Skip to main content
NCBI home page
Cellular and Molecular Immunology logoLink to Cellular and Molecular Immunology
. 2021 Nov 16;18(12):2648–2659. doi: 10.1038/s41423-021-00799-1

The membrane-associated E3 ubiquitin ligase MARCH3 downregulates the IL-6 receptor and suppresses colitis-associated carcinogenesis

Heng Lin 1, Lu Feng 1, Kai-Sa Cui 2, Lin-Wen Zeng 1, Deng Gao 1, Long-Xiang Zhang 1, Wen-Hua Xu 1, Yu-Hao Sun 1, Hong-Bing Shu 1,✉, Shu Li 1,✉
PMCID: PMC8632971  PMID: 34785732

Abstract

The IL-6-STAT3 axis is critically involved in inflammation-associated carcinogenesis (IAC). How this axis is regulated to modulate IAC remains unknown. Here, we show that the plasma membrane-associated E3 ubiquitin ligase MARCH3 negatively regulates STAT3 activation triggered by IL-6, as well as another IL-6 subfamily member, Oncostatin M (OSM). MARCH3 is associated with the IL-6 receptor α-chain (IL-6Rα) and its coreceptor gp130. Biochemical experiments indicated that MARCH3 mediates the polyubiquitination of IL-6Rα at K401 and gp130 at K849 following IL-6 stimulation, leading to their translocation to and degradation in lysosomes. MARCH3 deficiency increases IL-6- and OSM-triggered activation of STAT3 and induction of downstream effector genes in various cell types. MARCH3 deficiency enhances dextran sulfate sodium (DSS)-induced STAT3 activation, increases the expression of inflammatory cytokines, and exacerbates colitis, as well as azoxymethane (AOM)/DSS-induced colitis-associated cancer in mice. In addition, MARCH3 is downregulated in human colorectal cancer tissues and associated with poor survival across different cancer types. Our findings suggest that MARCH3 is a pivotal negative regulator of IL-6-induced STAT3 activation, inflammation, and inflammation-associated carcinogenesis.

Keywords: MARCH3, IL-6, IL-6Ra, colitis-associated carcinogenesis, polyubiquitination

Subject terms: Inflammation, Tumour immunology

Introduction

IL-6 is a pleiotropic cytokine that plays crucial role in immune modulation and inflammation [1, 2]. IL-6 binds to the IL-6 receptor α-chain (IL-6Rα) and then associates with glycoprotein 130 (gp130), a common receptor subunit for other IL-6 family members, such as oncostatin M (OSM), leukemia inhibitory factor, IL-11, IL-27, and ciliary neurotrophic factor. The binding of IL-6 to its receptor complex leads to activation of Janus kinases (JAKs) [3]. Activated JAKs recruit the transcription factor signal transducer and activator of transcription 3 (STAT3) and mediate its phosphorylation at Y705 [4]. Phosphorylated STAT3 translocates into the nucleus to induce the transcription of a set of downstream effector genes including IL-6, SOCS3, FOS, and Bcl-xL, which play crucial roles in promoting tumor cell proliferation and survival, tumor invasion, angiogenesis, and immunosuppression [2, 5–7].

The activation of STAT3 is tightly regulated in various physiological processes, such as cell proliferation, survival, and differentiation. Aberrant and persistent activation of STAT3 has been found in various types of cancers [2, 6, 8]. Multiple mechanisms have been reported to regulate IL-6-triggered STAT3 activation. IL-6 induces the expression of two cytokine receptor signaling inhibitors, SOCS1 and SOCS3, which inhibit JAK activity and subsequent STAT3 activation by binding to phosphorylated JAKs or competing with STAT3 for binding to gp130 [9, 10]. Recently, it has been reported that TRIM27 positively regulates IL-6-induced STAT3 activation at retromer-positive structures, thereby promoting colitis and colitis-associated carcinogenesis [11]. FAM64A is associated with STAT3 in the nucleus and regulates its DNA-binding activity, thereby positively regulating Th17 differentiation and inflammation-associated tumorigenesis [12]. Previously, it was demonstrated that IL-6 stimulation causes downregulation of its cell surface receptor subunits IL-6Rα and gp130 [13, 14]. However, the mechanisms underlying these observations are unknown.

The membrane-associated RING-CH-type finger (MARCH) proteins, which are E3 ubiquitin ligases, have emerged as critical regulators of immune responses by targeting various immune receptors, viral proteins, or certain organelle membrane-associated components involved in innate immune responses for polyubiquitination and degradation [15, 16]. In this study, we identified MARCH3, which is expressed mainly by immune cells [15], as a crucial negative regulator of IL-6- and OSM-triggered STAT3 activation. Mechanistically, MARCH3 associated with IL-6Rα and gp130 and mediated their polyubiquitination and lysosome-dependent degradation. March3 deficiency promoted dextran sulfate sodium (DSS)-induced colitis as well as azoxymethane (AOM)/DSS-induced colitis-associated cancer (CAC) in mice. We also found that MARCH3 was downregulated in human colorectal cancer (CRC) tissues and associated with poor survival across different cancer types. Our findings suggest that MARCH3 mediates the polyubiquitination and degradation of IL-6 receptor components following IL-6 stimulation, thereby negatively regulating inflammation-associated carcinogenesis.

Results

MARCH3 inhibits IL-6- and OSM-triggered signaling

Our previous study demonstrated that MARCH3 regulates IL-1β-triggered inflammation by mediating the polyubiquitination of IL-1 receptor I (IL-1RI) [17]. In this study, we investigated the potential role of MARCH3 in signaling mediated by other cytokine receptors. In reporter assays, overexpression of MARCH3 inhibited IL-6- and OSM-induced STAT3 activation in a dose-dependent manner in HEK293 cells (Fig. 1A). It has been reported that interferon (IFN)-γ induces STAT1-mediated transcription of the IFN-regulatory factor 1 (IRF1) gene [18]. Overexpression of MARCH3 had no marked effect on IFN-γ-induced IRF1 promoter activation (Fig. 1A). IFN-β, a member of the type I IFN family of cytokines, activates STAT1 and STAT2 to induce IFN-stimulated gene (ISG) expression [19]. Similarly, overexpression of MARCH3 had no marked effects on IFN-β-induced STAT1/2 activation in HEK293 cells (Fig. 1A). Consistent with these results, overexpression of MARCH3 inhibited IL-6- and OSM-induced transcription of the IL6, SOCS3, and FOS genes but had no marked effects on IFN-γ-induced transcription of the IRF1 gene or IFN-β-induced transcription of the ISG56 gene (Fig. 1B). In addition, overexpression of MARCH3 inhibited IL-6- and OSM-induced phosphorylation of STAT3Y705 (which is a hallmark of STAT3 activation) in HeLa cells (Fig. 1C). These results suggest that overexpression of MARCH3 negatively regulates IL-6- and OSM-induced STAT3 activation pathways.

Fig. 1.

Fig. 1

Open in a new tab

MARCH3 inhibits IL-6- and OSM-triggered signaling. A Effects of MARCH3 on signaling triggered by IL-6, OSM, IFN-γ, and IFN-β. HEK293 cells (1 × 105) were transfected with the STAT3, STAT1/2, or IRF1 promoter-luciferase reporter plasmids (10 ng) and increasing amounts of the MARCH3 plasmid for 24 h. The cells were then left untreated or treated with IL-6 (10 ng/mL), OSM (5 ng/mL), IFN-γ (100 ng/mL), or IFN-β (100 ng/mL) for 10 h before luciferase assays were performed. B Effects of MARCH3 on IL-6-, OSM-, IFN-γ- and IFN-β-induced transcription of downstream genes. HeLa cells (4 × 105) stably expressing MARCH3-FLAG were starved overnight prior to IL-6 (20 ng/mL), OSM (10 ng/mL), IFN-γ (100 ng/mL), or IFN-β (100 ng/mL) treatment for the indicated times before qPCR analysis of the mRNA levels of the indicated genes. C Effects of MARCH3 on IL-6- and OSM-induced STAT3 phosphorylation. HeLa cells (4 × 105) stably expressing MARCH3-FLAG were starved overnight prior to stimulation with IL-6 (20 ng/mL) or OSM (10 ng/mL) for the indicated times before immunoblot analysis. The data shown in (A) and (B) are the mean ± SD from one representative experiment performed with triplicates. The experiments in (A−C) were repeated three times with similar results. **P < 0.01, ***P < 0.001. NS not significant

To investigate whether endogenous MARCH3 regulates IL-6- and OSM-triggered signaling, we established human MARCH3-RNAi HeLa cell lines in which MARCH3 was successfully downregulated (Fig. 2A). qPCR analysis indicated that knockdown of MARCH3 increased IL-6- and OSM-induced transcription of the downstream IL6, SOCS3, and FOS genes in HeLa cells (Fig. 2A). However, knockdown of MARCH3 did not affect IFN-γ-induced transcription of the IRF1 gene or IFN-β-induced transcription of the ISG56 gene (Fig. 2A). To confirm the roles of March3 in primary immune cells, we generated March3-deficient mice utilizing the CRISPR/Cas9 strategy (in the following text, the designations of Homo sapiens genes and proteins are presented in capital letters, while only the first letter of murine gene and protein designations is capitalized). The numbers and compositions of major immune cells in peripheral lymph nodes (PLNs), the spleen, and the thymus were similar between March3+/+ and March3−/− mice (Fig. S1A–C), suggesting that March3 is not essential for the development of the investigated immune cells. We examined the expression of downstream genes induced by Il-6 or Osm in wild-type and March3−/− bone marrow-derived macrophages (BMDMs). The results indicated that transcription of the Il-6, Socs3, and Fos genes induced by Il-6 or Osm was increased in March3−/− BMDMs compared to wild-type BMDMs (Fig. 2B). In addition, we observed that both Il-6 and Osm induced March3 gene transcription at early time points after stimulation (Fig. 2B). March3 deficiency also enhanced the induction of Il-6, Socs3, and Fos genes transcription by Il-6 or Osm in murine intestinal epithelial cells (IECs) (Fig. S2), in addition to BMDMs. In similar experiments, March3 deficiency had no marked effects on Ifn-γ-induced transcription of the Irf1 gene or Ifn-β-induced transcription of the Isg56 gene (Fig. 2C). We also observed that March3 deficiency increased Il-6- and Osm-induced phosphorylation of Stat3Y705 in BMDMs (Fig. 2D). These data suggest that March3 negatively regulates Il-6- and Osm-induced signaling in primary mouse cells.

Fig. 2.

Fig. 2

Open in a new tab

MARCH3 deficiency potentiates IL-6- and OSM-triggered signaling. A Effects of MARCH3 knockdown on IL-6-, OSM-, IFN-γ- and IFN-β-induced transcription of downstream genes. HeLa cells (4 × 105) stably transduced with control or MARCH3 shRNA were starved overnight prior to stimulation with IL-6 (20 ng/mL), OSM (10 ng/mL), IFN-γ (100 ng/mL), or IFN-β (100 ng/mL) for the indicated times before qPCR analysis of the mRNA levels of the indicated genes. The data shown are the mean ± SD from one representative experiment performed with triplicates. The experiments were repeated twice with similar results. B Effects of March3 deficiency on Il-6- and Osm-induced transcription of downstream genes. BMDMs (6 × 105) isolated from March3+/+ (n = 3) and March3−/− (n = 3) mice were starved overnight and treated with murine Il-6 (20 ng/mL) or Osm (10 ng/mL) for the indicated times before qPCR analysis of the mRNA levels of the indicated genes. The data shown are the mean ± SD (n = 3) from one representative experiment, which was repeated twice with similar results. C Effects of March3 deficiency on Ifn-γ- and Ifn-β-induced transcription of downstream genes. BMDMs (6 × 105) derived from March3+/+ (n = 3) and March3−/− (n = 3) mice were treated with Ifn-γ (100 ng/mL) or Ifn-β (100 ng/mL) for the indicated times before qPCR analysis of the mRNA levels of the indicated gene. The data shown are the mean ± SD (n = 3) from one representative experiment, which was repeated twice with similar results. D Effects of March3 deficiency on Il-6- and Osm-induced Stat3 phosphorylation. March3+/+ or March3−/− BMDMs (6 × 105) pooled from three mice were starved overnight prior to stimulation with Il-6 (20 ng/mL) or Osm (10 ng/mL) for the indicated times before immunoblot analysis. The experiments were repeated twice with similar results. *P < 0.05, **P < 0.01, ***P < 0.001. NS not significant

Since MARCH2 exhibits the greatest sequence similarity with MARCH3 among MARCH family members [20], we investigated whether MARCH2 regulates IL-6- and OSM-triggered signaling. We utilized March2-deficient mice generated by CRISPR/Cas9 (Fig. S3A). Successful targeting of the March2 gene was verified by genotyping (Fig. S3B). We examined the transcription of downstream genes induced by Il-6 or Osm in wild-type and March2−/− BMDMs. The results showed that no marked effects on the transcription of the Il-6, Socs3, and Fos genes induced by Il-6 or Osm were observed in March2-deficient BMDMs compared to wild-type BMDMs (Fig. S4). These results suggest that March3 but not March2 negatively regulates Il-6- and Osm-triggered signaling in primary mouse cells.

MARCH3 mediates degradation of IL-6Rα and gp130

To investigate the molecular mechanisms by which MARCH3 regulates IL-6- and OSM-induced signaling, we first determined the effects of overexpression of MARCH3 on the protein levels of key components in the IL-6- and OSM-triggered signaling pathways. We found that overexpression of MARCH3 decreased the levels of the high-molecular-weight (probably glycosylated) forms of IL-6Rα and gp130 but had no marked effects on the levels of the OSM receptor (OSMR), JAK1, JAK2, and STAT3 (Fig. 3A). During the course of this study, one group reported that MARCH3 can downregulate IL-6Rα in mouse myeloid leukemia M1 cells; [21] however, the mechanisms and functions were not characterized. In transient transfection and coimmunoprecipitation experiments, MARCH3 was found to interact with IL-6Rα and gp130 but not with JAK1 or JAK2 in HEK293 cells (Fig. 3B). Endogenous coimmunoprecipitation experiments showed that MARCH3 constitutively interacted with IL-6Rα and gp130 and that their association was increased after IL-6 stimulation in human erythroleukemia TF-1 cells (Fig. 3C). These data suggest that MARCH3 interacts with IL-6Rα and gp130.

Fig. 3.

Fig. 3

Open in a new tab

MARCH3 mediates the downregulation of IL-6Rα and gp130. A MARCH3 promotes a decrease in the levels of high-molecular-weight forms of IL-6Rα and gp130. HEK293 cells (4 × 105) were transfected with expression plasmids for the indicated FLAG-tagged proteins, HA-tagged MARCH3 and β-actin for 24 h before immunoblot analysis with the indicated antibodies. B MARCH3 interacts with IL-6Rα and gp130. HEK293 cells (2 × 106) were transfected with expression plasmids for HA-tagged MARCH3 and the indicated FLAG-tagged proteins for 20 h. Cell lysates were immunoprecipitated with an anti-HA antibody (αHA) or control mouse IgG (IgG). The immunoprecipitates were analyzed by immunoblotting with an anti-FLAG antibody. Lysates were analyzed by immunoblotting with anti-FLAG and anti-HA antibodies to determine the expression levels of transfected proteins. C Endogenous MARCH3 associates with IL-6Rα and gp130. TF-1 cells (3 × 107) were starved for 2 h and were then treated with IL-6 (50 ng/mL) or left untreated for the indicated times. Cell lysates were immunoprecipitated with control rabbit IgG (IgG) or an anti-IL-6Rα antibody or with preimmune serum (Pre) or anti-gp130 antiserum as indicated. The immunoprecipitates were analyzed by immunoblotting with mouse anti-MARCH3, rabbit anti-IL-6Rα, or rabbit anti-gp130 antibodies as indicated. Lysates were analyzed by immunoblotting with rabbit anti-IL-6Rα, rabbit anti-gp130, or mouse anti-MARCH3 antibodies to determine the levels of the respective endogenous proteins. D MARCH3 but not its E3 ligase-inactive mutants downregulates IL-6Rα and gp130. HEK293 cells (4 × 105) were transfected with expression plasmids for FLAG-tagged IL-6Rα, HA-tagged MARCH3 or its mutants, and HA-tagged β-actin for 24 h. Cell lysates were then analyzed by immunoblotting for the indicated proteins. E Effects of March3 deficiency on Il-6-induced downregulation of Il-6rα and gp130. March3+/+ or March3−/− BMDMs (6 × 105) pooled from three mice were starved overnight prior to stimulation with murine Il-6 (20 ng/mL) for the indicated times before immunoblot analysis of the indicated proteins. All experiments were repeated at least twice with similar results

Since MARCH3 belongs to the RING-CH-type finger E3 ubiquitin ligase family, we further investigated whether the functions of MARCH3 are dependent on its E3 ligase activity. It has been demonstrated that mutation of the conserved cysteine residues in the RING domain of an E3 ubiquitin ligase leads to inactivation of the ligase [22]. It has been shown that the MARCH3 C71S, C74S, and C87S mutants are catalytically inactive [17]. We found that overexpression of wild-type MARCH3 but not the C71S, C74S, or C87S mutant decreased the levels of IL-6Rα and gp130 (Fig. 3D). These results suggest that MARCH3 specifically mediates the degradation of IL-6Rα and gp130 in an E3 ligase activity-dependent manner. Previously, it has been reported that IL-6 stimulation induces degradation of its receptor [13, 14, 23]. We also observed that March3 deficiency increased the levels of endogenous Il-6rα and gp130 in unstimulated BMDMs and inhibited their degradation following Il-6 stimulation in these cells (Fig. 3E). These results suggest that MARCH3 mediates the downregulation of IL-6Rα and gp130 in an E3 ligase-dependent manner in both unstimulated and IL-6-stimulated cells.

MARCH3 mediates K48-linked polyubiquitination of IL-6Rα and gp130

Since MARCH3 is an E3 ubiquitin ligase and mediates the downregulation of IL-6Rα and gp130, we next determined whether MARCH3 mediates the polyubiquitination of IL-6Rα and gp130. In the mammalian overexpression system, MARCH3 but not the C71S, C74S, or C87S mutant markedly enhanced the polyubiquitination of IL-6Rα and gp130 (Fig. 4A). Further experiments with linkage-specific ubiquitin moieties indicated that overexpression of MARCH3 promoted K48- and K63-linked polyubiquitination of IL-6Rα and K48-linked polyubiquitination of gp130 (Fig. S5A, B). MARCH3 deficiency inhibited IL-6-induced K48- and K63-linked polyubiquitination of IL-6Rα and K48-linked polyubiquitination of gp130 in TF-1 cells (Fig. 4B). These results suggest that MARCH3 mediates K48- and K63-linked polyubiquitination of IL-6Rα and K48-linked polyubiquitination of gp130 following IL-6 stimulation.

Fig. 4.

Fig. 4

Open in a new tab

MARCH3 mediates the polyubiquitination of IL-6Rα at K401 and gp130 at K849. A MARCH3 but not its mutants mediate the polyubiquitination of IL-6Rα and gp130. HEK293 cells (2 × 106) were transfected with the indicated plasmids for 20 h. Cell lysates were immunoprecipitated with an anti-FLAG antibody. The immunoprecipitates were analyzed by immunoblotting with an anti-Myc antibody. Cell lysates were analyzed by immunoblotting with anti-FLAG and anti-HA antibodies to determine the levels of transfected proteins. B Effects of MARCH3 deficiency on IL-6-induced K48- or K63-linked polyubiquitination of IL-6Rα and gp130. MARCH3-deficient (MARCH3-KO) and control (Con) TF-1 cells (3 × 107) were starved for 2 h and were then stimulated with IL-6 (50 ng/mL) or left untreated for the indicated times. Cell lysates were then immunoprecipitated with an anti-IL-6Rα antibody, and the immunoprecipitates were analyzed by immunoblotting with anti-Ub-K48, anti-Ub-K63, anti-IL-6Rα, or anti-gp130 antibodies. Cell lysates were analyzed by immunoblotting for the indicated proteins. C MARCH3 catalyzes the polyubiquitination of IL-6Rα at K401 and gp130 at K849. HEK293 cells (2 × 106) were transfected with the indicated plasmids for 20 h. Cell lysates were then immunoprecipitated with an anti-FLAG antibody, and the immunoprecipitates were analyzed by immunoblotting with anti-FLAG or anti-HA antibodies. Ub(K48O), ubiquitin with all lysines except K48 mutated to arginine; Ub(K63O), ubiquitin with all lysines except K63 mutated to arginine. D Levels of IL-6Rα, gp130, and the related mutants following IL-6 stimulation. HEK293 (4 × 105) cells were transfected with the indicated plasmids for 15 h and were then treated with cycloheximide (CHX) (250 μg/mL) for 1 h. The cells were then left untreated or treated with IL-6 (50 ng/mL) for the indicated times before immunoblot analysis of the indicated proteins. The relative levels of IL-6Rα, gp130, and the related mutants normalized to β-actin were determined by the ImageJ program and are shown in the graphs on the right. E Internalization of IL-6Rα, gp130, and the related mutants following IL-6 stimulation. IL-6Rα- and gp130-deficient HeLa cells were reconstituted with IL-6Rα or its mutants and gp130 or its mutants, respectively, by lentiviral-mediated gene transfer. The reconstituted cells (4 × 105) were left untreated or treated with IL-6 (50 ng/mL) for 60 min. Cells were analyzed by flow cytometry after staining with anti-IL-6Rα or anti-gp130 antibodies. The data shown are the mean ± SD (n = 3) of the median fluorescence intensity (MFI) values from flow cytometric analysis. F MARCH3 mediates lysosome-dependent degradation of IL-6Rα and gp130. HEK293 (4 × 105) cells were transfected with expression plasmids for FLAG-tagged IL-6Rα, Myc-tagged MARCH3, and HA-tagged β-actin as indicated for 10 h and were then treated with NH4Cl (10 mM) or MG132 (10 nM) for 6 h before immunoblot analysis with anti-FLAG, anti-Myc, and anti-HA antibodies, respectively. G IL-6RαK401R and gp130K849R have an increased ability to mediate IL-6-induced signaling compared with their respective wild-type receptors. IL-6Rα- (gIL6R) and gp130-deficient (ggp130) HeLa cells were reconstituted with IL-6Rα or its mutants and gp130 or its mutants, respectively, by lentiviral-mediated gene transfer. The reconstituted cells (1 × 105) were left untreated or treated with IL-6 (20 ng/mL) for the indicated times before qPCR analysis of the mRNA levels of the indicated genes. gNC, negative control. The data shown are the mean ± SD from one representative experiment performed with triplicates. All experiments were repeated at least twice with similar results. *P < 0.05, **P < 0.01, ***P < 0.001. NS not significant

MARCH3 mediates the polyubiquitination of IL-6RαK401 and gp130K849

There are 5 lysine residues in the cytoplasmic domain (aa 387–468) of IL-6Rα and 16 lysine residues in the cytoplasmic domain (aa 642–918) of gp130. To identify potential ubiquitination residues in IL-6Rα and gp130, we individually mutated each lysine in their cytoplasmic domains to arginine and examined whether overexpression of MARCH3 downregulated these mutants. The results indicated that the protein levels of all mutants except IL-6RαK401R and gp130K849R were markedly decreased by MARCH3 (Fig. S6A, B). Furthermore, we found that MARCH3 could not catalyze K48- or K63-linked polyubiquitination of IL-6RαK401R or K48-linked polyubiquitination of gp130K849R (Fig. 4C). Moreover, we observed that mutation of K401 in IL-6Rα or K849 in gp130 to arginine inhibited IL-6-induced downregulation of these proteins (Fig. 4D). Sequence analysis indicated that K401 in IL-6Rα and K849 in gp130 are conserved in various species (Fig. S6C), suggesting that these residues have conserved roles. Flow cytometric analysis indicated that plasma membrane-localized IL-6Rα and gp130 were internalized after IL-6 stimulation, whereas IL-6Rα(K401R) and gp130(K849R) were resistant to IL-6-induced internalization (Fig. 4E). Furthermore, we found that downregulation of IL-6Rα and gp130 mediated by MARCH3 was restored by treatment of cells with the lysosomal inhibitor NH4Cl but not the proteasomal inhibitor MG132 (Fig. 4F). Taken together, these results suggest that after IL-6 stimulation, MARCH3 increases the polyubiquitination of IL-6Rα at K401 and gp130 at K849, resulting in their translocation to and degradation in lysosomes. Consistent with these results, reconstitution of IL-6Rα-deficient cells with IL-6RαK401R or reconstitution of gp130-deficient cells with gp130K849R enhanced IL-6-induced transcription of downstream genes compared with that induced by reconstitution with the corresponding wild-type receptors (Fig. 4G).

March3 deficiency promotes colitis and colitis-associated cancer

The IL-6-STAT3 axis plays crucial role in inflammation-associated carcinogenesis. We next investigated the effects of March3 on DSS-induced acute colitis. Mice were treated with 3% DSS in the drinking water to induce acute colitis. In comparison to their wild-type littermates, March3−/− mice exhibited greater exacerbation of colitis, as determined by their increased weight loss, decreased survival rate, and increased colon shortening (Fig. S7A–C). Histopathological analysis showed that the colonic mucosa of March3−/− mice was less intact, with the apparent loss of crypt structures and mucosal ulceration, than that of their wild-type littermates. In addition, the colonic tissues of March3−/− mice had more infiltration of inflammatory cells than that of their wild-type littermates (Fig. S7D). Consistent with these results, the mRNA levels of inflammatory cytokine genes, including Il-6, Tnfa, and Il-17a, were increased in colonic lysates from March3−/− mice compared to those from their wild-type littermates (Fig. S7E). These results suggest that March3 deficiency promotes DSS-induced colonic inflammatory responses.

We next investigated the roles of March3 in inflammation-associated carcinogenesis utilizing the azoxymethane (AOM)/DSS model [24]. In this model, mice were injected with AOM prior to three rounds of DSS exposure to induce CAC (Fig. 5A). The results showed that March3-deficient mice had increased weight loss compared with that of their wild-type littermates following model establishment (Fig. 5B). March3-deficient mice developed more and larger colon tumors than their wild-type littermates (Fig. 5C). In addition, most of the colon adenomas in March3−/− mice were classified as high-grade dysplasia, while the adenomas in their wild-type littermates were classified as low-grade dysplasia and infiltrated with fewer inflammatory cells (Fig. 5D). Immunohistochemical (IHC) analysis indicated that cell proliferation, as determined by Ki-67 nuclear staining and Stat3Y705 phosphorylation, was markedly increased in the colon tumors of March3−/− mice compared with those of their wild-type littermates (Fig. 5E, F). Moreover, the mRNA levels of Il-6, Tnfa, Socs3, and Myc in colon tissues were increased in March3−/− mice compared to their wild-type littermates (Fig. 5G). These results suggest that March3 plays critical role in CAC development.

Fig. 5.

Fig. 5

Open in a new tab

March3 deficiency aggravates AOM/DSS-induced CAC. A A schematic overview of the CAC model. Sex- and age-matched March3+/+ (n = 14) and March3−/− (n = 14) mice were used for the experiments. Five days after the initial AOM injection (10 mg/kg), drinking water containing DSS was provided for 7 days, followed by regular water for 15–20 days as indicated; this cycle was repeated twice. B Effects of March3 deficiency on body weight changes. Body weight was measured daily during the experiment. C Effects of March3 deficiency on the numbers and sizes of colon tumors. After the procedures described in (A), the colons of March3+/+ and March3−/− mice were removed and photographed. The tumor numbers (left panel) and tumor sizes (right panel) were determined. The results shown are the mean ± SD values; n = 6. D Representative images of H&E staining of colon tumors from the mice described in (C). Scale bars, 200 μm. E Representative images of immunohistochemical staining of the colon tumors described in (C). Scale bars, 1 mm or 100 μm as indicated. F The number of DAB-positive cells was quantified with Image-Pro Plus 6 (Media Cybernetics). The results shown are the mean ± SD values; n = 4. G qPCR analysis of colon tissues from March3+/+ (n = 12) and March3−/− (n = 7) mice treated with AOM/DSS. The results are presented as the mean ± SD values. *P < 0.05, **P < 0.01, ***P < 0.001

MARCH3 is downregulated in colorectal cancer and associated with poor survival in cancer patients

To evaluate the clinical relevance of MARCH3 in human colorectal cancer (CRC), we analyzed its expression in CRC cohorts from The Cancer Genome Atlas (TCGA) and Human Protein Atlas (HPA) datasets. We found that the mRNA level of MARCH3 was significantly downregulated in CRC tissues compared with normal tissues in TCGA (Fig. 6A). IHC staining data from the HPA revealed that the MARCH3 level was lower in CRC tissue than in normal tissue (Fig. 6B). It has been reported that genomic copy number variation (CNV) is an important contributor to the dysregulation of genes in human cancers [25, 26]. Analysis of MARCH3 CNVs indicated that the proportion of patients with MARCH3 copy number loss was higher than that of patients with copy number gain (Fig. 6C). Moreover, the MARCH3 copy number loss group showed significantly lower MARCH3 expression than the copy number neutral and gain groups (Fig. 6C). These data suggest that MARCH3 copy number loss is associated with its downregulation in CRC.

Fig. 6.

Fig. 6

Open in a new tab

MARCH3 is downregulated in CRC and associated with poor survival outcomes. A Boxplot of MARCH3 expression based on RNA-Seq or RNA-SeqV2 in CRC samples from the TCGA dataset. B IHC staining of MARCH3 proteins in normal and CRC samples from the HPA dataset. Scale bars, 200 μm. C The proportions of MARCH3 CNV statuses in a CRC dataset from TCGA (left panel). MARCH3 expression in samples grouped by CNV status in a CRC dataset from TCGA (right panel). D Kaplan–Meier curves of OS and DSS based on the expression of MARCH3 in a CRC dataset from TCGA. E Kaplan–Meier curve of OS based on the expression of MARCH3 in a CRC dataset from GEO. F Univariable and multivariable Cox regression analyses of MARCH3 in a CRC dataset from TCGA. The X-axis shows the log2 transformed hazard ratio (HR) values, and the Y-axis shows the −log transformed P values. The P values in the boxplots were calculated with the Mann−Whitney test. ****P < 0.0001

We further explored the correlation between MARCH3 expression and CRC survival outcomes. In the TCGA CRC cohort, the patients with low expression of MARCH3 showed significantly poorer overall survival (OS) and disease-specific survival (DSS) than those with high expression of MARCH3 (Fig. 6D). Low expression of MARCH3 was also associated with poor OS in two independent CRC cohorts from the Gene Expression Omnibus (GEO) database (Fig. 6E). Furthermore, univariable and multivariable Cox regression analyses indicated that MARCH3 was an independent prognostic factor for 5-year OS in CRC patients in TCGA (Fig. 6F). In addition, a pancancer survival analysis of TCGA datasets demonstrated that MARCH3 downregulation was associated with poor OS in breast invasive carcinoma (BRCA), pancreatic adenocarcinoma (PAAD), glioblastoma multiforme (GBM), head and neck squamous cell carcinoma (HNSC), cervical squamous cell carcinoma (CESC) and low-grade glioma (LGG) (Fig. S8). Collectively, these data suggest that downregulation of MARCH3 is correlated with the pathogenesis of CRC as well as other cancer types.

Discussion

Previous studies have demonstrated that the IL-6-STAT3 axis plays crucial roles in various biological processes, as well as inflammation-associated carcinogenesis [1, 2, 27]. This axis is delicately regulated through distinct mechanisms to ensure proper execution of biological functions and pathological processes. In this study, we identified MARCH3 as a critical negative regulator of IL-6- and OSM-triggered STAT3 activation as well as colitis-associated carcinogenesis.

Our results indicated that overexpression of MARCH3 inhibited IL-6- and OSM-triggered activation of STAT3 and transcription of downstream effector genes, whereas MARCH3 deficiency had the opposite effects. The expression of MARCH3 was increased upon IL-6 or OSM stimulation, suggesting that MARCH3 is involved in negative feedback regulatory mechanisms mediating signaling by IL-6 family members. Although MARCH2 exhibits the greatest sequence similarity with MARCH3 among MARCH family members [20], compared to wild-type BMDMs, BMDMs with March2 deficiency exhibited no marked effects on the transcription of the Il-6, Socs3, and Fos genes induced by Il-6 or Osm. These results suggest that March3 but not March2 negatively regulates Il-6- and Osm-induced signaling in primary mouse cells. Coimmunoprecipitation experiments indicated that MARCH3 interacts with IL-6Rα and gp130. Overexpression of MARCH3 caused decreases in the levels of high-molecular-weight (most likely glycosylated) forms of IL-6Rα and gp130 in an E3 ubiquitin ligase activity-dependent manner, and this effect was inhibited by treatment with a lysosomal inhibitor. These results suggest that membrane-localized MARCH3 targets membrane IL-6Rα and gp130 for lysosomal degradation. Consistent with these results, MARCH3 deficiency increased the levels of endogenous IL-6Rα and gp130 and inhibited IL-6-induced degradation of IL-6Rα and gp130 in BMDMs and TF-1 cells. Intriguingly, MARCH3 did not degrade the OSM receptor OSMR. Previously, it was reported that MARCH3 downregulates the IL-1 receptor IL-1RI but not its coreceptor IL-1RAcP or the IL-33 receptor ST2 [17]. These observations suggest that MARCH3 has a versatile ability to regulate inflammatory responses by targeting distinct members of the IL receptor family. Our experiments indicated that MARCH3 promoted K48- and K63-linked polyubiquitination of IL-6Rα at K401 and K48-linked polyubiquitination of gp130 at K849 after IL-6 stimulation. Flow cytometric analysis indicated that wild-type IL-6Rα and gp130 but not IL-6RαK401R or gp130K849R were internalized from the plasma membrane upon IL-6 stimulation. Taken together, these results suggest that upon IL-6 stimulation, plasma membrane-associated MARCH3 increases the polyubiquitination of membrane IL-6Rα and gp130, leading to their internalization from the plasma membrane and lysosomal degradation. Since MARCH3 mediates both K48- and K63-mediated polyubiquitination of IL-6Rα at the same residue (K401), whether these different linkage modifications play distinct roles in the regulation of IL-6Rα needs further investigation. Previously, it was reported that the E3 ubiquitin ligase c-Cbl targets gp130 for K63-linked polyubiquitination and lysosome-dependent degradation upon IL-6 stimulation [28]. Whether MARCH3 and c-Cbl are mutually required for IL-6-induced degradation of gp130 requires further investigation.

Consistent with this role in the negative regulation of IL-6-triggered STAT3 activation, our results suggest that MARCH3 negatively regulates colitis and CAC development. In the DSS-induced acute colitis model, March3-deficient mice displayed aggravated colitis in comparison to that in their wild-type littermates. Consistent with these results, March3-deficient mice had increased transcription of inflammatory genes in the colonic mucosa. In the AOM/DSS model, March3-deficient mice had greater body weight loss and developed more, larger, and higher-grade colon tumors than their wild-type littermates. The tumor tissues in March3-deficient mice had increased infiltration of inflammatory cells and increased transcription of Stat3 target genes. In addition, MARCH3 was significantly downregulated in CRC tissues, and low expression of MARCH3 was associated with poor survival in patients with various types of cancer. These results suggest that MARCH3 negatively regulates carcinogenesis and is a candidate tumor suppressor gene. Previously, it was demonstrated that MARCH3 negatively regulates IL-1β signaling by targeting IL-1RI [17]. It is possible that MARCH3 negatively regulates colitis and CAC by downregulating multiple members of the interleukin receptor family. In conclusion, our findings reveal that MARCH3 negatively regulates IL-6-triggered signaling, colitis, and carcinogenesis by targeting IL-6 receptor components for polyubiquitination and degradation. Therefore, MARCH3 may serve as a potential target for therapeutic intervention in cancers.

Materials and methods

Reagents, antibodies, and cells

The following items were purchased from the indicated companies: dual-luciferase assay kit (Promega, E1980); RNAiso Plus (Takara Bio, 9109); SYBR Green (Bio-Rad, 172–5274); Recombinant human IL-6, OSM, IFN-γ, IFN-β, and murine Il-6 (Peprotech, 200-06, 300-10, 300-02, 300-02BC and 216-16, respectively); recombinant murine Ifn-γ (BioLegend, 575306); recombinant murine Ifn-β (R&D Systems, 8234-MB); mouse monoclonal antibodies against FLAG (Sigma, F3165), β-actin (Sigma, A2228), hemagglutinin (HA) (OriGene, H6908), Myc (CST, 5605); and rabbit antibodies against p-Y705-STAT3 (CST, D3A7), IL-6Rα (Santa Cruz Biotechnology, sc-661), STAT3 (Proteintech, 10253-2-AP), gp130 (ABclonal, A14654), K48 linkage-specific polyubiquitin (Abcam, ab140601) and K63 linkage-specific polyubiquitin (CST, 5621S). Mouse antisera against MARCH3 were produced against recombinant human MARCH3 (10-180), and rabbit antisera against gp130 were produced against recombinant human gp130 (642–918). HEK293, HeLa, and TF-1 cells were obtained from ATCC.

Constructs

Mammalian expression plasmids for FLAG- or HA-tagged MARCH3 and its mutants, IL-6Rα and its mutants, gp130 and its mutants, OSMR, JAK1, JAK2, STAT3, Myc-tagged MARCH3, as well as pSUPER.Retro-shRNA plasmids for MARCH3, were constructed by standard molecular biology techniques. gRNA plasmids targeting MARCH3, IL6R, and GP130 were constructed with the lentiCRISPR v2 vector. STAT3 and STAT1/2 luciferase reporter plasmids were purchased from Qiagen. The IRF1 promoter-luciferase reporter plasmid was previously described [29].

Mice

March3−/− mice were generated as previously described [17]. March2−/− mice on a C57BL/6 background were generated via CRISPR/Cas9 by Nanjing Biomedical Research Institute. The strategy for the construction of the targeting vector is shown in Fig. S3A. Sequencing of the March2−/− mouse genome suggested the presence of a 7 bp deletion in exon 3 that causes a reading frame shift and early termination of translation. Mice were maintained in specific pathogen-free facilities at Wuhan University. All mouse studies were approved by the Animal Care Committee of the Medical Research Institute of Wuhan University.

Stable cell lines

HEK293 cells plated in 100 mm dishes were transfected with the indicated retroviral expression plasmid together with the pGag-pol and pVSV-G plasmids. The culture medium was replaced with new medium without antibiotics at 12 h after transfection. After an additional 24 h, viruses were harvested and used to infect HeLa cells in the presence of polybrene (8 µg/mL). Transduced cells were selected with puromycin (1 µg/mL) for at least 6 days before experiments.

CRISPR/Cas9 knockout

The protocols for genome engineering using the CRISPR/Cas9 system were previously described [30, 31]. Briefly, ds-oligonucleotides corresponding to the target sequences were cloned into the lentiCRISPR v2 plasmid, and the resulting constructs were cotransfected with packaging plasmids into HEK293 cells. The culture medium was replaced with new medium without antibiotics at 12 h after transfection. After an additional 24 h, viruses were harvested and used to infect TF-1 or HeLa cells. Transduced cells were selected with puromycin (1 µg/mL) for at least 6 days before experiments. The following oligonucleotides were used to construct the corresponding gRNA plasmids:

gNC: 5′-GTAGTCGGTACGTGACTCGT-3′, gIL6R: 5′-TCGGTGCAGCTCCACGACTC-3′, gGP130: 5′-AACACTCTTAATACTTGGGT-3′, gMARCH3 #1: 5′-TGCACCCGTGGTGAAGACGG-3′, gMARCH3 #2: 5′- GATTGTGGCAGCCTAGTGAA-3′.

RNAi experiments

Double-stranded oligonucleotides corresponding to the target sequences were cloned into pSUPER.Retro RNAi plasmid (Oligoengine Inc.). In this study, the following sequences were used to target human MARCH3 mRNA: #1, 5′-GGACCAATCAGAGGGTGAT-3′; #2, 5′-GCGACATGGTGTGCTTCTT-3.

Transfection and reporter assays

HEK293 cells were transfected by standard calcium phosphate precipitation. For normalization of the transfection efficiency, the pRL-TK (Renilla luciferase) reporter plasmid (0.01 μg) was added to each transfection reaction. Empty control plasmid was added to ensure that the same amount of total DNA was used in each transfection reaction. Twenty-four hours after transfection, cells were left untreated or treated with the indicated stimuli. Luciferase assays were performed by using a dual-specific luciferase assay kit (Promega). Firefly luciferase activity was normalized to Renilla luciferase activity.

Coimmunoprecipitation and immunoblot analysis

For transient transfection and coimmunoprecipitation experiments, transfected HEK293 cells (2 × 106) were lysed in l mL of NP-40 lysis buffer (20 mM Tris-HCl (pH 7.5), 150 mM NaCl, 1 mM EDTA, 1% NP-40, 10 μg/mL aprotinin, 10 μg/mL leupeptin and 1 mM phenylmethylsulfonyl fluoride). The lysates were centrifuged at 12,000 rpm for 10 min at 4 °C. For each immunoprecipitation, the supernatant was incubated with 0.5 μg of the indicated antibody and 35 μL of a 50% slurry of GammaBind G Plus-Sepharose (Amersham Biosciences) at 4 °C for 2 h. The beads were washed three times with 1 mL of lysis buffer containing 500 mM NaCl. The bead-bound proteins were separated by sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis (PAGE), and immunoblot analysis was then performed with the indicated antibodies. For endogenous coimmunoprecipitation, the indicated cells were starved for 2 h in fetal bovine serum (FBS)-free medium and stimulated with IL-6 for the indicated times or left untreated before coimmunoprecipitation and immunoblot analysis.

Ubiquitination assays

The experiments were performed as previously described [32]. Briefly, cell lysates were immunoprecipitated with the indicated antibodies. The immunoprecipitates were re-extracted in lysis buffer containing 1% SDS and denatured by heating for 5 min. The supernatants were diluted with NP-40 lysis buffer until the concentration of SDS was decreased to 0.1% prior to reimmunoprecipitation with the indicated antibodies. Ubiquitinated proteins were detected by immunoblotting with anti-ubiquitin antibodies.

qPCR

Total RNA was isolated from cells using TRIzol reagent, reverse transcribed, and subjected to qPCR to measure the mRNA levels of the tested genes. The data shown are the relative abundances of the indicated mRNAs normalized to the abundance of human GAPDH or mouse Gapdh. qPCR was performed using the following primers:

Human GAPDH: GACAAGCTTCCCGTTCTCAG (forward) and GAGTCAACGGATTTGGTCGT (reverse);

Human IL-6: TTCTCCACAAGCGCCTTCGGTC (forward) and TCTGTGTGGGGCGGCTACATCT (reverse);

Human SOCS3: CATCTCTGTCGGAAGACCGTCA (forward) and GCATCGTACTGGTCCAGGAACT (reverse);

Human FOS: GCCTCTCTTACTACCACTCACC (forward) and AGATGGCAGTGACCGTGGGAAT (reverse);

Human ISG56: TCATCAGGTCAAGGATAGTC (forward) and

CCACACTGTATTTGGTGTCTA (reverse);

Human IRF1: GAGGAGGTGAAAGACCAGAGCA (forward) and

TAGCATCTCGGCTGGACTTCGA (reverse);

Human MARCH3: CTGGCTGTCATCCTCAAACACC (forward) and TGTCGCCAAACAGAGTCCGCTT (reverse);

Human IL6R: CTCAGTGTCACCTGGCAAGA (forward) and CCTTGACCATCCATGTTGTG (reverse);

Human GP130: TGAACGAGGGGAAGAAAATG (forward) and ACTTGTGTGTTGCCCATTCA (reverse);

Mouse Gapdh: ACGGCCGCATCTTCTTGTGCA (forward) and ACGGCCAAATCCGTTCACACC (reverse);

Mouse Il-6: TCTGCAAGAGACTTCCATCCAGTTGC (forward) and AGCCTCCGACTTGTGAAGTGGT (reverse);

Mouse Socs3: GGACCAAGAACCTACGCATCCA (forward) and CACCAGCTTGAGTACACAGTCG (reverse);

Mouse Fos: GGGAATGGTGAAGACCGTGTCA (forward) and GCAGCCATCTTATTCCGTTCCC (reverse);

Mouse Tnfa: GGTGATCGGTCCCCAAAGGGATGA (forward) and

TGGTTTGCTACGACGTGGGCT (reverse);

Mouse Il-17a: CATGAGTCCAGGGAGAGCTT (forward) and

ATCTATCAGGGTCTTCATTGCGG (reverse);

Mouse Myc: CTGTACCTCGTCCGATTCC (forward) and GCTCTTCTTCAGAGTCGCT (reverse);

Mouse March2: ATTCACAGAGTGACTGTCCCTT (forward) and GACAGCCATTTCTCCAGGCAGC (reverse);

Mouse March3: GGAAGCAGCCAAGAGGACTT (forward) and TGCAAACCTGAAGTGGCAGA (reverse);

Mouse Isg56: TACAGGCTGGAGTGTGCTGAGA (forward) and

CTCCACTTTCAGAGCCTTCGCA (reverse);

Mouse Irf1: TCCAAGTCCAGCCGAGACACTA (forward) and

ACTGCTGTGGTCATCAGGTAGG (reverse).

Flow cytometry

Spleens, thymi, and peripheral lymph nodes were obtained from March3+/+ and March3−/− mice, and single-cell suspensions were prepared. After depletion of red blood cells by ammonium chloride, cells were subjected to staining with the indicated antibodies for 30 min prior to flow cytometric analysis. The antibodies used in this study were as follows: anti-CD4-PE (BD, 553048), anti-CD8-PB (BD, 558207), anti-CD3-FITC (BD, 561801), and anti-B220-APC (BD, 553092).

For analysis of internalization of IL-6Rα, gp130, and the related mutants following IL-6 stimulation, the indicated cells were left untreated or treated with IL-6 (50 ng/mL) for 60 min. Cells were analyzed by flow cytometry after staining with the indicated antibodies. The antibodies used in this study were as follows: anti-IL-6Rα-APC (BioLegend, 352806) and anti-gp130-PE (BioLegend, 362008).

Colitis and CAC models

To establish the colitis model, sex- and age-matched March3+/+ and March3−/− mice (8–10 weeks of age) were provided drinking water containing 3% DSS for 7 days. To establish the CAC model, mice were injected intraperitoneally with AOM (10 mg/kg), and after 5 days, drinking water containing DSS (2.5%) was provided for 7 days, followed by regular water for 15–20 days as indicated. This cycle was repeated twice with 2% DSS, and mice were sacrificed on Day 80. Histological assessments of colitis and determination of severity scores were performed in a double-blinded manner after hematoxylin and eosin (H&E) staining as described [33].

Bioinformatic analysis

RNA-Seq, RNA-SeqV2, and CNV data for CRC were downloaded from TCGA (http://cancergenome.nih.gov/). RNA-Seq data are expressed as fragments per kilobase million (FPKM) values. OS and DSS data were obtained from the integrated TCGA Pan-Cancer Clinical Data Resource (TCGA-CDR) [34]. The two independent CRC microarray datasets GSE71187 and GSE103479 are available in GEO (http://www.ncbi.nlm.nih.gov/geo/). IHC data for MARCH3 were obtained from the HPA (https://www.proteinatlas.org/). The “survival” package in R 3.5.0 was used to calculate the optimal cutoff value to best stratify the patients into two groups with high and low expression of MARCH3 according to previously described methods [25]. OS and DSS were evaluated by Kaplan–Meier survival analysis with the log-rank test. P < 0.05 was regarded as statistically significant. SPSS 26 was used to perform univariable and multivariable Cox regression analyses.

Statistical analysis

Unpaired Student’s t-test was used for statistical analysis with Microsoft Excel and GraphPad Prism Software. For the mouse survival study, Kaplan–Meier survival curves were generated and analyzed by the log-rank test; P < 0.05 was considered significant.

Supplementary information

Supplementary Figures (1.4MB, pdf)

Acknowledgements

We thank members of our laboratory for technical help and discussions. This work was supported by grants from the National Key R&D Program of China (2017YFA0505800), the National Natural Science Foundation of China (31630045, 31830024, 31900556, and 32070775), the CAMS Innovation Fund for Medical Sciences (2019-I2M-5-071), the National Postdoctoral Program for Innovative Talents (BX20190255) and the China Postdoctoral Science Foundation (2019M662706).

Author contributions

H-BS, SL, and HL conceived and designed the study. HL, LF, DG, L-XZ, W-HX, L-WZ, and Y-HS performed the experiments. H-BS, HL, and SL analyzed the data. K-SC performed bioinformatics data analysis and visualization. H-BS, SL, and HL wrote the manuscript.

Competing interests

The authors declare no competing interests.

Contributor Information

Hong-Bing Shu, Email: shuh@whu.edu.cn.

Shu Li, Email: shuli@whu.edu.cn.

Supplementary information

The online version contains supplementary material available at 10.1038/s41423-021-00799-1.

References

  • 1.Murakami M, Kamimura D, Hirano T. Pleiotropy and specificity: insights from the interleukin 6 family of cytokines. Immunity. 2019;50:812–31. doi: 10.1016/j.immuni.2019.03.027. [DOI] [PubMed] [Google Scholar]
  • 2.Hunter CA, Jones SA. IL-6 as a keystone cytokine in health and disease. Nat Immunol. 2015;16:448–57. doi: 10.1038/ni.3153. [DOI] [PubMed] [Google Scholar]
  • 3.Guschin D, Rogers N, Briscoe J, Witthuhn B, Watling D, Horn F, et al. A major role for the protein tyrosine kinase JAK1 in the JAK/STAT signal transduction pathway in response to interleukin-6. EMBO J. 1995;14:1421–9. doi: 10.1002/j.1460-2075.1995.tb07128.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Zhong Z, Wen Z, Darnell JE., Jr Stat3: a STAT family member activated by tyrosine phosphorylation in response to epidermal growth factor and interleukin-6. Science. 1994;264:95–98. doi: 10.1126/science.8140422. [DOI] [PubMed] [Google Scholar]
  • 5.Levy DE, Darnell JE., Jr Stats: transcriptional control and biological impact. Nat Rev Mol Cell Biol. 2002;3:651–62. doi: 10.1038/nrm909. [DOI] [PubMed] [Google Scholar]
  • 6.Yu H, Lee H, Herrmann A, Buettner R, Jove R. Revisiting STAT3 signalling in cancer: new and unexpected biological functions. Nat Rev Cancer. 2014;14:736–46. doi: 10.1038/nrc3818. [DOI] [PubMed] [Google Scholar]
  • 7.Stark, GR, Cheon, H, Wang, Y. Responses to cytokines and interferons that depend upon JAKs and STATs. Cold Spring Harb Perspect Biol. 2018;10:a028555 (2018). [DOI] [PMC free article] [PubMed]
  • 8.Yu H, Pardoll D, Jove R. STATs in cancer inflammation and immunity: a leading role for STAT3. Nat Rev Cancer. 2009;9:798–809. doi: 10.1038/nrc2734. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Kang S, Tanaka T, Narazaki M, Kishimoto T. Targeting interleukin-6 signaling in clinic. Immunity. 2019;50:1007–23. doi: 10.1016/j.immuni.2019.03.026. [DOI] [PubMed] [Google Scholar]
  • 10.Starr R, Willson TA, Viney EM, Murray LJ, Rayner JR, Jenkins BJ, et al. A family of cytokine-inducible inhibitors of signalling. Nature. 1997;387:917–21. doi: 10.1038/43206. [DOI] [PubMed] [Google Scholar]
  • 11.Zhang HX, Xu ZS, Lin H, Li M, Xia T, Cui K, et al. TRIM27 mediates STAT3 activation at retromer-positive structures to promote colitis and colitis-associated carcinogenesis. Nat Commun. 2018;9:3441. doi: 10.1038/s41467-018-05796-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Xu ZS, Zhang HX, Li WW, Ran Y, Liu TT, Xiong MG, et al. FAM64A positively regulates STAT3 activity to promote Th17 differentiation and colitis-associated carcinogenesis. Proc Natl Acad Sci USA. 2019;116:10447–52. doi: 10.1073/pnas.1814336116. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Dittrich E, Haft CR, Muys L, Heinrich PC, Graeve L. A di-leucine motif and an upstream serine in the interleukin-6 (IL-6) signal transducer gp130 mediate ligand-induced endocytosis and down-regulation of the IL-6 receptor. J Biol Chem. 1996;271:5487–94. doi: 10.1074/jbc.271.10.5487. [DOI] [PubMed] [Google Scholar]
  • 14.Zohlnhöfer D, Graeve L, Rose-John S, Schooltink H, Dittrich E, Heinrich PC. The hepatic interleukin-6 receptor. Down-regulation of the interleukin-6 binding subunit (gp80) by its ligand. FEBS Lett. 1992;306:219–22. doi: 10.1016/0014-5793(92)81004-6. [DOI] [PubMed] [Google Scholar]
  • 15.Lin H, Li S, Shu HB. The membrane-associated MARCH E3 ligase family: emerging roles in immune regulation. Front Immunol. 2019;10:1751. doi: 10.3389/fimmu.2019.01751. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Liu H, Mintern JD, Villadangos JA. MARCH ligases in immunity. Curr Opin Immunol. 2019;58:38–43. doi: 10.1016/j.coi.2019.03.001. [DOI] [PubMed] [Google Scholar]
  • 17.Lin H, Gao D, Hu MM, Zhang M, Wu XX, Feng L, et al. MARCH3 attenuates IL-1beta-triggered inflammation by mediating K48-linked polyubiquitination and degradation of IL-1RI. Proc Natl Acad Sci USA. 2018;115:12483–8. doi: 10.1073/pnas.1806217115. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Harroch S, Revel M, Chebath J. Induction by interleukin-6 of interferon regulatory factor 1 (IRF-1) gene expression through the palindromic interferon response element pIRE and cell type-dependent control of IRF-1 binding to DNA. EMBO J. 1994;13:1942–9. doi: 10.1002/j.1460-2075.1994.tb06463.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Platanias LC. Mechanisms of type-I- and type-II-interferon-mediated signalling. Nat Rev Immunol. 2005;5:375–86. doi: 10.1038/nri1604. [DOI] [PubMed] [Google Scholar]
  • 20.Fukuda H, Nakamura N, Hirose S. MARCH-III Is a novel component of endosomes with properties similar to those of MARCH-II. J Biochem. 2006;139:137–45. doi: 10.1093/jb/mvj012. [DOI] [PubMed] [Google Scholar]
  • 21.Babon JJ, Stockwell D, DiRago L, Zhang JG, Laktyushin A, Villadangos J, et al. Membrane-associated RING-CH (MARCH) proteins down-regulate cell surface expression of the interleukin-6 receptor alpha chain (IL6Ralpha) Biochem J. 2019;476:2869–82. doi: 10.1042/BCJ20190577. [DOI] [PubMed] [Google Scholar]
  • 22.Garcia-Barcena C, Osinalde N, Ramirez J, Mayor U. How to inactivate human ubiquitin E3 ligases by mutation. Front Cell Dev Biol. 2020;8:39. doi: 10.3389/fcell.2020.00039. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Heinrich PC, Behrmann I, Muller-Newen G, Schaper F, Graeve L. Interleukin-6-type cytokine signalling through the gp130/Jak/STAT pathway. Biochem J. 1998;334:297–314. doi: 10.1042/bj3340297. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Greten FR, Eckmann L, Greten TF, Park JM, Li ZW, Egan LJ, et al. IKKbeta links inflammation and tumorigenesis in a mouse model of colitis-associated cancer. Cell. 2004;118:285–96. doi: 10.1016/j.cell.2004.07.013. [DOI] [PubMed] [Google Scholar]
  • 25.Cui K, Liu C, Li X, Zhang Q, Li Y. Comprehensive characterization of the rRNA metabolism-related genes in human cancer. Oncogene. 2020;39:786–800. doi: 10.1038/s41388-019-1026-9. [DOI] [PubMed] [Google Scholar]
  • 26.Hirata H, Sugimachi K, Komatsu H, Ueda M, Masuda T, Uchi R, et al. Decreased expression of fructose-1,6-bisphosphatase associates with glucose metabolism and tumor progression in hepatocellular carcinoma. Cancer Res. 2016;76:3265–76. doi: 10.1158/0008-5472.CAN-15-2601. [DOI] [PubMed] [Google Scholar]
  • 27.Jones SA, Jenkins BJ. Recent insights into targeting the IL-6 cytokine family in inflammatory diseases and cancer. Nat Rev Immunol. 2018;18:773–89. doi: 10.1038/s41577-018-0066-7. [DOI] [PubMed] [Google Scholar]
  • 28.Tanaka Y, Tanaka N, Saeki Y, Tanaka K, Murakami M, Hirano T, et al. c-Cbl-dependent monoubiquitination and lysosomal degradation of gp130. Mol Cell Biol. 2008;28:4805–18. doi: 10.1128/MCB.01784-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Lei CQ, Zhong B, Zhang Y, Zhang J, Wang S, Shu HB. Glycogen synthase kinase 3beta regulates IRF3 transcription factor-mediated antiviral response via activation of the kinase TBK1. Immunity. 2010;33:878–89. doi: 10.1016/j.immuni.2010.11.021. [DOI] [PubMed] [Google Scholar]
  • 30.Sanjana NE, Shalem O, Zhang F. Improved vectors and genome-wide libraries for CRISPR screening. Nat Methods. 2014;11:783–4. doi: 10.1038/nmeth.3047. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Shalem O, Sanjana NE, Hartenian E, Shi X, Scott DA, Mikkelson T, et al. Genome-scale CRISPR-Cas9 knockout screening in human cells. Science. 2014;343:84–87. doi: 10.1126/science.1247005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Luo WW, Li S, Li C, Lian H, Yang Q, Zhong B, et al. iRhom2 is essential for innate immunity to DNA viruses by mediating trafficking and stability of the adaptor STING. Nat Immunol. 2016;17:1057–66. doi: 10.1038/ni.3510. [DOI] [PubMed] [Google Scholar]
  • 33.Erben U, Loddenkemper C, Doerfel K, Spieckermann S, Haller D, Heimesaat MM, et al. A guide to histomorphological evaluation of intestinal inflammation in mouse models. Int J Clin Exp Pathol. 2014;7:4557–76. [PMC free article] [PubMed] [Google Scholar]
  • 34.Liu J, Lichtenberg T, Hoadley KA, Poisson LM, Lazar AJ, Cherniack AD, et al. An integrated TCGA pan-cancer clinical data resource to drive high-quality survival outcome analytics. Cell. 2018;173:400–16 e411. doi: 10.1016/j.cell.2018.02.052. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Figures (1.4MB, pdf)

Articles from Cellular and Molecular Immunology are provided here courtesy of Nature Publishing Group

RESOURCES