Abstract
Nager syndrome is a rare human developmental disorder characterized by hypoplastic neural crest-derived craniofacial bones and limb defects. Mutations in SF3B4 gene, which encodes a component of the spliceosome, are a major cause for Nager. A review of the literature indicates that 45% of confirmed cases are also affected by conductive, sensorineural or mixed hearing loss. Conductive hearing loss is due to defective middle ear ossicles, which are neural crest derived, while sensorineural hearing loss typically results from defective inner ear or vestibulocochlear nerve, which are both derived from the otic placode. Animal model of Nager syndrome indicates that upon Sf3b4 knockdown cranial neural crest progenitors are depleted, which may account for the conductive hearing loss in these patients. To determine whether Sf3b4 plays a role in otic placode formation we analyzed the impact of Sf3b4 knockdown on otic development. Sf3b4-depleted Xenopus embryos exhibited reduced expression of several pan-placodal genes six1, dmrta1 and foxi4.1. We confirmed the dependence of placode genes expression on Sf3b4 function in animal cap explants expressing noggin, a BMP antagonist critical to induce placode fate in the ectoderm. Later in development, Sf3b4 morphant embryos had reduced expression of pax8, tbx2, otx2, bmp4 and wnt3a at the otic vesicle stage, and altered otic vesicle development. We propose that in addition to the neural crest, Sf3b4 is required for otic development, which may account for sensorineural hearing loss in Nager syndrome.
Keywords: Xenopus, Otic, Hearing loss, Nager, Rodriguez, Sf3b4
Introduction
Nager syndrome (OMIM#154400) is a rare congenital disorder with a little more than 100 cases described in the literature. It is characterized by craniofacial defects including downward slanting of the palpebral fissures, midface retrusion, micrognathia, cleft palate and limb deformities, typically hypoplasia or absence of the thumbs (Wieczorek, 2013; Trainor and Andrews, 2013). Most cases are sporadic, however autosomal dominant and recessive forms of the disease have been reported (Chemke et al. 1988; Nur et al., 2013). Nager syndrome is caused by mutations in the SF3B4 (Splicing factor 3b, subunit 4) gene in 63% of the cases (Bernier et al., 2012; Czeschik et al., 2013; Petit et al., 2013). Rodriguez syndrome (OMIM#201170) is also due to mutations in SF3B4 (Drivas et al., 2019). Rodriguez and Nager syndrome patients have similar craniofacial features, however in Rodriguez syndrome the defects are typically more severe and also include postaxial as well as lower limb defects (Rodriguez et al., 1990). SF3B4 gene encodes SF3B4, a protein component of the spliceosome, the machinery that remove introns from transcribed pre-mRNA (Will and Lührmann, 2011). The mechanisms by which SF3B4 mutations result in these restricted craniofacial and limb defects is not well understood (Beauchamp et al., 2020; Griffin and Saint-Jeannet, 2020).
Nager syndrome patients often have abnormalities of the external ear, auditory canal and middle ear ossicles, which contribute to conductive hearing loss (Petit et al., 2013; Czeschik et al., 2013; Cassina et al., 2017; Likar et al., 2018, Danziger et al, 1990; Aylsworth et al., 1991; Hermann et al., 2005; Davies and Johnson, 2011; Lin, 2012). Interestingly a small number of Nager syndrome patients have been diagnosed with strictly sensorineural (Chemke et al., 1988; Mishra et al., 1999; Battaglia and Magit, 2000; Kumar et al., 2015) or mixed conductive/sensorineural (Czeschik et al., 2013; Hermann et al., 2005) hearing loss suggesting that the etiology of deafness is heterogeneous in this disease. While conductive hearing loss is usually attributed to abnormal development of the first and second pharyngeal arches neural crest-derived middle ear ossicles (reviewed in Minoux and Rijli, 2010), sensorineural hearing loss results from defects to the inner ear or the vestibulocochlear nerve, two structures derived from thickenings of the embryonic head ectoderm, the otic placodes, with a minor contribution from the neural crest (reviewed in Streit, 2001; Whitfield, 2015; Ritter and Martin, 2018).
We have previously shown in an animal model of Nager syndrome that Sf3b4 is required for neural crest formation, and that Sf3b4-depleted Xenopus embryos develop hypoplastic neural crest-derived craniofacial cartilages at the tadpole stage, reminiscent of the craniofacial defects seen in Nager syndrome patients (Devotta et al., 2016). Here we analyze the impact of Sf3b4 knockdown on cranial placode gene expression and otic vesicle development as a possible cause of sensorineural hearing loss in Nager syndrome patients.
Materials and Methods
Xenopus embryos, microinjections and animal cap explants
Xenopus laevis embryos were raised in 0.1X NAM (Normal Amphibian Medium; Slack & Forman, 1980) and staged according to Nieuwkoop and Faber (Nieuwkoop and Faber, 1967). All experiments were conducted in accordance with the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. All procedures were approved by the Institutional Animal Care and Use Committee of New York University (animal protocol #IA16–00052). Beta-galactosidase and noggin mRNAs were synthesized in vitro using the Message Machine Kit (Ambion; Austin, TX). Standard control (CoMO) and Sf3b4 (SF3B4MO; GCCATAACCTGTGAGGAAAAAGAGC; Devotta et al., 2016) morpholino antisense oligonucleotides (MO) were purchased from GeneTools (Philomath, OR). All MOs were injected in one blastomere at 2-cell stage and embryos were analyzed by in situ hybridization (ISH) at the neurula (NF stage 15) or tailbud (NF stage 35) stages. Embryos were co-injected with 500 pg of beta-galactosidase mRNA to identify the injected side. For animal cap explants, both blastomeres at the 2-cell stage were injected in the animal pole region with noggin mRNA (400 pg) alone or in combination with SF3B4MO (10 ng), animal cap explants were dissected at the late blastula stage (NF stage 9) and cultured for 8 hours in 0.5X NAM.
Whole-mount in situ hybridization and histology
Embryos at the appropriate stage were fixed in 4% paraformaldehyde (PFA) and stained for Red-Gal (Research Organics; Cleveland, OH) to visualize the lineage tracer (β-gal mRNA) and processed for ISH. Antisense digoxygenin-labeled probes (Genius kit; Roche, Indianapolis IN) were synthesized using template cDNA encoding six1 (Pandur and Moody, 2000), dmrta1 (Huang et al., 2005), foxi4.1 (Pohl et al., 2002), pax8 (Heller and Brandli, 1999), tbx2 (Hayata et al., 1999), wnt3a (Wolda et al., 1993), bmp4 (Jones et al., 1992), otx2 (Pannese et al., 1995) and ebf2 (Burns and Vetter, 2002). Whole-mount ISH was performed as described (Harland, 1991; Saint-Jeannet, 2017) with minor modifications. For histology, tbx2 stained embryos were embedded in Paraplast+ (Sigma; St Louis, MO), sectioned (12 μm) on an Olympus rotary microtome (Olympus; Waltham, MA), counter stained with Eosin and mounted in Permount (Fisher Scientific; Waltham, MA). The size of the otic vesicle (μm) was determined based on the number of sections (12 μm) required to cut the entire otic vesicle on control side vs. injected side.
qRT-PCR analysis
Total RNAs were extracted from 12 animal cap explants using the RNeasy Micro Kit (Qiagen; Valencia, CA). The RNA samples were digested with RNase-free DNase I before RT-PCR. The amount of RNA isolated was quantified by measuring the optical density using a Nanodrop spectrophotometer (Nanodrop Technologies; Wilmington, DE). The RT-PCR reaction mixture consisted of 10 μl of SYBR Green RT-PCR Master mix (Applied Biosystems; Foster City, CA), 500nM of forward and reverse primers, 1ng of template RNA in total volumes of 10 μl. The reaction was performed on a QuantStudio 3 Real-Time PCR System (Applied Biosystems; Foster City, CA) using primer sets to detect six1, eya1, sox2, krt12.4 and odc (Hong and Saint-Jeannet, 2006).
Statistical Method
Each experiment was performed on at least three different batches of embryos obtained from different females (biological replicates). Gene expression on the Sf3b4MO-injected side was compared to the uninjected side for each embryo, and to CoMO-injected embryos. The data from all biological replicates were pooled for statistical analysis. Significance testing for gene expression by ISH was performed using the Chi-squared test, and for gene expression by qRT-PCR using the Student’s t-test. A p-value of <0.05 was considered significant and analyses were performed using GraphPad Prism 8 (GraphPad Software, San Diego, CA).
Results
Nager syndrome patients are affected by hearing loss
A survey of the scientific literature of confirmed Nager and Rodriguez syndrome patients indicates that approximately 45% of all patients (63/140) exhibit hearing loss in addition of the classic features of the disease, craniofacial and limb defects. That is 54% of patients (36/66) with confirmed SF3B4 mutations (Table 1), and 36% of patients (27/74) who have not been directly linked to a mutation in this gene (Table 2). These numbers are presumably underestimated since information on the hearing status is unknown in 41% (27/66) and 44% (33/74) of the cases with or without SF3B4 mutation, respectively. Among the 63 patients with reported hearing loss (Table 1 and Table 2), the type of hearing loss is categorized as conductive (38%), sensorineural (6%) or mixed (6%), while for the remainder of the patients (49%) the nature of the hearing loss has not been fully characterized. These observations suggest that the cause of deafness is heterogeneous in these patients as conductive hearing loss is typically attributed to abnormal development of the neural crest-derived elements of first and second pharyngeal arches, while sensorineural hearing loss results from defect to the inner ear or the associated vestibulocochlear nerve, which are both derived from the otic placode.
Table 1:
Incidence of hearing loss in Nager and Rodriguez syndrome patients with SF3B4 mutation/deletion.
| Nager syndrome cases with SF3B4 mutation/deletion | Number of patients | Hearing status unknown | Normal hearing | Uncategorized hearing loss | Conductive hearing loss | Sensorineural hearing loss |
|---|---|---|---|---|---|---|
| Rodriguez et al., 1989 | 1** | 1 | - | - | - | - |
| Waggoner et al., 1999 | 1 | 1 | - | - | - | - |
| Wessels et al., 2002 | 1** | 1 | - | - | - | - |
| Sermer et al. 2007 | 1** | 1 | - | - | - | - |
| Bernier et al., 2012 | 25 | 6 | - | 19 | - | - |
| Czeschik et al., 2013 | 7 | 2 | 1 | - | 2 | 2* |
| Petit et al., 2013 | 13 | 4 | 2 | 1 | 6 | - |
| Castori et al., 2014 | 1 | 1 | - | - | - | - |
| McPherson et al., 2014 | 1 | 1 | - | - | - | - |
| Bellanger et al., 2015 | 1 | - | - | 1 | - | - |
| Lund et al., 2016 | 1 | 1 | - | - | - | - |
| Marques et al., 2016 | 3 | 3 | - | - | - | - |
| Cassina et al., 2017 | 1 | - | - | - | 1 | - |
| Denu and Burkard, 2017 | 1 | - | - | 1 | - | - |
| Drivas et al., 2018 | 1 | - | - | 1 | - | - |
| Likar et al. 2018 | 1 | - | - | - | 1 | - |
| Hayata et al., 2019 | 1 | - | - | 1 | - | - |
| Zerounian et al., 2019 | 1 | 1 | - | - | - | - |
| Jourdain et al. 2019 | 1 | 1 | - | - | - | - |
| Drozniewska et al., 2020 | 1 | 1 | - | - | - | - |
| Zhao and Yang, 2020 | 1 | 1 | - | - | - | - |
| Bukowska-Olech et al. 2020 | 1 | 1 | - | - | - | - |
| TOTAL | 66 | 27 | 3 | 24 | 10 | 2 |
Indicate patients affected by both conductive and sensorineural (mixed) hearing loss.
Patient sequenced by Irving et al., (2016).
Table 2:
Incidence of hearing loss in Nager and Rodriguez syndrome patients with unconfirmed SF3B4 mutation.
| Nager syndrome cases with unconfirmed SF3B4 mutation | Number of patients | Hearing status unknown | Normal hearing | Uncategorized hearing loss | Conductive hearing loss | Sensorineural hearing loss |
|---|---|---|---|---|---|---|
| Kawira et al., 1984 | 2 | 2 | - | - | - | - |
| Hecht et al., 1987 | 1 | 1 | - | - | - | - |
| Chemke et al., 1988 | 2 | 1 | - | - | - | 1 |
| Goldstein and Mirkin, 1988 | 1 | 1 | - | - | - | - |
| Rodriguez et al., 1989 | 2 | 2 | - | - | - | - |
| Danziger et al, 1990 | 1 | - | - | - | 1 | - |
| Aylsworth et al., 1991 | 5 | 2 | - | 1 | 2 | - |
| Zori et al., 1992 | 1 | 1 | - | - | - | - |
| Mishra et al., 1999 | 1 | - | - | - | - | 1 |
| Battaglia and Magit, 2000 | 3 | 1 | 1 | - | - | 1 |
| Groeper et al., 2002 | 1 | - | - | 1 | - | - |
| Kavadia et al., 2003 | 1 | - | - | - | - | - |
| Herrmann et al., 2005 | 11 | 1 | - | - | 8 | 2* |
| Dimitrov et al., 2005 | 1** | 1 | - | - | - | - |
| Miyawaki et al., 2009 | 1 | 1 | - | - | - | - |
| Davies and Johnson, 2011 | 1 | - | - | - | 1 | - |
| Lin, 2012 | 1 | - | - | - | 1 | - |
| Abdollahi Fakhim et al., 2012 | 1 | - | - | 1 | - | - |
| Bernier et al., 2012 | 16 | 16 | - | - | - | - |
| Czeschik et al., 2013 | 5 | 5 | - | - | - | - |
| Petit et al., 2013 | 5 | 1 | 1 | 2 | 1 | - |
| Nur et al., 2013 | 1 | 1 | - | - | - | - |
| Malik et al., 2014 | 1 | - | - | 1 | - | - |
| Bozathoglu and Muenevveroglu, 2015 | 1 | - | - | 1 | - | - |
| Kumar et al., 2015 | 1 | - | - | - | - | 1 |
| Rosa et al., 2015 | 1 | 1 | - | - | - | - |
| Ural and Ceylander, 2016 | 1 | 1 | - | - | - | - |
| Wu et al., 2017 | 2 | 2 | - | - | - | - |
| Tay et al., 2017 | 2 | 2 | - | - | - | - |
| Rai et al., 2017 | 1 | - | 1 | - | - | - |
| TOTAL | 74 | 33 | 3 | 7 | 14 | 6 |
Indicate patients affected by both conductive and sensorineural (mixed) hearing loss.
Patient sequenced by Irving et al., (2016).
Sf3b4 depletion alters cranial placode gene expression
Cranial placode progenitors arise from a common domain anteriorly, known as the pre-placodal region (PPR). Over time this domain is further subdivided to give rise to the specialized paired sensory organs, the adenohypophysis and cranial ganglia (Schlosser, 2010; Grocott et al., 2012; Saint-Jeannet and Moody, 2014). To evaluate a potential role of Sf3b4 in cranial placode formation we used a well-characterized morpholino antisense oligonucleotide (Sf3b4MO; Devotta et al., 2016) to knockdown Sf3b4 function in Xenopus embryos. Unilateral injection of increasing doses of Sf3b4MO (2 ng to 20 ng) resulted in a marked reduction of six1 and dmrta1 expression, two genes expressed in the PPR at the neurula stage (Fig 1a). This effect was dose-dependent (Fig 1b), and we selected the dose of 10 ng for further analyses.
Figure 1: Sf3b4 knockdown affects six1 and dmrta1 expression at the neurula stage.

(a) Unilateral injection of increasing doses of Sf3b4MO (2 ng-20 ng) interfere with six1 and dmrta1 expression. RNA encoding the lineage tracer β-galactosidase was co-injected with Sf3b4MO to identify the injected side (red staining, right side in all panels). The arrows point to the affected placode areas. Anterior views, dorsal to top. (b) Quantification of six1 and dmrta1 ISH results. The numbers on the top of each bar indicate the number of embryos analyzed from three independent experiments.
We expanded our analysis to include a larger repertoire of genes, including foxi4.1, a factor broadly expressed at the PPR, and pax8, which is primarily restricted to the otic placode, the precursor of the inner ear (Schlosser and Ahrens 2004). Both genes were downregulated in a majority of Sf3b4-depleted embryos, while injection of a control MO (CoMO) at the same concentration had no impact on the expression of these genes (Fig 2a, b).
Figure 2: Sf3b4 knockdown affects a broad range of placode genes.

(a) Unilateral injection of Sf3b4MO (10 ng) interfere with six1, dmrta1, foxi4.1 and pax8 expression. RNA encoding the lineage tracer β-galactosidase was co-injected with Sf3b4MO to identify the injected side (red staining, right side in all panels). The arrows point to the affected placode areas. pax8 is also expressed posteriorly in the prospective pronephros (asterisks). Anterior views, dorsal to top. (b) Quantification of the ISH results. The numbers on the top of each bar indicate the number of embryos analyzed from at least three independent experiments. Injection of a CoMO at the same concentration (10 ng) had no impact of the expression of these genes. *** p<0.0001, Chi-squared test.
Sf3b4 is required for placode gene induction by noggin
To confirm Sf3b4 requirement for cranial placode gene expression we used an animal cap explant assay and qRT-PCR (Fig 3a). In this preparation attenuation of bone morphogenetic protein (BMP) signaling promotes cranial placode and neural plate fates (Brugmann and al., 2004; Hong and Saint-Jeannet, 2007). In these explants, placode (six1 and eya1) and neural plate (sox2) gene induction by the BMP antagonist Noggin was significantly repressed by co-injection of Sf3b4MO (Fig 3b). Sf3b4-depletion in noggin-injected explants was associated with an increase in krt12.4 expression (Fig 3b), characteristic of the default epidermal fate of these explants. Altogether these results indicate that in the embryos and in animal cap explants Sf3b4 is required for pan-placodal and neural plate gene expression.
Figure 3: Placode genes induction by noggin require Sf3b4.

(a) Animal cap explants dissected from blastula stage embryos (NF stage 9) injected at the 2-cell stage with noggin mRNAs alone or in combination with Sf3b4MO were cultured for 8 hours. (b) qRT-PCR analyses indicate that Sf3b4MO blocks placode (six1 and eya1) and neural plate (sox2) gene induction by Noggin in animal cap explants, and restores epidermal fate (krt12.4). Values are normalized to odc and presented as mean ± s.e.m.; (*) p < 0.05 and (**) p < 0.001 (Student’s t-test), from three independent samples.
Sf3b4 depletion alters otic vesicle gene expression and development
To further characterize the phenotype of Sf3b4-depleted embryos we have analyzed the expression of pax8, tbx2, wnt3a, bmp4 and otx2 at the otic vesicle stage (NF stage 35). pax8 and and tbx2 are broadly expressed throughout the otic vesicle, otx2 and wnt3a are confined ventrally and dorsally, respectively, while bmp4 is restricted to the anterior and posterior domains of the otic vesicle (Fig 4a; Saint-Germain et al., 2004). Embryos were injected with Sf3b4MO (10 ng) and analyzed by ISH at stage 35. All five genes were greatly reduced upon Sf3b4-depletion in the majority of the embryos examined (Fig 4b,c), suggesting that otic vesicle development was defective. Interestingly, the penetrance of the phenotype was higher at this stage than observed at the neurula stage. One interpretation is that subtle differences in gene expression levels that could not be fully assessed visually at an early stage may still have long-term consequences on otic vesicle development.
Figure 4: Sf3b4 knockdown affects otic vesicle gene expression.

(a) Schematic representation of the expression pattern of pax8, tbx2, wnt3a, bmp4, and otx2 in the epithelium of the otic vesicle of NF stage 35 embryos. A, anterior; P posterior; D, dorsal; V, ventral. (b) In embryos injected with 10 ng of Sf3b4MO the regional otic expression of pax8, tbx2, wnt3a, bmp4, and otx2 is disrupted. RNA encoding the lineage tracer β-galactosidase was co-injected with Sf3b4MO to identify the injected side (red staining). The black arrows point to the otic expression of each gene on the control side and the white arrows to the corresponding affected areas on the Sf3b4MO-injected side. For orientation, the position of the eye is indicated (asterisks). Lateral views, anterior to left, dorsal to top. (c) Quantification of the ISH results. The numbers on the top of each bar indicate the number of embryos analyzed from three independent experiments.
We next analyzed by histology the morphology of the otic vesicle of these animals, by comparing the size of the otic vesicles on the Sf3b4MO-injected versus control side of tbx2 stained embryos. We found that the majority of the embryos had an overall reduction of the otic vesicle size on the injected side by approximately 40% (Fig 5a,b). These results point to Sf3b4 as an important regulator of otic vesicle development.
Figure 5: Sf3b4 knockdown affects otic vesicle development.

(a) Serial sections (#1-anterior to #14-posterior) through a representative tbx2-stained embryo (NF stage 35) injected with 10 ng of Sf3b4MO. On the injected side (left side; double arrows), the size of the otic vesicle is reduced as compared to the control side (right side; single arrows). (b) The size of the otic vesicle (μm) was determined based on the number of sections (12 μm) required to cut the entire otic vesicle on control vs. injected sides. On average this represents 11.33 sections or 136 μm (control) vs. 6.77 sections or 81.33 μm (Sf3b4MO-injected). * p < 0.05 (Unpaired t-test with Welch’s correction), n=9.
Sf3b4 depletion affects olfactory placode gene expression
While information on olfactory defects remains largely undocumented in Nager syndrome patients we expanded our analysis to evaluate the impact of Sf3b4 knockdown on genes expressed in the developing olfactory epithelium namely dmrta1, ebf2 and six1. Interestingly, the expression of these genes was also disrupted in morphant embryos (Fig 6a,b) consistent with a potential role of Sf3b4 in the development of other cranial placode derivatives in addition to the prospective inner ear.
Figure 6: Sf3b4 knockdown affects olfactory gene expression.

(a) Unilateral injection of Sf3b4MO (10 ng) interferes with dmrta1, ebf2 and six1 expression. RNA encoding the lineage tracer β-galactosidase was co-injected with Sf3b4MO to identify the injected side (red staining, right side in all panels). The arrows point to reduce gene expression in the olfactory epithelium. (b) Quantification of the ISH results. The numbers on the top of each bar indicate the number of embryos analyzed from two independent experiments. Injection of a CoMO at the same concentration (10 ng) had no impact of the expression of these genes. *** p<0.0001, Chi-squared test.
Discussion
Here we present evidence that the splicing factor Sf3b4 is required for otic placode gene expression and development in Xenopus embryos, this is in addition to its well-documented role in neural crest formation (Devotta et al, 2016), and we propose that this activity may account for sensorineural deafness in Nager syndrome patients carrying mutations in SF3B4. Our results also suggest that Sf3b4 may have a broader function in the formation of cranial placodes and their derivatives, as several pan-placodal as well as olfactory placode genes are also disrupted upon Sf3b4 knockdown.
The primary cause of Nager syndrome is haploinsufficiency of SF3B4 (Bernier et al., 2012; Czeschik et al., 2013; Petit et al., 2014). This syndrome is characterized by limb defects and mandibulofacial dysostosis (MFD). MFD is a condition affecting neural crest-derived craniofacial skeletal elements arising from the first and second pharyngeal arches (Passos-Bueno et al., 2009; Wieczoreck, 2013). In the first pharyngeal arch, the maxillary prominence forms the maxillary, zygomatic and temporal bones, while the mandibular prominence forms the middle ear bones, malleus and incus, and the mandible. The second pharyngeal arch gives rise to the third middle ear ossicle, stapes, styloid process and the lesser horn of the hyoid. All these structures are defective to varying degrees in Nager syndrome, and a subset of these patients is affected by hearing loss (Table 1 and Table 2). The most common form of deafness among these patients is conductive hearing loss, which is typically due to defect to the middle ear ossicles preventing the proper transmission of the sound to the inner ear.
A mouse model of MFD indicates that this condition is caused by an early depletion of neural crest progenitors through mechanisms involving increased apoptosis and reduced proliferation (Dixon et al., 2006; Jones and et al., 2008). Similarly, we have previously shown that Sf3b4-depleted Xenopus embryos show increased apoptosis in the ectoderm, leading to a reduction in neural crest progenitors, and subsequent development of hypoplastic craniofacial cartilages (Devotta et al., 2016). It is therefore likely that the depletion of neural crest progenitors is also the underlying cause for conductive hearing loss in Nager syndrome patients since the middle ear bones are neural crest derived.
Because a number of Nager syndrome patients also present with sensorineural hearing loss (Table 1 and Table 2), which is typically due to defect to the inner ear or the associated vestibulocochlear nerve, we posited that other ectoderm derivatives, in addition to the neural crest, might be affected by a similar process upon Sf3b4 knockdown. Indeed we found a significant decrease in the expression of several otic-specific genes associated with a reduction in the size of the otic vesicle in Sf3b4 depleted Xenopus embryos. The requirement of Sf3b4 for placode gene expression was also confirmed in an animal cap assay. Therefore we propose that defective otic placode formation and inner ear development is the likely culprit in Nager syndrome patients suffering from sensorineural hearing loss. Future studies will determine the long-term consequences of Sf3b4 knockdown and the extent to which the functional components of the inner ear are affected.
Nager syndrome belongs to a category of diseases known as spliceosomopathies resulting from mutations in genes encoding components of the spliceosome (reviewed in Beauchamp et al., 2020; Griffin and Saint-Jeannet, 2020). Interestingly, mutations in other splicing factors encoding genes such as EFTUD2, SNRPB and TXNL4A also cause MFD in three related syndromes, mandibulofacial dysostosis with microcephaly (MFDM; OMIM#610536; Lines et al., 2012), cerebrocostomandibular syndrome (CCMS; OMIM#117650; Lynch et al., 2014) and Burn-McKeown Syndrome (BMKS; OMIM#608572; Wieczorek et al., 2014), respectively (reviewed in Lehalle et al., 2015; Beauchamp et al., 2020). A number of MFDM, CCMS and BMKS patients have also been diagnosed with hearing loss, and a subset of these patients had confirmed sensorineural hearing loss at least in the case of MFDM (Lines et al., 2012; Gordon et al., 2014). This suggest that the etiology of deafness is heterogeneous across multiple craniofacial spliceosomopathies, and that mutations in proteins of the spliceosome affect at least two major embryonic cell populations the neural crest and cranial placodes. While the spliceosome is presumably active in all cells of the organism, the cell type specificity of these spliceosomopathies is still poorly understood (Griffin and Saint-Jeannet, 2020).
Sf3b4-depleted Xenopus embryo is the only animal model available so far to investigate the pathogenesis of Nager syndrome (Devotta et al., 2016). In the mouse, homozygous Sf3b4 mutation is embryonic lethal, and heterozygous mutants have a relatively mild phenotype characterized by anterior-posterior patterning defects of the axial skeleton (Yamada et al., 2020). The lack of a distinctive craniofacial phenotype in these animals could be explained by compensation by another component of the Sf3b complex. Typically a high level of redundancy is observed in murine gene families, but not as much in Xenopus. Alternatively it is also possible that reducing Sf3b4 by half its normal levels may not be sufficient to affect neural crest formation in mice.
Highlights.
Nager syndrome is a human craniofacial disorder due to mutation in SF3B4.
A subset of Nager syndrome patients is also affected by hearing loss.
Sf3b4-depleted Xenopus embryos have altered otic gene expression.
This effect may account for conductive hearing loss in human patients.
Acknowledgements
We are grateful to Mr. Chibuike Ihewulezi for technical help, Dr. Aditi Dubey for her assistance with GraphPad analysis and members of the lab for discussions. The work benefited from the support of Xenbase (http://www.xenbase.org/ - RRID:SCR_003280) and the National Xenopus Resource (http://mbl.edu/xenopus/ - RRID:SCR_013731).
Funding
The work was supported by a grant from the National Institutes of Health to J-P-S-J (R01DE025468).
Footnotes
Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Competing Interests
The authors declare no competing interests.
References
- Abdollahi Fakhim S, Shahidi N, & Mousaviagdas M (2012). A case report: nager acrofacial dysostosis. Iranian Journal of Otorhinolaryngology, 24(66), 45–50. [PMC free article] [PubMed] [Google Scholar]
- Aylsworth AS, Lin AE, & Friedman PA (1991). Nager acrofacial dysostosis: Male-to-male transmission in 2 families. American Journal of Medical Genetics Part C: Seminars in Medical Genetics 41, 83–88. [DOI] [PubMed] [Google Scholar]
- Battaglia A, & Magit A (2000). Nager acrofacial dysostosis with autosomal dominant inheritance: implications for the otolaryngologist. Otolaryngology-Head and Neck Surgery 123, 276–277. [DOI] [PubMed] [Google Scholar]
- Beauchamp MC, Alam SS, Kumar S & Jerome-Majewska LA (2020). Spliceosomopathies and neurocristopathies: two sides of the same coin? Developmental Dynamics, 249, 924–945. [DOI] [PubMed] [Google Scholar]
- Bellanger C, Villedieu F, Gerard M & Guillois B (2015). Nager syndrome associated with tetralogy of Fallot: a frequent association? Archives de Pediatrie 22, 974–977. [DOI] [PubMed] [Google Scholar]
- Bernier FP, Caluseriu O, Ng S, Schwartzentruber J, Buckingham KJ, Innes AM, et al. (2012). Haploinsufficiency of SF3B4, a component of the pre-mRNA spliceosomal complex, causes Nager syndrome. American Journal of Human Genetics 90, 925–933. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bozatlioglu R, & Munevveroglu AP (2015). Dental management of a pa- tient with Nager acrofacial dysostosis. Case Rep Dent 2015, 984732. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Brugmann SA, Pandur PD, Kenyon KL, Pignoni F and Moody SA (2004). Six1 promotes a placodal fate within the lateral neurogenic ectoderm by functioning as both a transcriptional activator and repressor. Development 131, 5871–5881. [DOI] [PubMed] [Google Scholar]
- Bukowska-Olech E, Materna-Kiryluk A, Walczak-Sztulpa J, Popiel D, Badura-Stronka M, Koczyk G, Dawidziuk A & Jamsheer A (2020) Targeted Next-Generation Sequencing in the Diagnosis of Facial Dysostoses. Front. Genet 11:580477. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Burns CJ and Vetter ML (2002). Xath5 regulates neurogenesis in the Xenopus olfactory placode. Developmental Dynamics 225, 536–543. [DOI] [PubMed] [Google Scholar]
- Cassina M, Cerqua C, Rossi S, et al. (2017). A synonymous splicing mutation in the SF3B4 gene segregates in a family with highly variable Nager syndrome. Eur J Human Genet. 25, 371–375. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Castori M, Bottillo I, D’Angelantonio D et al. (2014). A 22-week-old fetus with Nager syndrome and congenital diaphragmatic hernia due to a novel SF3B4 mutation. Mol Syndromol. 2014;5(5): 241–244. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Chemke J, Mogilner BM, Ben-Itzhak I, Zurkowski L, & Ophir D (1988). Autosomal recessive inheritance of Nager acrofacial dysostosis. Journal of Medical Genetics, 25(4), 230–232. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Czeschik JC, Voigt C, Alanay Y, Albrecht B, Avci S, Fitzpatrick D, et al. (2013). Clinical and mutation data in 12 patients with the clinical diagnosis of Nager syndrome. Human Genetics 132(8), 885–898. [DOI] [PubMed] [Google Scholar]
- Danziger I, Brodsky L, Perry R, Nusbaum S, Bernat J & Robinson L (1990). Nager’s acrofacila dysostosis. Case reprot and review of the literature. International Journmal of Pediatric Otorhinolaryngology 20, 225–240. [DOI] [PubMed] [Google Scholar]
- Davies GP, & Johnson IJM (2011). The first reported treatment of Nager syndrome associated hearing loss with bone-anchored hearing aids: case report. The Journal of Laryngology & Otology 126 (01), 76–78. [DOI] [PubMed] [Google Scholar]
- Denu RA & Burkard ME (2017). Synchronous bilateral breast cancer in a patient with Nager syndrome. Clinical Breast Cancer 17, e151–153 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Devotta A, Juraver-Geslin H, Gonzalez JA, Hong C-S, & Saint-Jeannet J-P (2016). Sf3b4-depleted Xenopus embryos: A model to study the pathogenesis of craniofacial defects in Nager syndrome. Developmental Biology 415(2), 371–382. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Dimitrov B, Balokova I, Jekova N, Vakrilova L, Fryns JP. & Simeonov E (2005). Acrofacial dysostosis type Rodriguez. American Journal of Medical Genetics 135A, 81–85. [DOI] [PubMed] [Google Scholar]
- Dixon J, Jones NC, Sandell LL, Jayasinghe SM, Crane J, Rey J-P, Dixon M & Trainor PA (2006). Tcof1/Treacle is required for neural crest cell formation and proliferation deficiencies that cause craniofacial abnormalities. Proc. Natl. Acad. Sci. USA 103, 13403–13408. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Drivas TG, Taylor JA & Zackai EH (2019). The final demise of Rodriguez lethal acrofacial dysostosis: a case report and review of the literature. American Journal of Medical Genetics 179A, 1063–1068. [DOI] [PubMed] [Google Scholar]
- Drozniewska M, Kilby MD, Vogt J et al. (2020). Second-trimester prenatal diagnosis of Nager syndrome with a deletion including SF3B4 detected by chromosomal microarray. Clin Case Rep. 8, 508–511. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Freyer L, Aggarwal V, & Morrow BE (2011). Dual embryonic origin of the mammalian otic vesicle forming the inner ear. Development, 138(24), 5403–5414. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Goldstein DJ, & Mirkin LD (1988). Nager acrofacial dysostosis: evidence for apparent heterogeneity. American Journal of Medical Genetics Part C: Seminars in Medical Genetics, 30(3), 741–746. [DOI] [PubMed] [Google Scholar]
- Gordon CT, Petit F, Oufadem M, et al. EFTUD2 haploinsufficiency leads to syndromic oesophageal atresia. J Med Genet. 2012;49(12):737–746. [DOI] [PubMed] [Google Scholar]
- Griffin C & Saint-Jeannet J-P (2020). Spliceosomopathies: diseases and mechanisms. Developmental Dynamics 249, 1038–1046. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Groeper K, Johnson JO, Braddock SR, & Tobias JD (2002). Anaesthetic implications of Nager syndrome. Paediatric Anaesthesia, 12(4), 365–368. [DOI] [PubMed] [Google Scholar]
- Jourdain AS, Petit F, Odou MF, Balduyck M, Brunelle P, Dufour W, Boussion S, Brischoux-Boucher E, Colson C, Dieux A, Gérard M, Ghoumid J, Giuliano F, Goldenberg A, Khau van Kien P, Lehalle D, Morin G, Moutton S, Smol T, Vanlerberghe C, Manouvier-Hanu S & Escande F (2020). Multiplex targeted high‐ throughput sequencing in a series of 352 patients with congenital limb malformations. Human Mutation 41, 222–239. [DOI] [PubMed] [Google Scholar]
- Harland RM (1991). In situ hybridization: an improved whole-mount method for Xenopus embryos. Methods in Cell Biology, 36, 685–695. [DOI] [PubMed] [Google Scholar]
- Hayata T, Kuroda H, Eisaki A & Asashima M (1999). Expression of the Xenopus T-box transcription factor, Tbx2 in Xenopus embryo. Dev. Genes Evol 209, 625–628. [DOI] [PubMed] [Google Scholar]
- Hayata K, Masuyama H, Eto E, Mitsui T, Tamada S, Eguchi T, Maki J, Tani K, Ohira A, Washio Y, Yoshimoto J & Hasegawa K (2019). A case of Nager syndrome diagnosed before birth. Acta Medica Okayama 73(3), 273–277. [DOI] [PubMed] [Google Scholar]
- Hecht JT, Immken LL, Harris LF, Malini S, & Scott CI (1987). The Nager syndrome. American Journal of Medical Genetics Part C: Seminars in Medical Genetics, 27(4), 965–969. [DOI] [PubMed] [Google Scholar]
- Heller N & Brandli AW (1999). Xenopus Pax-2/5/8 orthologues: novel insights into Pax gene evolution and identification of Pax-8 as the earliest marker for otic and pronephric cell lineages. Dev. Gen 24, 208–219. [DOI] [PubMed] [Google Scholar]
- Herrmann BW, Karzon R, & Molter DW (2005). Otologic and audiologic features of Nager acrofacial dysostosis. International Journal of Pediatric Otorhinolaryngology, 69(8), 1053–1059. [DOI] [PubMed] [Google Scholar]
- Hong C-S & Saint-Jeannet J-P (2007). The activity of Pax3 and Zic1 regulates three distinct cell fates at the neural plate border. Mol. Biol. Cell 18, 2192–2202. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Huang X, Hong C-S, O’Donnell M, & Saint-Jeannet J-P (2005). The doublesex-related gene, XDmrt4, is required for neurogenesis in the olfactory system. Proc. Natl. Acad. Sci. U.S.a, 102(32), 11349–11354. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Irving MD, Dimitrov BI, Wessels M, Holder-Espinasse M, Chitayat D & Simpson MA (2016). Rodriguez acrofacial dysostosis is caused by apparently de novo heterozygous mutations in the SF3B4 gene. Am J Med Genet A. 170, 3133–3137. [DOI] [PubMed] [Google Scholar]
- Jones CM, Lyons KM, Lapan PM, Wright CVE & Hogan BLM (1992). DVR-4 (Bone Morphogenetic Protein-4) as a posterior-ventralizing factor in Xenopus mesoderm induction. Development 115, 639–647. [DOI] [PubMed] [Google Scholar]
- Jones NC, Lynn ML, Gaudenz K, Sakai D, Aoto K, Rey JP, Glynn EF, Ellington L, Du C, Dixon J, Dixon MJ, & Trainor PA (2008). Prevention of the neurocristopathy Treacher Collins syndrome through inhibition of p53 function. Nature Medicine 14, 125–133. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kavadia S, Kaklamanos EG, Antoniades K, Lafazanis V & Tramma D (2004). Nager syndrome (preaxial acrofacial dysostosis): a case report. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 97, 732–738. [DOI] [PubMed] [Google Scholar]
- Kawira EL, Weaver DD & Bender HA (1984). Acrofacial dysostosis with severe facial clefting and limb reduction. American Journal of Medical Genetics 17, 641–647. [DOI] [PubMed] [Google Scholar]
- Kumar MH, Kumar MS, Kumar VS & Kumar SH (2015). Nager acrofacial dysostosis: a rare genetic disorder causing bilateral temperomandibular joint ankylosis in a 10-year-old girl. BMJ Case Rep, doi: 10.1136/bcr-2015-212949. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lehalle D, Wieczorek D, Zechi-Ceide RM, Passos-Bueno MR, Lyonnet S, Amiel J, & Gordon CT (2015). A review of craniofacial disorders caused by spliceosomal defects. Clinical Genetics, 88(5), 405–415. [DOI] [PubMed] [Google Scholar]
- Likars T, Hasanhodzic M, Teran N, Maver A, Peterlin B & Writzl K (2018). Diagnostic outcomes of exome sequencing in patients with syndromic or non-syndromic hearing loss. PLoS ONE 13(1): e0188578. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lin J-L (2012). Nager Syndrome: A Case Report. Pediatrics & Neonatology, 53(2), 147–150. [DOI] [PubMed] [Google Scholar]
- Lines M, Huang L, Schwartzentruber J et al. (2012). Haploinsufficiency of a spliceosomal GTPase encoded by EFTUD2 causes mandibulofacial dysostosis with microcephaly. Am. J. Hum. Genet 90, 369–377. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lund IC, Vestergaard EM, Christensen R, Uldbjerg N & Becher N (2016). Prenatal diagnosis of Nager syndrome in a 12-week-old fetus with a whole gene deletion of SF3B4 by chromosomal microarray. Eur J Med Genet. 259, 48–51. [DOI] [PubMed] [Google Scholar]
- Lynch DC, Revil T, Schwartzentruber J et al. (2014) Disrupted auto-regulation of the spliceosomal complex gene SNRPB causes cerebro-costo-mandibular syndrome. Nat. Commun 5, 4483 doi: 10.1038/ncomms5483. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Malik R, Goel S & Aggarwal S (2014). Limbal dermoid in Nager acrofacial dysostosis: a rare case report. Indian Journal of Ophthalmology 62, 339–341. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Marques F, Tenney J, Duran I, et al. (2016). Altered mRNA splicing, chondrocyte gene expression and abnormal skeletal development due to SF3B4 mutations in Rodriguez acrofacial dysostosis. PLoS Genet. 12(9):e1006307. [DOI] [PMC free article] [PubMed] [Google Scholar]
- McPherson E, Zaleski C, Ye Z, Lin S. (2014). Rodriguez syndrome with SF3B4 mutation: a severe form of Nager syndrome? Am J Med Genet Part A. 164a, 1841–1845 [DOI] [PubMed] [Google Scholar]
- Minoux M, & Rijli FM (2010). Molecular mechanisms of cranial neural crest cell migration and patterning in craniofacial development. Development, 137(16), 2605–2621. [DOI] [PubMed] [Google Scholar]
- Mishra A, Shukla GK, & Bhatia N (1999). A.B.R. in Nager type acrofacial dysostosis syndrome. Indian Journal of Otolaryngology and Head & Neck Surgery, 51(3), 45–49. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Miyawaki M, Higuchi R & Yoshikawa N (2009). Rodriguez lethal acrofacial dysostosis syndrome with pulmonary hypoplasia. Pediatrics International 51(4), 593–595. [DOI] [PubMed] [Google Scholar]
- Nieuwkoop PD & Faber J (1956). Normal table of Xenopus laevis (Daudin). Amesterdam: North-Holland Publishing Co. [Google Scholar]
- Nur BG, Bernier FP, Oztekin O, Kardelen F, Kalay S, Parboosingh JS, & Mihci E (2013). Possible autosomal recessive inheritance in an infant with acrofacial dysostosis similar to Nager syndrome. American Journal of Medical Genetics Part A, 161A(9), 2311–2315. [DOI] [PubMed] [Google Scholar]
- Paladini D, Tartaglione A, Lamberti A, Lapadula C, & Martinelli P (2003). Prenatal ultrasound diagnosis of Nager syndrome. Ultrasound in Obstetrics & Gynecology, 21(2), 195–197. [DOI] [PubMed] [Google Scholar]
- Pandur PD, & Moody SA (2000). Xenopus Six1 gene is expressed in neurogenic cranial placodes and maintained in the differentiating lateral lines. 96(2), 253–257. [DOI] [PubMed] [Google Scholar]
- Pannese M, Polo C, Andreazzoli M, Vignali R, Kablar B, Barsacchi G, & Boncinelli E (1995). The Xenopus homologue of Otx2 is a maternal homeobox gene that demarcates and specifies anterior body regions. Development 121, 707–720. [DOI] [PubMed] [Google Scholar]
- Passos-Bueno MR, Ornelas CC and Fanganiello RD (2009). Syndromes of the first and second pharyngeal arches: A Review. Am. J. Med. Genet. Part A 149, 1853–1859. [DOI] [PubMed] [Google Scholar]
- Petit F, Escande F, Jourdain AS, Porchet N, Amiel J, Doray B, et al. (2013). Nager syndrome: confirmation of SF3B4haploinsufficiency as the major cause. Clinical Genetics, 86(3), 246–251. [DOI] [PubMed] [Google Scholar]
- Pohl BS, Knochel S, Dillinger K & Knochel W (2002). Sequence and expression of FoxB2 (XFD-5) and FoxI1c (XFD-10) in Xenopus embryogenesis. Mech. Dev 117, 283–287. [DOI] [PubMed] [Google Scholar]
- Rai A, Nandimath K, Sattur A & Naikmasur V (2013). Nager′s acrofacial dysostosis. Journal of Orofacial Sciences, 5(2), 138. [Google Scholar]
- Ritter KE & Martin DM (2018). Neural crest contributions to the ear: Implications for congenital hearing disorders. Hearing Research 376, 22–32. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Rodríguez JI, Palacios J & Urioste M (1990). New acrofacial dysostosis syndrome in 3 sibs. American Journal of Medical Genetics 35, 484–489. [DOI] [PubMed] [Google Scholar]
- Rosa RF, Guimaraes VB, Beltrao LA et al. (2015) Nager syndrome and Pierre Robin sequence. Pediatr Int 57, 69–72. [DOI] [PubMed] [Google Scholar]
- Saint-Germain N, Lee Y-H, Zhang Y, Sargent TD & Saint-Jeannet J-P (2004). Specification of the otic placode depends on Sox9 function in Xenopus. Development 131, 1755–1763. [DOI] [PubMed] [Google Scholar]
- Saint-Jeannet J-P (2017). Whole-Mount In Situ Hybridization of Xenopus Embryos. Cold Spring Harbor Protocols, 2017(12), pdb.prot097287. [DOI] [PubMed] [Google Scholar]
- Schlosser G, Ahrens K, 2004. Molecular anatomy of placode development in Xenopus laevis. Dev. Biol 271, 439–466. [DOI] [PubMed] [Google Scholar]
- Sermer D, Quercia N, Chong K & Chitayat D (2007). Acrofacial dysostosis syndrome type Rodriguez: prenatal diagnosis and autopsy findings. American Journal of Medical Genetics 143A, 3286–3289. [DOI] [PubMed] [Google Scholar]
- Slack JM, & Forman D (1980). An interaction between dorsal and ventral regions of the marginal zone in early amphibian embryos. Journal of Embryology and Experimental Morphology, 56, 283–299. [PubMed] [Google Scholar]
- Streit A (2001). Origin of the vertebrate inner ear: evolution and induction of the otic placode. Journal of Anatomy, 199(1–2), 99–103. 10.1046/j.1469-7580.2001.19910099. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Tay SY, Loh WS & Lim TC (2017). A case report of absemnt epiglottis in children with Nager syndrome: its impact n swallowing. Cleft Palate-Craniofacial Journal 54, 754–757. [DOI] [PubMed] [Google Scholar]
- Trainor PA, & Andrews BT (2013). Facial dysostoses: Etiology, pathogenesis and management. American Journal of Medical Genetics Part C: Seminars in Medical Genetics, 163(4), 283–294. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ural UM & Ceylander S (2016) Rodriguez lethal acrofacial dysostosis syndrome with ambiguous genitalia. Taiwanese Journal of Obstetrics & Gynecology 55, 613–615. [DOI] [PubMed] [Google Scholar]
- Waggoner DJ, Ciske DJ, Dowton SB & Watson MS (1999). Deletion of 1q in a patient with acrofacial dysostosis. Am. J. Med. Genet 82, 301–304. [DOI] [PubMed] [Google Scholar]
- Wessels MW, Den Hollander NS, Cohen-Overbeek TE, Lesnik Oberstein MS, Nash RM, Wladimiroff JW, Niermeijer MF & Willems PJ (2002). Prenatal diagnosis and confirmation of the acrofacial dysostosis syndrome type Rodriguez. American Journal of Medical Genetics 113, 97–100. [DOI] [PubMed] [Google Scholar]
- Whitfield TT (2015). Development of the inner ear. Current Opinion in Genetics & Development, 32, 112–118. [DOI] [PubMed] [Google Scholar]
- Wieczorek D (2013). Human facial dysostoses. Clinical Genetics, 83(6), 499–510. [DOI] [PubMed] [Google Scholar]
- Wieczorek D, Newman WG, Wieland T et al. (2014). Compound heterozygosity of low-frequency promoter deletions and rare loss-of-function mutations in TXNL4A causes Burn-McKeown syndrome. Am. J. Hum. Genet 95, 698–707. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Will CL, & Lührmann R (2011). Spliceosome structure and function. Cold Spring Harbor Perspectives in Biology 3, 1–23. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wolda SL, Moody CJ & Moon RT (1993). Overlapping expression of Xwnt-3A and Xwnt-1 in neural tissue of Xenopus laevis embryos. Dev. Biol 155, 46–57. [DOI] [PubMed] [Google Scholar]
- Wu CC, Sakahara D & Imai K (2017). Ankylosis of temporomandibular joints after mandibular distraction osteogenesis in patients with Nager syndrome: Report of two cases and literature review. Journal of Plastic, Reconstructive & Aesthetic Surgery 70, 1449–1456. [DOI] [PubMed] [Google Scholar]
- Yamada T, Takechi M, Yokoyama N, Hiraoka Y, Ishikubo H, Usami T, Furutera T, Taga Y, Hirate Y, Kanai-Azuma M, Yoda T, Ogawa-Goto K & Iseki S (2020). Heterozygous mutation of the splicing factor Sf3b4 affects development of the axial skeleton and forebrain in mouse. Developmental Dynamics, 249 (5), 622–635. [DOI] [PubMed] [Google Scholar]
- Zerounian S, Delrue M, Rypens F, Codsi E & Wavrant S (2019). EP17.10: early diagnosis of Nager syndrome in dichorionic twins. Ultrasound Obstet Gynecol. 54, 336–336. [Google Scholar]
- Zhao J & Yang L (2020). Broad-spectrum next-generation sequencing-based diagnosis of a case of Nager syndrome. J Clin Lab Anal 2020;00:e23426. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zori RT, Gray BA, Bent-Williams A, Driscoll DJ, Williams CA, & Zackowski JL (1993). Preaxial acrofacial dysostosis (Nager syndrome) associated with an inherited and apparently balanced X;9 translocation: Prenatal and postnatal late replication studies. American Journal of Medical Genetics Part C: Seminars in Medical Genetics, 46(4), 379–383. [DOI] [PubMed] [Google Scholar]
