transmitted to others through direct contact such as swimming water, wrestling mats, and physical contact [3]. It should be noted, swimming pools with a high temperature can provide a suitable growth condition for fungus [4]. Researches have reported that swimming pool can act as a habitat for fungal infection spreading and cultivation. Thus, it can caused a certain threats to the swimmers [5]. It has been demonstrated that dermatophytes, saprophytic fungus and yeast organisms can prone the potential pathogenicity of mycosis, candidiasis, asthma, and also allergic symptoms [6]. In addition, external ear, toe and fingers and inguinal tract are susceptible to fungal attack because of wet conditions of these parts [7]. These problems happened through accidental ingestion.

Most of fungi species cause diseases, which easily grow in swimming pool environments. These include; different species of Trichophyton spp. dermatophytes, Aspergillus spp., Candida spp., Penicillium spp., Mucor spp. and Rizopus spp. [8]. Outbreak waterborne diseases are possibility strengthen when the disinfectants in water is not enough [9] and the pH optimum was not set.

The importance of the health risks associated with the swimming pool is due to the gathering of the large number of users. Improving the health knowledge and attitude about risks of recreational areas needs to remain updated with the new control strategies [10]. Although there is a surveillance system to collect water and food borne outbreaks, but there is no monitoring schedule to evaluate water fungal contamination along with bacterial indices. Therefore, to implement an appropriate and national strategy, deep investigation in available data, which exist in researches, can help us to build an applicable plan. An investigation on the active quality status of swimming pools not only reveal the rate of microbial contamination in different areas or operational moods, but also help making good decisions on how to control microorganisms. Therefore, present work carried out to systematically review the percent of fungal in the contaminated samples from Iranian swimming pools. Based on literature review, there are noticeable numbers of published study about fungal contamination (mainly dermatophytes, saprophytes and yeasts) of swimming pools that we aimed to finalize the scattering data in different locations by using metal analysis. Then, the most common dermatophytes, saprophytes and yeast which found in the swimming pools have been listed. Hot spring fungal communities were reviewed and other notable topic such as fungal detection methods, effecting growth factors and management operational alternative were also considered.

Methods

Literature search strategy

In response to this question, “what is the rate of occurrence of infectious fungal from Iranian swimming pools?‘ keywords and study frameworks were identified. In order to search and find the relevant articles, the popular international and national databases including Google Scholar, Scopus, Science Direct, PubMed, Open Access Journal Directory, Iranmedex, Medlib, Magiran, Irandoc, and SID were investigated. Searching the literature was conducted in October 2019 to identify English and Persian language studies which contained the fungal monitoring in the Iranian swimming pools. There was no limitation on publishing time. The search strategy was systematic by using English and Persian sensitive keywords such as swimming pool, pools, recreational pool, recreational water, hot water, fungal, fungus, fungal contamination, microbial characteristics, dermatophyte, saprophyte, yeast and Iranian swimming pool.

Databases engines were used to find keywords and the equivalents of keywords in Persian. The articles were collected based on the titles and abstracts. However, related articles in the reference lists of published works were also considered in order to increase search sensitivity and find articles which could not be found previously.

Afterwards, full-text screening was carried out by two independent authors (PA and HH). Discussion was conducted out for solving any disagreement with the authors (PM). To make the final decision third person was needed occasionally. The articles with quantities amounts of fungal density or percentage of contamination were excluded because there was a lot of quality monitoring reports. Although there was no review, dissertations, comments and letters to be excluded.

According to the following criteria the articles were limited:

  • the results of Iranian pools.

  • the quantified result.

  • remove one of duplicate studies.

The criteria to exclude:

  • negative results of fungal contamination.

  • unavailable full-text.

  • qualitative results.

Data extraction and analysis

The data extraction from the finalized articles was performed based on the first author’s last name, year of publication, study locations, sample size, sampling time, detection method, number of pools, study type, positive sample percentage and operational conditions if were existed. To assess the quality of articles, a checklist contained 12 questions was utilized. The checklist with more details can be find in [11].

To calculate the standard error (SDE) of extracted data the following equations was used;

Standard Error=sqrt[p(1p)/n)

Percentage data of fungal contamination were entered into excel and then imported into Stata version 12.0 for more analyses (StataCorp, College Station, TX, USA).

Results and discussion

Selection, identification and characteristics of studiesTable 1, illustrates the all findings of the systematic review process. Altogether, around 97 research articles were collected in the primary search. Then, articles were excluded due to duplication, which was summarized to 49#. Based on the title and an overview, the articles were limited to 21#, which were available by full-text. However, 5 studies were not included because of quality report of fungal pollution in the swimming pools. Among 16 articles (n = 5862 samples) that were chosen due to three classes of funguses, 10 articles had addressed dermatophyte and corresponding 13# and 12# addressed yeast and saprophyte, respectively [1214].

The descriptions of the final 16 articles included in systematic review are reported in Table 2. 31 % (n = 5) of the articles were published from 2001 to 2005 and the remained 69 % (n = 11) published between 2006 and 2019. Most articles (n = 10, 62.5 %) were published through national journals in Persian. The minimum and maximum sample sizes were respectively 18 and 1,500, which implies a disparity in the sample sizes. Among them, most studies considered a long sampling time more than 3 months up to the full-year, but one study used only a random sample. Moreover, there was summer sample in all studies due to tendency to swim this season. 37 % (n = 6) of the studies had collected the samples throughout the year. In total, 82 swimming places including; indoor public, private pools, and a natural hot spring (Sarein, Ardabil) were considered in this study.

Table 2.

Characteristics of articles included in the systematic review

First author Year Study location Sample size Number of pool Season Detection method pH Cl (mg/l) Saprophyte % Yeast % Dermatophyte %
Rafiei 2010 Ahwaz 593 10 summer- winter Slide culture, Pour plate 6.81 1.76 89.2 7.7 3.1
Jafari 2013 Yazd 720 12 spring. summer Slide culture, Pour plate - - 89.5 9.7 0.8
Karimi 2019 Gonabad 18 2 summer slide culture 7.38 1.29 91.1 7.93 0.84
Nourian 2004 Zanjan 90 5 summer slide culture - - 77.7 21.8 0.5
Kazemi Fard 2006 Qom 480 6 annual slide culture - 1 0.21 - - 8.8
Shadzi 2001 Esfahan 150 4 qrowth -slide culture - - 94.57 5.26 0.36
Ehrampoosh 2011 Yazd 100 4 winter Slide culture, Pour plate(Colony Appearance - Growth Rate - Color - Shape) 8.05 0.55 - - 7
Sadeghi Dehkordi 2017 Hamedan 720 3 slide culture - - 56.14 42.1 1.75
Nan Bakhsh 2004 Urmia 384 4 annual slide culture 8.1 0.6 77.01 25.7 2
Seyedmousavi 2007 Sarein 284 11 summer Slide culture, Pour plate - - 96.24 3.1 0
Fadaei 2015 Shahrekord 459 2 summer - winter - 99.3 - -
Hoseinzadeh 2013 Hamadan 40 4 summer - winter-spring Slide culture, Pour plate(Colony appearance - Growth rate - Color - Shape) 7.38 0.84 -
Saberianpour 2015 Shahrekord 21 5 autumn PCR 7.8 1.62 19.02 4.76 -
Rasti 2012 Kashan 200 4 annual slide culture 7.7 1.5 21 4.5 -
Molazadeh 2016 Kerman 1500 10 annual slide culture - - -
Asadi Shavaki 2015 Karaj 103 7 summer Slide culture, Pour plate(Colony appearance - Growth rate - Color - Shape) 7.5 2.2 74.28 25.7 -

Table 1.

Systematic search and articles screening

Step Articles #
i Identification National database Iranmedex Medlib, Magiran, SID, ISC, 97
ii International database Google Scholar Scopus, Science Direct, Elsevier, PubMed, DOAJ,
iii Screening Excluding duplication 49
iv Eligibility Excluding by the title 21
v Inclusion Excluding by gap score and quality 16

Dermatophytes

In the two last decades, prevalence of dermatophytes fungi in the swimming pool environments has been investigated. The swimming pools are prone for growing of fungal strains in particular dermatophytes, due to the suitable conditions such as temperature and humidity. Although the sporophytes fungal and yeasts are found in higher numbers, but dermatophyte pathogens are also important even in small amounts. At among of dermatophytes funguses, three commonly species are more reported in the swimming pool which include Trichophyton mentagrophytes, Trichophyton rubrum and Epidermophyton floccosum [22]. Furthermore, the other species such as Microsporum gypseum, Microsporum canis and Trichophyton verrucosum have been isolated from pool environments, too. Total dermatophytes which were found in the eligible studies were Epidermophyton flucosom (2.8 %), Trichophyton mentagrophytes (0.8 %), Trichophyton rubrum (0.8 %), Trichophyton verrucosum(0.8 %), Trichophyton tonusurans (1.6 %), Trichophyton schoenleinii (0.8 %) and Trichophyton equinum (1.6 %) [18]. Among them, E. flucosom, T. mentagrophytes, T. rubrum, T. verrucosum and T. Tonusurans were more reported in greater abundance (Fig. 1).

Fig. 1.

Fig. 1

Frequency distribution of dermatophytes fungal in swimming pool samples

Yeasts and saprophytic fungus

Most common species of keratinophilic fungus that were isolated from swimming places are included; Aspergillus, Penicillum, Alternaria, Cladosporium, Geotrichum, Phoma and Fusarium [22]. In similar, the results of considered studies show that there are a wide range of fungal as follows; Aspergillus, Penicillium, mycelia sterilia, Cladosporium, Drechslera, Alternaria, Rhizopus, Ulocladium, Paecilomyces, Phoma, Sporothrix, Phialophora, Exophiala and Fusarium [2, 3, 6, 9, 16, 17, 20]. However, the molds species like Mucor and yeast strain like Rhodotorula and Candida albicans [2, 9], and some genus of anamorphic fungi like Scopulariopsis [2] were found by researches. In addition to previous funguses, some plant pathogens, Stemphylium and Drechslera, were identified [17].

The most frequently occurring number of funguses was related to Aspergillus, Rhizopus, Cladosporium and Penicillium [23]. In the most cases, the Aspergillus spp. have been reported at a more relative frequency of 0.5 (or 50 %) [3, 14]. Indeed, A. niger, A. fumigatus and A. flavus were the most usual species of Aspergillus.

Detection methods

Sampling of pools environment, including foot washing sinks, bathrooms, dry sauna rooms, walls and floors of dressing rooms, were taken using sterilized carpets in the namely size of 5 × 5 cm. For waterborne fungal, the sterile bottle were used and filled to a depth of 30–40 cm. In addition, the swab was utilized for soggy surfaces. All samples, swabs and carpets were shaken and inoculated onto agar media under a biological hood. In the case of water samples, they were transferred to three different culture media including; Sabouraud Dextrose Agar, Chloramphenicol, with or without Cycloheximide (SC, SCC), after filtrating through Millipore filters with 0.45 μm. Finally, the agar mediums were incubated at 25˚C for 3 weeks. To determine the fungal categories, the shape, color, growth rate, colony appearance as well as microscopic structure were detected in the isolated colonies were from positive samples. Slide culture was also used to identify the morphology of mold fungi.

As can be seen in Fig. 2a and b, there are graphical photo of fungal colonies, E. flucosom and T. mentagrophytes that were detected from swimming pools, Yazd, Iran [15]. Macroconidia of fusarium spp. is developed typically on inoculated mediums in the form of clover-leaves (Fig. 2b).

Fig. 2.

Fig. 2

Epidermophyton Flucosom (a) and Trichophyton mentagrophytes (b) colonies on Sabouraud dextrose agar[15]

For more identifying of the fungal species, molecular detection method was used by Saberianpour et al. [4]. In this study Candida albicans, Aspergillus and Penicillium species was characterized by PCR technique (gene detection) and corresponding primer (5’- 3’) GCCGGTGACGACGCTCCAAGAGCTG, CGGCCCTTAAATAGCCCGGTC and TCCGTAGGTGAACCTGCGG.

Effective factors on prevalence of fungal

The occurrence and distribution of funguses are depended on several physical, chemical and ecological factors including pH, dissolved oxygen, ambient temperature, presence of toxic compounds, and organic matter particularly keratinaceous substance [22]. In the swimming pools, the proper usage of disinfectants can inhibit effectively the growth of microorganisms; however, the influence of disinfectant maybe affected by some factors such as pH, total organic carbon, turbidity, disinfectant concentrations and hardness. The results of Rasti et al. [3] revealed that the insufficient concentration of disinfectant is corresponded for microbial contamination of swimming pools. This fact has been emphasized by another study [4]. On the other hand, spore-forming microorganism are resistant to disinfecting substance like perchlorine [3].

Based on the chosen literatures, the common disinfectant which used in Iran has been chlorine. The chlorine efficiency dramatically is depend on pH; while the pH level arouses to basic conditions the disinfecting ability is decreased [3]. This phenomenon happens due to changes of the free chlorine forms from acid hypochlorite to hypochlorous. The hypochlorous acid is approximately 100 fold weaker than hypochlorite. This change can also be influenced by temperature. Rasti et al. believed that in the warm season, even the standardized chlorine has no effect on the reduce of funguses, so they suggested to replace the chlorine with other stronger disinfectants [3]. Similar results were acquired by the other study [4]. The other factors that may contribute to the spread of pathogenic funguses in a pools includes; humidity, age, profession, life conditions, and swimmers’ hygiene. Sadzi et al. reported that there was a relationship between swimmers population and fungal density in the pools [23]. They emphasized in the condition of lower remaining chlorine (< 1 mg/L) and large number of swimmers, a relative high prevalence of fungal contamination is expected. In addition, they saw the least amounts of fungal colonies under high concentration of chlorine and low population density of swimmers.

Effect of season

Some of the reasons that show a high occurrence of fungal contamination during the warm seasons include; high temperature and air humidity, more tendency to swimming, increase the water turbidity, organic matter, high uses frequency, and consumption of chlorine. Among studies, [19] and [3] investigated the prevalence of fungal contamination through swimming pools and they found that the fungal densities were increased in the summer and winter.

Growth sites and mediums

Swimming pool is considered the suitable place for fungus habitat because of having a good temperature, dark and damp condition. Therefore, successful colonization of fungal species can happen on the empty habitat which is used by patient swimmers. In presence of moisture many places such as walls and floors, woods, cement, wallpaper and also water can be used by fungus for more growth. The most fungal contamination site for both swimming pools was showers and dressing room [2, 17]. Jafari et al. documented that showers and dressing room were responsible for 43 and 28.1 % of the total fungal contamination, respectively [17]. Also, dry and wet sauna were more susceptible to fungus growth than pool water [19]. In another study, all species of kratiophallic fungus and yeasts were found in the showers and dressing room [20]. However, the lowest density of fungal colonies relating to the pool water and baths was reported by other study [17]. This can be occurred due to the continuing water chlorination and proper water recycling. Aspergillus was identified as the most abundant species in the both of water medium and site surfaces. The results of Sahdzi et al. exhibited dermatophytes was not found in the water pools while T. Mentagrophytes were isolated from the solid surfaces [23].

Private and governmental management

Only one study separately addressed a comparison between two different governmental and private operations [17]. There was no significant difference between them regarding the presence of dermatophytes, while there was a relative lower amounts of saprophytes and yeasts in the private pools.

Hot spring pool

Syeyedmousavi et al. investigated the fungal flora of the Serein hot spring pool, Irdabil, Iran, by taken about 284 samples at different locations from eleven pools. Among the collected samples, 193 plates (67.95 %) were contaminated by fungus colonies. As expected by them, the Aspergillus spp. was the predominating species. A. fumigatusm, A. feltus and A. niger with penicillium spp. were the most abundant fungi. Figure 3, shows the all types of fungus that were isolated from hot spring environments. It should not be forgotten that no dermatophyte fungi was observed from carpet and water samples [21]. Therefore, Ulcoladium, Sepdonium, Acermonopum, Psilomassis, Stemphilium and Streptomycin were at the lowest amount.

Fig. 3.

Fig. 3

Frequency distribution of fungi isolated from hot spring water

Meta‐analysis of data

As can be seen in Fig. 4a, the percentage of dermatophytes presence in different swimming pools is shown as an isolated part in the forest plots. Analyzing of the all isolated percentages of dermatophytes showed this type of fungus can be found in the contaminated swimming pool samples (2.78, 95 % CI: 1.68 to 3.89). In addition to the significant p-value (P < 0.0001), a high heterogeneity of I2 = 99.9 % was observed among the studies. Although, there were some higher values of dermatophyte percent than normal prevalence, but most of them were isolated at lower percentages. An overall glance of dermatophyte distribution map, different categories of fungi percentage is found in Fig. 4b according to eligible reports. The researches imply the prevalence of dermatophytes in the swimming pool is around 3 %. Meanwhile, more than 5 % of prevalence in the central Iran and moderate prevalence in the West and northwest is seen. Figure 4c represents the forest plot of the prevalence of yeasts in the swimming pool environments. Among studies which chosen for mata-analysis, a high heterogeneity was found by I2 = 100 % with a p-value < 0.0001. According to the plot and map, it is evidence that the range of yeast prevalence percent is below than 10 % up to 42.1 %. However, overall prevalence rate was determined of 14.29 (with 95 % CI: 7.59 to 21.18). Unlike to dermatophytes and yeasts results, high percent of samples were contaminated by saprophytes strains (73.73 % CI: 64.32 to 83.21). A high heterogeneity rate was found by I2 = 100 %, and a p-value < 0.0001 between studies.

Fig. 4.

Fig. 4

Forest plot of the occurrence percentage of the swimming pool saprophytes fungal which are isolated from different locations (a dermatophyte; b yeast and c saprophyte)

Conclusions

According to the literature review, identified fungal isolates in the most collected samples were Aspergillus spp., Rhizopus spp., Cladosporium spp. and Penicillium spp., respectively. In addition, E. flucosom and T. mentagrophytes were the most abundant dermatophytes. Meta-analysis results revealed that dermatophytes, yeasts and saprophytes were found in the percent of 2.78 %, 14.29 and 73.73 %, respectively. In addition, the showers, sauna and dressing room were identified as the highest contaminated places with fungal agents. The results of hot spring pools showed Aspergillus fumigatusm, feltus and niger with penicillium spp. are the most abundant species which are found. Paying attention to the managing measurements can reduce the number of saprophytes and yeasts. It can be concluded that the swimming pools (both indoor and outdoor) can be considered as a reservoir of human diseases caused by fungi, especially a potential source of dermatophytic infection.

Acknowledgements

The authors gratefully acknowledge the Research Council of Kermanshah University of Medical Sciences (Grant Number: 97795) for the financial support.

Declarations

Conflict of interest

The authors report no conflicts of interest. The authors alone are responsible for the content and writing of this article. 

Ethical consideration

Ethical issues (Including plagiarism, Informed Consent, misconduct, data fabrication and/or falsification, double publication and/or submission, redundancy, etc.) have been completely observed by the authors.

Footnotes

The original online version of this article was revised: The word 'tree' in title is replaced with 'three'.

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Change history

6/7/2021

A Correction to this paper has been published: 10.1007/s40201-021-00685-y

Contributor Information

Nezam Mirzaei, Email: nezammirzaei@yahoo.com.

Hooshyar Hossini, Email: hoo.hosseini@gmail.com.

References

  • 1.WHO. Guidelines for safe recreational water environments: Coastal and fresh waters. Geneva:World Health Organization; 2003. [PubMed]
  • 2.Fadaei A, Amiri M. Comparison of chemical, biological and physical quality assessment of indoor swimming pools in Shahrekord City, Iran in 2013. Glob J  Health Sci. 2015;7(3):240. doi: 10.5539/gjhs.v7n3p240. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Rasti S, Assadi MA, Iranshahi L, Saffari M, Gilasi HR, Pourbabaee M. Assessment of microbial contamination and physicochemical condition of public swimming pools in Kashan, Iran. Jundishapur J Microbiol. 2012;5(3):450–5. doi: 10.5812/jjm.2478. [DOI] [Google Scholar]
  • 4.Saberianpour S, Momtaz H, Ghanbari F, Mahmodi F. Assessment of bacterial and fungal contamination in public swimming pools in Shahrekord-IRAN. J Trop Dis Public Health. 2015;4(2):1000190. [Google Scholar]
  • 5.Hilmarsdottir I, Haraldsson H, Sigurdardottir A, Sigurgeirsson B. Dermatophytes in a swimming pool facility: difference in dermatophyte load in men’s and women’s dressing rooms. Acta Derm Venereol. 2005;1(1):1. doi: 10.1080/00015550410024571. [DOI] [PubMed] [Google Scholar]
  • 6.Rafiei A, Amirrajab N. Fungal contamination of indoor public swimming pools, Ahwaz, South-west of Iran. Iran J Public Health. 2010;39(3):124. [PMC free article] [PubMed] [Google Scholar]
  • 7.Nanbakhsh H, Diba K, Hazarti K. Study of fungal contamination of indoor public swimming pools. Iran J Public Health. 2004;33(1):60–5. [Google Scholar]
  • 8.Brandi G, Sisti M, Paparini A, Gianfranceschi G, Schiavano GF, De Santi M, et al. Swimming pools and fungi: an environmental epidemiology survey in Italian indoor swimming facilities. Int J Environ Health Res. 2007;17(3):197–206. doi: 10.1080/09603120701254862. [DOI] [PubMed] [Google Scholar]
  • 9.Hoseinzadeh E, Mohammady F, Shokouhi R, Ghiasian SA, Roshanaie G, Toolabi A, et al. Evaluation of biological and physico-chemical quality of public swimming pools, Hamadan (Iran) Int J Environ Health Eng. 2013;2(1):21. doi: 10.4103/2277-9183.113207. [DOI] [Google Scholar]
  • 10.Leili M, Norouzi HA, Khodabakhshi M, Naghibi A. Surveillance of the physical, chemical, and microbiological quality of swimming pool water in the Hamadan province. J Adv Environ Health Res. 2017;5(2):93–100. [Google Scholar]
  • 11.Rezaei S, Hajizadeh M, Zandian H, Fathi A, Nouri B. Period prevalence and reporting rate of needlestick injuries to nurses in Iran: a systematic review and meta-analysis. Res Nurs Health. 2017;40(4):311–22. doi: 10.1002/nur.21801. [DOI] [PubMed] [Google Scholar]
  • 12.Karimi A, Radfard M, Naghizadeh A, Biglari H, Alvani V, Mahdavi M, et al. Formation of disinfection by-products and fungal contamination data in public swimming pools: A case study in Gonabad, Iran. Data Brief. 2019;22:326–31. doi: 10.1016/j.dib.2018.12.017. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Nourian AA, Badali H, Hamzaei H. Investigation of fungal infections in indoor swimming pools in Zanjan in 2003. J Adv Med Biomed Res 2004;12(48):43–9.
  • 14.Asadi Shavaki M, Mahmoodi E, Valaei N. An investigation of bacterial and fungal pollution of swimming pools in Karaj City and effect of some environmental factors on it. J Res Environ Health. 2015;1:134–44. [Google Scholar]
  • 15.Ehrampoosh M, Jafari A, Rahimi S, Ghaneian M, Khabiri F. Study of dermatophytic fungal species in covered swimming pools in Yazd, Iran. J Health Syst Res. 2011;7(3):373–80. [Google Scholar]
  • 16.Hassan NB, Kambiz D, Khosrow Ht Investigation of fungal pollution and some physico-chemical factors in the indoor swimming pools in Urmia. J Kurdistan Univ Med Sci. 2005;10(2):26–35. [Google Scholar]
  • 17.Jafari A, Ghaneian M, Ehrampoush M, Zarei S. Survey of fungal contamination in surfaces of Yazd indoor swimming pools in 2011. Tolooebehdasht. 2013;12(2):61–9. [Google Scholar]
  • 18.Kazemi-fard H, Jandaghi G, Safdari M. The study of Dermatophytic infections in public swimming pools of Qom city during 2004. J Arak Univ Med Sci. 2006;9(3):67–72. [Google Scholar]
  • 19.Molazadeh P, Khanjani N, Rahimi M, Molazadeh A, Rahimi A. Fungal and biological contamination and physicochemical quality of swimming pools water in Kerman, 2014–2015: A Short Report. J Rafsanjan Univ Med Sci. 2016;15(5):491–500. [Google Scholar]
  • 20.Sadeghi Dehkordi Z, Mohammadpour M, Moradi S, Bahrami M, Kordi B. Survey of fungal contamination of Hamedan indoor swimming pools in 2016. Alborz Univ Med J. 2017;6(2):91–7. doi: 10.18869/acadpub.aums.6.2.91. [DOI] [Google Scholar]
  • 21.Seyedmousavi S, Fataei E, Hashemi S. M. G. Fungal flora in mineral swimming pools of Sarein. J Ardabil Univ Med Sci. 2007;7(2):146–54.
  • 22.Ali-Shtayeh M, Khaleel TKM, Jamous RM. Ecology of dermatophytes and other keratinophilic fungi in swimming pools and polluted and unpolluted streams. Mycopathologia. 2003;156(3):193–205. doi: 10.1023/A:1023311411004. [DOI] [PubMed] [Google Scholar]
  • 23.Shadzi Shahla P, Hossein C, Mostafa Afshin Z. Investigation of the fungal infections of the water of public swimming pools in Isfahan. Iran J Basic Med Sci. 2001;4(1):28–31. [Google Scholar]

Articles from Journal of Environmental Health Science and Engineering are provided here courtesy of Springer

RESOURCES