Molecular identification and clinical characteristics of mumps virus and human herpesviruses associated with aseptic meningitis in South of Iran

Abstract

Viral infections are the major etiological agent of aseptic meningitis; though, limited data exist on the prevalence and molecular epidemiology of viral pathogens responsible for the occurrence of aseptic meningitis in Iran. Therefore, this study aimed to elucidate the prevalence and clinical features of mumps virus and human herpesviruses associated with aseptic meningitis in the South of Iran. A total of 73 patients with aseptic meningitis were enrolled in this study. Cerebral spinal fluid (CSF) samples were tested for detection of HSV, CMV, VZV and mumps virus using nested PCR assay. Mumps virus, HSV-1 and VZV were found in 4 (5.5%), 4 (5.5%) and 3 (4.1%) of the CSF samples, respectively. The highest rates of mumps virus and HSV infections were observed in infants less than one year, and VZV was more prevalent in patients under 5 years of age. The majority of mumps virus and VZV infections were found among male patients, while HSV was more prevalent among female patients. The highest incidence of aseptic meningitis associated with mumps virus was observed in summer, while HSV and VZV were more prevalent during spring. Headache was the most common symptom in mumps meningitis. About HSV and VZV, the most predominant clinical symptom was fever. The results of this study indicate the importance of molecular assay in the diagnosis of etiological agents of aseptic meningitis. Prompt detection of viral pathogens provides a better chance of managing viral meningitis in health care settings.

Supplementary Information

The online version contains supplementary material available at 10.1007/s13337-021-00718-y.

Introduction

Aseptic meningitis is defined as an acute febrile disease with cerebrospinal fluid (CSF) pleocytosis and bacteriologically negative CSF Gram stain and culture. Aseptic meningitis is mostly due to the viral infection of the central nervous system, although the causative agent remains unknown in most cases [1–3]. Among DNA viruses, the neurotropic members of the Herpesviridae family have been described as causative agents of aseptic meningitis [4]. While the predominance of enteroviruses as the most common etiology of aseptic meningitis might outshine the importance of the other viral infections as the causative agents of viral meningitis, and the presence of the other viral agents might be overlooked. Especially when molecular-based diagnostic methods are not used and the diagnosis is only based on the clinical features and CSF analysis.

Herpesviridae family viruses, including varicella-zoster virus (VZV), herpes simplex virus (HSV), Ebstein-Barr virus (EBV), human herpesvirus-6 (HHV6) and cytomegalovirus (CMV) are capable of causing aseptic meningitis [4]. These enveloped double-stranded DNA viruses might be transmitted by direct contact or respiratory droplets. Maternal–fetal transmission is also possible. Although the complications of herpes-related meningitis are usually self-limited with complete recovery, in high-risk groups especially young children and individuals with weakened immune systems, the disease progress to serious consequences and even death of the patient [5, 6].

Mumps virus, a member of the family Paramyxoviridae, is another causative agent of aseptic meningitis. This enveloped single-stranded RNA virus is transmitted through respiratory droplets and direct contact. Symptoms of mumps include nausea, muscle aches, headache, and fever, followed by non-purulent enlargement of the parotid gland [7]. Outbreaks appear to affect both unvaccinated and vaccinated individuals and all age groups, although complications are less common in vaccinated individuals. One of the most common complications in patients infected with mumps virus is mumps meningitis, which is more prevalent in men than women [4, 8]. Prior to general mumps virus vaccination, this virus was the most common cause of aseptic meningitis [9].

Prompt diagnosis of viral pathogens provides a better chance of managing aseptic meningitis through the early administration of antiviral agents [4]. However, despite such importance, viral meningitis is not a notifiable disease under surveillance in Iran. Therefore, the epidemic pattern of this disease remains unknown in Iran, and data on mumps virus and human herpesviruses causing aseptic meningitis in the Iranian population are scarce. While the importance of viral pathogens as the causative agents of aseptic meningitis cannot be neglected any longer. Therefore, this study aimed to elucidate the prevalence and clinical features of mumps virus and human herpesviruses associated with aseptic meningitis in the South of Iran. This is the first report on the clinical characteristics and molecular identification of mumps virus and herpesviruses associated with aseptic meningitis in this territory.

Material and methods

Study setting and population

A total of 73 patients (38 males and 35 females) with aseptic meningitis admitted to the hospitals of Bushehr University of Medical Sciences were enrolled in this study. Based on the clinical criteria of aseptic meningitis, patients were diagnosed as aseptic meningitis if there were signs and symptoms of meningeal inflammation such as high-grade fever, irritability, lethargy, vomiting, neck stiffness, headache and convulsion, as well as CSF pleocytosis (WBCs ≥ 5 cells/mm3 with the predominance of lymphocytes), the normal level of CSF glucose, elevated concentration of CSF protein and negative CSF bacterial culture [4, 10–14]. The exclusion criteria were the evidence of encephalitis or brain parenchymal involvement, including altered consciousness and epileptic spasm in addition to the positive bacterial culture of CSF. The patients or their legal guardians gave written informed consent for the use of their leftover CSF samples for viral detection. Clinical data were obtained from the medical record of each patient. The Deputy Research and Affairs of the Bushehr University of Medical Science funded this study with grant number 4359. The ethical approval was given by the Ethical Committee of Bushehr University of Medical Sciences (reference number bpums.rec.1394.29).

Laboratory diagnosis

CSF samples of patients with aseptic meningitis were tested for detection of herpes simplex viruses 1 and 2 (HSV 1/2), CMV, VZV, and mumps virus. Briefly, the High Pure Viral Nucleic Acid kit (Roche, Mannheim, Germany) was used to extract viral DNA and RNA from the CSF samples. The extracted DNA was amplified by nested polymerase chain reaction (nested PCR) assay, which amplifies the glycoprotein D, glycoprotein B and ORF 29 regions of HSV, CMV and VZV genomes. The viral RNA was reverse-transcribed into cDNA using RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific Inc). Then, cDNA was amplified by nested reverse transcriptase-polymerase chain reaction (nested RT-PCR) assay, which amplifies the SH (small hydrophobic protein) region of the mumps virus genome. The sequences of primers and regions in the genome for the detection of mumps virus, HSV-1, HSV-2, VZV and CMV are summarized in Table 1.

Table 1.

Sequences of primers for detection of mumps virus, HSV-1, HSV-2, VZV and CMV

Virus	Primers name	Sequences of primers 5′ → 3′	Gene	Region in genome	Size	References
Mumps virus	SH1	AGTAGTGTCGATGATCTCAT	SH gene	6133–6152	676 bp	[15]
	SH2R	GCTCAAGCCTTGATCATTGA		6789–6808
	SH3	GTCGATGATCTCATCAGGTAC		6139–6159	639 bp
	SH4R	AGCTCACCTAAAGTGACAAT		6758–6777
HSV-1 and HSV-2	HSVF1	ATCCGAACGCAGCCCCGCTG	Glycoprotein D	460–479	383 bp	[16]
	HSVR1	TCCGGSGGCAGCAGGGTGCT		842–823
	HSVF2	GCGCCGTCAGCGAGGATAAC		500–519	282 bp
	HSVR2	AGCTGTATASGGCGACGGTG		781–762
HSV-1	F-HS1	CGAAGACGTCCGGAAACAAC	Glycoprotein D	330–349	297 bp	[16]
	R1-HS1-2	CGGTGCTCCAGGATAAA		626–610
	R2-HS1-2	TCTCCGTCCAGTCGTTTATCTTC		601–579	272 bp
HSV-2	F-HS2	GGACGAGGCCCGAAAGCACA	Glycoprotein D	330–349	297 bp	[16]
	R1-HS1-2	CGGTGCTCCAGGATAAA		626–610
	R2-HS1-2	TCTCCGTCCAGTCGTTTATCTTC		601–579	272 bp
VZV	VZVF1	ACGGGTCTTGCCGGAGCTGGT	ORF 29	50,952 –50,972	272 bp	[16]
	VZVF1	AATGCCGTGACCACCAAGTATAAT		51,223 –51,200
	29VZVF2	ACCTTAAAACTCACTACCAGT		50,976–50,996	208 bp
	29VZVR2	CTAATCCAAGGCGGGTGCAT		51,183–51,164
CMV	gB1043	TCTGGGAAGCCTCGGAACG	Glycoprotein B	83,679–83,697	682 bp	[17]
	gB1724	GAGTAGCAGCGTCCTGGCGA		83,013–83,032
	gB1319	TGGAACTSGAACGTTTGGC		83,403–83,421	305 bp
	gB1604	GAAACGCGCGGCAATCGG		83,117–83,134

Statistical analysis

Data were statistically presented as frequencies, percentages, and means ± SD. The Student's t-test and the chi-square test or the Fisher exact test were used for data analysis, when appropriate. All statistical analyses were done using SPSS 17 package program (SPSS Inc., Chicago, IL, USA), and p values < 0.05 were defined statistically significant.

Result and Discussion

Out of 73 aseptic meningitis patients, 38 (52.1%) were male and 35 (47.9%) were female. The age distribution ranged from 1 month to 88 years old (median age, 13 years). The aseptic meningitis patients were classified into six age groups: < 1, 1–5, 6–14, 15–30, 31–60 and > 60 years. The majority of aseptic meningitis patients (56.2%) were in the age groups < 1 and 1–5 years. The highest incidence rates of aseptic meningitis were observed in autumn and spring. Levels of CSF glucose and CSF protein were normal in 53.4% and 45.2% of patients, respectively (Table 2). The mean ± SD (range) levels of CSF glucose, protein and leukocyte count have been shown in supplementary table 1. In 54.8% of the patients, lymphocytes were predominant in CSF leukocyte count. Fever was the most predominant clinical symptom reported in 74.0% of the aseptic meningitis patients, followed by drowsiness (43.8%), headache (24.7%) and rash (8.3%). Of note, 91.8% of the patients had received antibiotic therapy with empiric antibiotics such as ceftriaxone and vancomycin. Other antibiotics included cefotaxime, ampicillin, ciprofloxacin, meropenem, imipenem, amikacin, doxycycline and gentamicin.

Table 2.

Prevalence of mumps virus infection according to demographic and quantitative variables among aseptic meningitis patients in South of Iran

	No. of all participants (%): 73 (100%)	No. of PCR mumps virus positive subjects (%):4 (5.5%)	No. of PCR mumps virus negative subjects (%): 69 (94.5%)	Adjusted OR (95% CI)	p Value
Age groups (years)
< 1	27 (37.0%)	3 (75.0%)	24 (34.8%)	1.0
1–5	14 (19.2%)	0 (0.0%)	14 (20.3%)	0.00	0.99
6–14	2 (2.7%)	0 (0.0%)	2 (2.9%)	0.00	0.99
15–30	9 (12.3%)	0 (0.0%)	9 (13.0%)	0.00	0.99
31–60	13 (17.8%)	0 (0.0%)	13 (18.8%)	0.00	0.99
> 60	8 (11.0%)	1 (25.0%)	7 (10.1%)	0.87 (0.08–9.79)	0.91
Gender
Male	38 (52.1%)	3 (75.0%)	35 (50.7%)	1.0
Female	35 (47.9%)	1 (25.0%)	34 (49.3%)	2.91 (0.3–29.41)	0.36
Season
Winter	15(20.5%)	1 (25.0%)	14(20.3%)	1.0
Spring	19(26.0%)	0 (0.0%)	19(27.5%)	0.00	0.99
summer	16(21.9%)	2 (50.0%)	14(20.3%)	0.50 (0.21–3.59)	0.59
autumn	23(31.5%)	1 (25.0%)	22(31.9%)	1.57 (0.09–27.21)	0.76
Month
Jan	5 (6.8%)	0 (0.0%)	5 (7.2%)	1.0
Feb	7 (9.6%)	1(25.0%)	6 (8.7%)	0.00	0.99
Mar	3 (4.1%)	0 (0.0%)	3 (4.3%)	1.00	1.00
Apr	3 (4.1%)	0 (0.0%)	3 (4.3%)	1.00	1.00
May	10 (13.7%)	0 (0.0%)	10 (14.5%)	1.00	1.00
Jun	6 (8.2%)	0 (0.0%)	6 (8.7%)	1.00	1.00
Jul	6 (8.2%)	0 (0.0%)	6 (8.7%)	1.00	1.00
Aug	6 (8.2%)	1(25.0%)	5 (7.2%)	0.00	0.99
Sep	4 (5.5%)	1(25.0%)	3 (4.3%)	0.00	0.99
Oct	7 (9.6%)	0 (0.0%)	7 (10.1%)	1.00	1.00
Nov	6 (8.2%)	0 (0.0%)	6 (8.7%)	1.00	1.00
Dec	10 (13.7%)	1(25.0%)	9 (13.0%)	0.00	0.99
CSF Glucose (mg/dL)
< 45	20 (27.4%)	2 (50.0%)	18 (26.1%)	1.0
45–85	39 (53.4%)	1 (25.0%)	38 (55.1%)	4.22 (0.36–49.67)	0.252
> 85	14 (19.2%)	1 (25.0%)	13 (18.8%)	1.44 (0.12–17.67)	0.773
CSF protein (mg/dL)
< 15	7 (9.6%)	1 (25.0%)	6 (8.7%)	1.0
15–50	33 (45.2%)	3 (75.0%)	30 (43.5%)	0.67 (0.15–18.87)	0.68
> 50	33 (45.2%)	0 (0.0%)	33 (47.8%)	0.00	0.99
Lymphocyte % in CSF					NS
< 30%	5 (6.8%)	0 (0.0%)	5 (7.2%)
30–49%	20 (38.4%)	0 (0.0%)	20 (29.0%)
50–74%	14 (8.2%)	0 (100.0%)	14 (20.3%)
> 74%	34 (46.6%)	4 (0.0%)	30 (43.5%)
Antibiotic therapy					NS
Yes	67 (91.8%)	4 (100.%)	63 (91.3%)
No	6 (8.2%)	0 (0.0%)	6 (8.7%)
Clinical Signs					NS
Fever	54 (74.0%)	2 (50.0%)	52 (75.4%)
Headache	18 (24.7%)	3 (75.0%)	15 (21.7%)
Rash	6 (8.2%)	0 (0.0%)	6 (8.7%)
Drowisness	32 (43.8%)	0 (0.0%)	32 (46.4%)

CSF = Cerebrospinal Fluid, NS = not significant

Mumps virus, HSV-1 and VZV were found in 4 (5.5%), 4 (5.5%) and 3 (4.1%) of the CSF samples, respectively (Figs. 1, 2, 3). CMV and HSV-2 were not detected by nested-PCR in any of the CSF samples. The highest rates of mumps virus and HSV infections were observed in infants less than one year (75.0%), and VZV was more prevalent in patients under 5 years of age (66.6%). The majority of mumps virus and VZV infections were found among male patients (75.0% and 66.7%, respectively), while HSV was more prevalent among female patients (75.0%). The highest incidence of aseptic meningitis associated with mumps virus was observed in summer, while HSV and VZV were more prevalent during spring. Headache was the most common symptom in aseptic meningitis patients with mumps virus infection. About HSV and VZV, the most predominant clinical symptom was fever. Mumps virus-infected aseptic meningitis patients had lower CSF glucose and protein levels than the uninfected patients, while these differences were not significant (Supplementary Table 1). Regarding HSV and VZV, the infected patients showed higher CSF protein levels compared to the uninfected patients, and this difference was statistically significant in HSV infection (p = 0.02) (Supplementary Tables 3 and 5). The prevalence rates of mumps virus, HSV and VZV among aseptic meningitis patients grouped according to demographic characteristics and quantitative variables are presented in Table 2 and supplementary tables 2 and 4, respectively.

Fig. 1.

The nested RT-PCR amplification for detection of mumps virus from CSF samples of aseptic meningitis patients. a The first round of RT-PCR amplification by SH1 and SH2R primers. L, 100-bp DNA ladder; N, negative control; P, positive control; 1–6, negative PCR products (≈676 bp) on 2% agarose gel electrophoresis. b The second round of RT-PCR amplification by SH3 and SH4R primers. L, 100-bp DNA ladder; N, negative control; P, positive control; 3, amplified product (≈639 bp) on 2% agarose gel electrophoresis

Fig. 2.

The nested PCR amplification for detection of HSV from CSF samples of aseptic meningitis patients. a The first round of PCR amplification by HSVF1 and HSVR1 primers. L, 100-bp DNA ladder; N, negative control; P, positive control; 1–11, negative PCR products (≈383 bp) on 2% agarose gel electrophoresis. b The second round of PCR amplification by HSVF2 and HSVR2 primers. L, 100-bp DNA ladder; N, negative control; P, positive control; 4 and 6, amplified product (≈282 bp) on 2% agarose gel electrophoresis

Fig. 3.

The nested PCR amplification for detection of VZV from CSF samples of aseptic meningitis patients. a The first round of PCR amplification by VZVF1 and VZVR1 primers. L, 100-bp DNA ladder; N, negative control; P, positive control; 1–7, negative PCR products (≈272 bp) on 2% agarose gel electrophoresis. b The second round of PCR amplification by VZVF2 and VZVR2 primers. L,100-bp DNA ladder; N, negative control; P, positive control; 2, amplified product (≈208 bp) on 2% agarose gel electrophoresis

Viral meningitis is the most common type of meningitis and its incidence is estimated at approximately 12 to 19 cases per 100,000 population per year [18]. Although viral infections have been reported as the most common causes of aseptic meningitis, the etiologic agent remains unknown in most cases. In this survey, the prevalence of mumps virus, HSV-1 and VZV among aseptic meningitis patients were 5.5%, 5.5% and 4.1%, respectively.

The prevalence rate of 5.5% for HSV-1 infection reported in this study is higher than that reported among aseptic meningitis patients in the west of Iran, 1.5% in Kermanshah [19], but lower than those of Yasuj (5.7%) [20] and Gorgan (10%) [21]. This prevalence is also lower than that reported among aseptic meningitis patients in Brazil (10%) [10]. The prevalence rate of 4.1% for VZV infection reported in this study is higher than those of the other parts of Iran, 1.9% in Yasuj [20] and 2.5% in Kermanshah [19]. The reported prevalence in this study is lower than those of Brazil (6.06%) [22], South Korea (14.1%) [23] and France (14.5%) [24]. The prevalence rate of 5.5% for mumps virus infection reported in this study is lower than those reported among aseptic meningitis patients in other parts of Iran, 7.5% in Gorgan [21], 16.9% in Shiraz [25] and 5.7% in Yasuj [20]. This prevalence is also lower than that reported among aseptic meningitis patients in Korea (15.96%) [8]. These variations in the prevalence of viral infections in different studies may be due to differences in the sociodemographic characteristics of the study population, study period, sensitivity of molecular assays and sample size. However, differences in the burden of viral infections in various geographical regions cannot be ruled out.

In a study by Akya et al. in Kermanshah (west of Iran), the prevalence of HSV-1 and VZV in patients with suspected aseptic meningitis was 1.53% and 2.55%, respectively [19]. One of the possible reasons for the low prevalence reported in the above study could be due to the use of one-step PCR technique, while in our study the nested-PCR method was used to identify human herpesviruses. Nested-PCR or two-step PCR technique, which requires two pairs of primers, has very high sensitivity and is more appropriate for those clinical specimens with very low virus levels than one-step PCR technique. However, the probability of contamination and false positive results in the nested-PCR method is higher than one-step PCR. Contamination of clinical specimens with a virus or PCR product results in false positivity. Therefore, this issue should be considered in designing a PCR protocol [26]. In our study, positive samples were re-examined to ensure the accuracy of the results and the absence of technical errors or accidental contamination.

Given the sensitivity, specificity and speed of the PCR technique, this method has been considered as a general diagnostic method. At the same time, strict quality control and attention to details are essential for the routine use of this technique. Many clinical specimens contain PCR reaction inhibitors that can cause false-negative results if not removed effectively. In addition, nucleic acid purification methods with relative complexity and more steps increase the risk of contamination [26]. In this study, a commercial kit (High Pure Viral Nucleic Acid Kit-Roche, Mannheim, Germany) was used for nucleic acid extraction. By using this kit as compared with the manual methods, PCR inhibitors are removed effectively, and viral DNA and RNA are purified simultaneously [27].

The highest rates of mumps virus and HSV infections were observed in infants less than one year, and VZV was more prevalent in patients under 5 years of age. In Shiraz, southern Iran, VZV and HSV infections were detected in the age group 1–5 years, and mumps virus was more prevalent in the age group under 12 years [25]. In Gorgan, northern Iran, HSV infection was more prevalent in patients under 2 years [28]. In contrast, in a study in Brazil, 90% of VZV-positive cases were in the age group over 15 years [22]. Mumps virus and VZV were mainly detected among male patients, and HSV was more prevalent among female cases. Previous studies have also reported similar observations in Paris, France and Kermanshah, west of Iran [19, 24].

This study in accordance with previous studies indicates that the prevalence of HSV and VZV among aseptic meningitis patients is higher than other herpesviruses such as CMV [19, 25, 29, 30]. On the contrary, in a study in Brazil, a higher prevalence of CMV and EBV was reported compared to HSV [22]. Despite being predominantly related to meningitis [4], HSV-2 was not detected in any of the CSF samples in this study. A similar finding has also been observed in other studies from Iran [19, 21, 28]. In contrast, HSV-2 meningitis was found in 3.0% of patients in South Korea [31]. In a study by Ory et al. in Spain, the prevalence of HSV-1 was higher than HSV-2 [29]. Jarrin et al. have reported a high frequency of HSV-2 (16.8%) in aseptic meningitis patients in France [24].

In Hosseininasab et al., study in Shiraz, Iran, a high prevalence of mumps virus infection (16.9%) was reported in patients with suspected aseptic meningitis, some of whom had a history of vaccination with mumps virus [25]. In our study, mumps virus was detected in 5.5% of CSF samples, but no information was available on vaccination in their hospital records.

In our study, no skin lesions were observed in VZV positive aseptic meningitis patients. A similar observation has been reported in previous studies [25, 32]. In addition, the HSV-1 positive aseptic meningitis patients had no antiviral treatment in their hospital records. While antiviral treatment with acyclovir is a necessity in such cases. Overall, the use of the molecular assay in the diagnosis of human herpesviruses associated with aseptic meningitis, considering the availability of effective antiviral therapy, has a significant effect on the management of patients with aseptic meningitis [4, 13].

This study is the first report on the molecular identification of viral meningitis in the South of Iran. The results of this study indicate the importance of molecular assay in the diagnosis of etiological agents of aseptic meningitis. Early and reliable diagnosis of viral pathogens provides a better chance of managing viral meningitis through the early administration of antiviral agents. Moreover, the nested PCR technique increases the sensitivity of diagnosing viral infections, especially herpesviruses, in CSF specimens of aseptic meningitis. Almost all positive samples for mumps virus, HSV and VZV were identified in the second round of amplification.

Supplementary Information

Below is the link to the electronic supplementary material.

Author contributions

FF and TR designed and performed the study. FF drafted and edited the manuscript. All authors approved the final draft of the manuscript.

Funding

The Deputy Research and Affairs of Bushehr University of Medical Science funded this study with grant number 4359.

Availability of data and materials

All relevant data are within the paper.

Declarations

Conflict of interest

The authors declared that they do not have anything to disclose regarding conflict of interest with respect to this manuscript.

Ethical approval

The ethical approval was given by the Ethical Committee of Bushehr University of Medical Sciences (reference number bpums.rec.1394.29).

Consent to participate

The patients or their legal guardians gave written informed consent for the use of their leftover CSF samples for viral detection to participate in the study.

Consent to publish

The participants gave written informed consent to publish their data in a journal article.