A show of Hands: Novel and conserved expression patterns of teleost hand paralogs during craniofacial, heart, fin, peripheral nervous system and gut development

Abstract

Background:

Hand genes are required for the development of the vertebrate jaw, heart, peripheral nervous system, limb, gut, placenta, and decidua. Two Hand paralogues, Hand1 and Hand2, are present in most vertebrates, where they mediate different functions yet overlap in expression. In ray-finned fishes, Hand gene expression and function is only known for the zebrafish, which represents the rare condition of having a single Hand gene, hand2. Here we describe the developmental expression of hand1 and hand2 in the cichlid Copadichromis azureus.

Results:

hand1 and hand2 are expressed in the cichlid heart, paired fins, pharyngeal arches, peripheral nervous system, gut, and lateral plate mesoderm with different degrees of overlap.

Conclusions:

Hand gene expression in the gut, peripheral nervous system, and pharyngeal arches may have already been fixed in the lobe- and ray-finned fish common ancestor. In other embryonic regions, such as paired appendages, hand2 expression was fixed, while hand1 expression diverged in lobe- and ray-finned fish lineages. In the lateral plate mesoderm and arch associated catecholaminergic cells, hand1 and hand2 swapped expression between divergent lineages. Distinct expression of cichlid hand1 and hand2 in the epicardium and myocardium of the developing heart may represent the ancestral pattern for bony fishes.

1 |. INTRODUCTION

Hand (Heart And Neural crest Derived expressed) genes code for basic Helix-Loop-Helix (bHLH) transcription factors of the Twist class that play roles in cell specification, differentiation and tissue patterning during vertebrate and invertebrate development.^1–4 In Drosophila, a single Hand gene is required for cardiac and vascular development.² As a result of the whole genome duplication events that took place in the chordate lineage preceding the evolution of vertebrates,⁵ the single ancestral chordate Hand gene^6,7 was duplicated into 2 paralogues, Hand1 (eHand) and Hand2 (dHand), that are present in most extant vertebrates (Ensemble.org). Hand genes are required for the development of a host of vertebrate evolutionary novelties: the jaw, the left/right ventricles of the four-chambered heart, the sympathetic division of the peripheral nervous system, the tetrapod limb, as well as the placenta and decidua of placental mammals.^8–17 Consequently, Hand gene expression must have dramatically changed during the course of chordate evolution and understanding these changes and their timing may provide insights into the evolution of these morphological innovations.

Hand1 and Hand2 expression patterns have been described in model species of mammalian (mouse, Mus musculus),^8,18 avian (chicken, Gallus gallus)¹⁹ and amphibian (frog, Xenopus laevis)^20,21 classes. The developmental roles of tetrapod Hand1 and Hand2 have been best studied in the mouse embryo, where Hand1 and Hand2 have distinct functions in heart, pharyngeal arch (PA), limb, sympathoadrenal lineages of the peripheral nervous system (PNS) and gut development.^8–17,22 In addition, Hand1 is required for extra-embryonic mesoderm development.⁹

In contrast, Hand gene expression and function outside tetrapods has only been examined in a ray-finned fish species, the zebrafish (Danio rerio, order Cypriniformes), the genome of which contains just a single Hand orthologue (hand2).^23–27 This condition is not conserved among most extant ray-finned fishes, which have two Hand genes, hand1 and hand2, indicating that hand1 was lost in the lineage leading to the Cypriniforms (Ensemble.org). Hand1 requirements for the development of multiple structures in the mouse embryo and its loss in Cypriniforms poses multiple questions. What is the expression and function of hand1 in non-cypriniform ray-finned fishes? Did the loss of hand1 have any consequences for the development, anatomy, and/or morphology of the cypriniform body plan? A thorough description of hand1 and hand2 expression patterns in a non-cypriniform teleost is a first step towards answering these questions.

Here, we describe the expression patterns of hand1 and hand2 during the development of the teleost Copadichromis azureus (Caz; Cichlidae).²⁸ We find that both genes are expressed in the developing cichlid heart, paired fins, PAs, PNS, and gut with different degrees of overlap, while hand1 alone is expressed in the lateral plate mesoderm (LPM), and hand2 alone is expressed in median fins (dorsal and anal). Caz hand1 and hand2 expression patterns are most similar to each other in the trunk PNS. In the developing Caz heart, hand1 expression is detected in the epicardium alone, while hand2 is detected only in the myocardium. In the Caz gut mesenchyme, hand1 is expressed first and more robustly than hand2. In the Caz fin mesenchyme, hand1 expression is uniform, while hand2 is expressed in a posterior domain resembling the tetrapod limb zone of polarizing activity (ZPA) in both paired and median fins. In the Caz pharyngeal arches, both hand genes are expressed ventrally, although hand1 expression is restricted to a ventral subset of the hand2 domain.

2 |. RESULTS AND DISCUSSION

2.1 |. Hand1 alone is expressed in the cichlid lateral plate mesoderm

Derivatives of the vertebrate LPM include the heart and cardiovascular system, blood, smooth muscle, and limb skeleton.²⁹ A single Hand gene is expressed in the LPM of basal chordates (amphioxus, lamprey).^6,30 Mouse Hand2, but not Hand1, is expressed in the LPM.^8,18,19 Similarly hand2 is expressed in the zebrafish LPM,^27,31 while it is not expressed in the LPM of teleosts with two hand genes in their genomes, such as medaka and Nile tilapia.³² Because of the close evolutionary relationship between Caz and Nile tilapia, we expected Caz hand2 expression to be absent from the LPM, while hand1 expression in this species remained to be determined.

To address these issues we performed whole-mount in situ hybridization (ISH) for both hand1 and hand2 in Caz embryos over the first few days of development. At 36 hours postfertilization (hpf), hand1 was robustly expressed in a region directly lateral to the pharyngeal arches (PAs), which we interpret as the anterior LPM, including the heart field (Figure 1A), and also lateral to the posterior paraxial mesoderm in a region that we interpret as the posterior LPM (Figure 1A). hand2 expression was not detected at this stage (Figure 1B). At 54 hpf, hand1 expression was detected in the heart tube and two bilateral LPM patches lying lateral to the embryo body (Figure 1C), while hand2 was strongly expressed in the developing heart and neural crest (NC) of the PAs but was not detected in the LPM (Figure 1D). Bilateral domains of hand1 expression were detected in anterior LPM at the position of the future pectoral fins (Figure 1C) and in posterior LPM connecting to two bilateral lines of expression flanking the developing hindgut (Figure 1C). This Caz hand1 expression resembles that of hand2 in the zebrafish posterior LPM, where hand2 regulates the size of the intermediate mesoderm.³¹

FIGURE 1.

hand1 and hand2 expression in 2 to 8dpf C. azureus. A-B: hand1, A, and hand2, B, expression at 36 hpf in de-yolked embryos (dorsal view). hand1 expression is detected in anterior and posterior lateral plate mesoderm, while hand2 is not. C-D, hand1, C, and hand2, D, expression in 54 hpf de-yolked embryos (ventral view). hand1 is detected in the heart, lateral plate mesoderm and gut, C, and hand2 expression is detected in the heart and pharyngeal arches, D. E and F, hand1, E, and hand2, F, expression in 3 dpf de-yolked embryos (lateral view). hand1 and hand2 expression is detected in the heart, pharyngeal arches, and pectoral fins. hand1 alone is expressed in the gut, E. G and H, hand1, G, and hand2, H, expression at 4 dpf. hand1 and hand2 are still detected in the heart, pharyngeal arches, and pectoral fins. hand2 is first detected in the gut, H. I and J, hand1, I, and hand2, J, expression at 5 dpf. hand1 and hand2 are still detected in the heart, pharyngeal arches, pectoral fins, and gut. Their domains of expression now include vagal ganglia (gX). hand1 pharyngeal arch expression has become restricted to the mandibular and hyoid arches, I. K and L, hand1, K, and hand2, L, expression at 6 dpf. hand1 and hand2 are still detected in the heart, pharyngeal arches, pectoral fins, gut, and vagal ganglia. hand1 and hand2 are first detected in trunk sympathetic ganglia. hand2 is first detected in the presumptive dorsal and anal fins (arrowheads), L. M and N, hand1, M, and hand2, N, expression at 7 dpf. hand1 and hand2 are still detected in the heart, pharyngeal arches, pectoral fins, gut, vagal, and trunk sympathetic ganglia, and in the dorsal and anal fins. O and P, hand1, O, and hand2, P, expression at 8 dpf. hand1 and hand2 are still detected in the heart, pharyngeal arches, pectoral fins, gut, vagal and trunk sympathetic ganglia, and in the dorsal and anal fins. Their domains of expression include pelvic fins starting at this stage. Anterior to the left. * indicates first detection stage in labeled structure. aLPM, anterior lateral plate mesoderm; pLPM, posterior lateral plate mesoderm; PA, pharyngeal arches; pec, pectoral fin; SG, sympathetic ganglia; ma, mandibular arch; hy, hyoid arch; gX, vagus ganglion; df, dorsal fin; af, anal fin; pel, pelvic fin. Scale: 100 μm

Our results show that the expression of hand1, but not hand2, in the cichlid LPM differs from mouse or zebrafish Hand gene expression, in which hand2, but not hand1, is expressed in the LPM.^8,18,19,27 The lack of hand2 expression in cichlid LPM is consistent with previous reports in teleosts with a two hand gene complement.³² These opposite and mutually exclusive expression patterns suggest that a single hand gene is sufficient for LPM development and that LPM expression switched from one hand ortholog to the other in various bony fish lineages.

2.2 |. hand1 and hand2 are expressed in the atrium, ventricle, and outflow tract of the cichlid heart

During vertebrate heart morphogenesis cardiac precursors derived from the anterior LPM form a linear, primitive heart tube that is subsequently patterned along the anterior-posterior (A-P) axis into the presumptive atrium(a), ventricle(s), and outflow tract. Hand genes are diversely expressed in the developing heart fields of model vertebrate embryos. In the chick, both genes are homogeneously expressed and required redundantly for heart looping.¹⁹ In mouse, initially Hand2 expression spans the entire primitive heart tube while Hand1 expression is restricted to the presumptive left ventricle and outflow tract. Thereafter, Hand2 expression becomes the highest in the presumptive right ventricle.^8,33 Mouse knockouts have shown specific requirements for Hand1 and Hand2 in left and right ventricle formation, respectively.^8–10 In Xenopus, Hand1 is homogeneously expressed throughout the heart tube,³⁴ while Hand2 expression is not detected.²¹ In zebrafish, which lacks hand1, hand2 is expressed throughout the heart tube and required for myocardial lineage specification and heart looping.²⁷

At 54 hpf when the heart tube has formed, the expression of both Caz hand1 and hand2 was uniform along the entire tube, albeit in different layers (Figure 1C,D; Figure 2A,B). hand1 was detected in the outer epicardial layer (Figure 2A), while hand2 was detected in the inner myocardial layer (Figure 2B). During heart looping (78 hpf, Figure 1E, F), hand1 was still primarily expressed in the epicardium of the entire outflow tract and ventricle but became restricted in the atrium to the region immediately adjacent to the ventricle (Figure 2C). hand2 was also still primarily expressed in the myocardium of the entire outflow tract, ventricle and atrium, with the strongest expression in the thickening ventricle myocardium and very weak expression in the atrium (Figure 2D). By 7 days postfertilization (dpf) (Figure 1M,N), hand1 expression remained restricted to more peripheral regions of the outflow tract and ventricle, while not detected in the atrium (Figure 2E). In contrast, hand2 expression was excluded from the cardiac periphery, with robust expression in the outflow tract core and inner ventricle, and weaker expression in the atrial myocardium (Figure 2F). In addition, hand1 was robustly expressed throughout the pericardial sac (Figure 2E), while pericardial hand2 expression was weaker and restricted anteriorly (Figure 2F).

FIGURE 2.

hand1 and hand2 expression in the developing cichlid heart. A and B, hand1, A, and hand2, B, expression in the 54 hpf heart (ventral view). hand1 expression is detected in the outer heart layer, which we interpret as epicardium (ep), while hand2 expression is detected in the inner heart layer, which we interpret as presumptive myocardium (my). hand1 is also expressed in arch associated catecholaminergic cells⁵⁵ (arrowhead). C and D, hand1 C, and hand2, D, expression in the 78 hpf dissected heart (ventral view). C, hand1 expression is detected in the epicardium of ventricle, outflow tract, and proximal atrium. D, hand2 expression is robust in the myocardium of the ventricle and outflow tract, and weak in the atrium. E and F, hand1 (E) and hand2 (F) expression in the 7 dpf heart (lateral view). E, hand1 is expressed in the outer layers of the ventricle and outflow tract and not detected in the atrium. F, hand2 is expressed in the inner layers of the atrium, ventricle, and outflow tract. Both genes are also expressed in the cardiac sac. at, atrium; cs, cardiac sac; oft, outflow tract; ve, ventricle. Scale: 25 μm

The uniform expression of hand genes along the A-P axis of the cichlid heart tube is consistent with previous reports for zebrafish hand2, Xenopus Hand1 and both chicken Hand orthologs.^19,21,27 The restricted Hand gene expression observed along the A-P axis of the mouse heart tube patterns the left and right ventricles,⁸ a morphological innovation that evolved in the tetrapod lineage leading to mammals. Stronger expression in the outflow tract and ventricle during heart looping was reported for zebrafish hand2.²⁶

Layer-specific expression of hand orthologues in the heart was reported in a few organisms and at particular stages. Layer-specific expression of zebrafish hand2 expression was not reported, yet it is required specifically for myocardium development, the particular layer where hand2 is detected in our study.²⁷ In mouse, Hand2 is expressed in the myocardium, but not the epicardium, similar to cichlid hand2.⁸ In addition, mouse Hand1 expression was primarily reported in the myocardium, yet lineage analyses showed that Hand1-expressing cells become restricted to the epicardium,¹⁴ which is where cichlid hand1 is detected in our study.

Taken together, our results suggest that the ancestral expression of Hand orthologs before the split between ray- and lobe-finned fish lineages was uniform along the A-P axis of the heart tube, and that hand1 was expressed in the epicardium and hand2 was expressed in the myocardium. The loss of hand1 in Cypriniforms does not correlate with any known morphological alteration of the heart, suggesting that hand1 was dispensable for heart development at the time of its loss.

2.3 |. Cichlid paired fins express hand1 and hand2, median fins express hand2 alone

Hand2 is dynamically expressed in mouse and chick limb buds through multiple stages.^19,35 Its posterior expression in the early limb bud is required for Shh expression in the Zone of Polarizing Activity (ZPA).^11,35,36 By contrast, Hand1 is expressed anteriorly and ventrally in chick and mouse limb buds, and no limb defects have been reported in mouse Hand1 mutants.²²

The teleost fore- and hindlimb homologues, the pectoral and pelvic fins, respectively, develop over distinct periods. Pectoral fin buds become visible during pharyngeal arch segmentation, similar to tetrapod forelimb buds,^37–39 while pelvic fin buds appear during metamorphosis, the timing of which is species-specific.^38,40–42 Teleost hand2 fin expression was previously reported for the zebrafish pectoral fin alone, where it is expressed in the posterior mesenchyme and required for shh expression similar to tetrapods.²⁷ hand1 expression in fins has remained undescribed in teleosts before this study.

hand1 and hand2 expression were both detected, albeit differently, in the cichlid pectoral fin bud from 72 hpf to 9 dpf (Figure 1C–P). In the early bud (72-96 hpf), hand1 expression appeared uniform across the A-P extent of the pectoral fin mesenchyme, while hand2 expression appeared restricted to the posterior mesenchyme alone (Figure 1E–P, Figure 3A,B). As fin development proceeded, hand1 and hand2 expression became restricted to the fin base (Figure 3C,D), with hand1 expression along the entire A-P extent of the fin (Figure 3C), and hand2 expression restricted to the posterior fin (Figure 3D).

FIGURE 3.

hand1 and hand2 expression in the developing cichlid paired and median fins. A and B, hand1, A, and hand2, B, expression in the 3 dpf pectoral fin. hand1, A, is expressed in the entire fin mesenchyme, while hand2, B, is expressed in the posterior mesenchyme. C and D, hand1, C, and hand2, D, expression in the 7 dpf pectoral fin (anterior to the left). hand1, C, fin base expression is continuous along the A-P axis, while hand2, D, expression is restricted to the posterior half of the fin base. E and F, hand1, E, and hand2, F, expression in the 9 dpf pelvic fin. hand1, E, is expressed in the entire fin mesenchyme, while hand2, F, is expressed in the posterior mesenchyme. G and H, hand2, H, but not hand1, G, is expressed in the posterior mesenchyme of the 9 dpf dorsal fin. I and J: hand2, I, but not hand1, J, is expressed in the posterior mesenchyme of the 9 dpf anal fin. Scale: 25 μm. pec, pectoral fin; pel, pelvic fin; df, dorsal fin; af, anal fin

Pelvic fin expression of hand1 and hand2 was detected starting at 8 dpf, the beginning of cichlid metamorphosis.^38,41 At this stage, pelvic fin buds lay laterally on the yolk sac (Figure 1O,P). Similar to the pectoral fin, hand1 expression was uniform throughout the pelvic fin bud mesenchyme (Figure 3E), while hand2 expression was restricted posteriorly (Figure 3F).

In median fins, hand2 expression, but not hand1, also became detectable at the onset of metamorphosis (6 dpf; Figure 1L), although 48 hours prior to its detection in the pelvic fin buds. Weak expression was first detected within the larval finfold at the posterior edges of the presumptive dorsal and anal fins (Figure 1L). Expression became more robust at later stages (Figure 1N,P).

The ZPA-like expression of hand2 in cichlid fins suggests a conserved role in appendage A-P patterning between teleosts and mammals, while the uniform hand1 expression in the cichlid fin mesenchyme suggests a different requirement than in mammals. The previously undescribed hand2 expression in median fins, structures lost in mammals, is likely ancestral for ray- and lobe-finned fishes as the ZPA-like expression of shh, activated by Hand2 in mouse limbs,¹¹ is regulated by a common cis-regulatory element in zebrafish paired and median fins⁴³ and present in shark median fins.⁴⁴ Median fin hand2 expression was likely not previously described in zebrafish due to the late onset of metamorphosis in this species.⁴⁵

2.4 |. hand1 and hand2 expression in the cichlid gut mesenchyme

In mouse, Hand1 and Hand2 are expressed in distinct populations of the intestinal mesenchyme: Hand1 is expressed in the enteric mesoderm, while Hand2 is expressed in enteric NC cells.^12–14 Mouse Hand1 is required for enteric muscle organization, not differentiation,⁴⁶ while Hand2 is required for the differentiation of enteric neurons.¹² In zebrafish, hand2 is first expressed in the intestinal mesoderm-derived mesenchyme at early stages of intestinal development, similar to mouse Hand1 ^12,25 and becomes also expressed in enteric NC cells at later stages. Zebrafish hand2 is required for (a) the migration and proliferation of enteric NC cells along the intestine, (b) their differentiation, (c) intestinal smooth muscle development,²⁵ and (d) gut looping.⁴⁷ Thus, zebrafish hand2 is responsible for the biological activities of both hand1 and hand2 shown in mouse, in addition to requirements for enteric neuron migration and gut looping.

Caz hand1 expression was detected in bilateral lines of mesenchyme flanking the gut at 54 hpf (Figure 1C) and became restricted to the gut region extending from the pectoral fin to the anus at subsequent stages (Figure 1E). Expression was first restricted to the ventral side of the gut (Figure 1E, G), became localized dorsally in the region proximal to the anus at 5 dpf (Figure 1I), and was detected dorsally and ventrally thereafter (Figure 1K,M,O). hand2 gut expression started 2 days after hand1 was first detected (4 dpf) and its general pattern mirrored that of hand1: it was first detected ventrally before extending to the dorsal aspect of the gut tube, although hand2 salt-and-pepper expression was less robust than that of hand1 (Figure 4A,B). Observations of hand1 and hand2 gut expression at higher magnification, together with sagittal histological sections from same-staged larvae of Nile tilapia (Oreochromis niloticus), showed that both genes are expressed in the mesenchyme lining the basal side of the intestinal epithelium, although hand1 is expressed in more cells than hand2 (Figure 4A–C). hand1 and hand2 gut expression became increasingly restricted to the distal gut/anal region over the next few days of development (Figure 1K–P).

FIGURE 4.

hand1 and hand2 expression in the developing cichlid gut. A, hand1 expression throughout the 7 dpf intestinal mesenchyme. B, hand2 salt and pepper expression in the 7 dpf intestinal mesenchyme. C, sagittal section showing gut histology at 7dpf. Scale: 50 μm

The salt-and-pepper hand2 expression in the Caz gut mesenchyme, and the more robust hand1 expression suggest that, as in mouse, Caz hand1, and hand2 may be required for smooth muscle and enteric neuron development, respectively. However, the use of molecular markers specifically expressed in these two lineages will be necessary to support this possibility.

2.5 |. hand1 and hand2 expression in the pharyngeal arches

In mouse and chick, Hand1 and Hand2 expressions overlap in the ventral pharyngeal arches (PAs): Hand1 expression is restricted to the ventral (distal)-most PA region, while Hand2 extends further dorsally.^8,18,19,48 NC ablation of hand1 alone does not affect pharyngeal development,⁴⁹ whereas distal mandibular structures (Meckel’s symphysis, lower incisors) are affected when loss of Hand1 is combined with a Hand2 heterozygous loss-of-function.⁵⁰ In addition, altering the dimerization affinities of Hand1 in phosphorylation mutants results in severe mid-facial clefting.⁵¹ Hand2 is required for lower jaw patterning in mice and zebrafish, where it is a downstream target of Edn1.^24,33,52 It also represses bone differentiation in the lower jaw independently from its DNA-binding role by direct binding to the transcription factor Runx2.⁵³

Expression of hand1 and hand2 in NC was first detected in the cichlid PAs at 54 hpf (Figure 1C,D; Figure 2A,B), by which stage NC cells are post-migratory.^41,54 hand1 expression was salt-and-pepper in the ventral domains of PA1-4 (Figure 2A), while hand2 was robustly expressed ventrally in the rings of NC that surround the mesodermal core of each pharyngeal arch (Figure 2B).⁵⁵ In addition, hand1 was intensely expressed in small clusters of variably positioned cells located ventrally in the zone of contact between PA1 and 2 (Figure 2A). These cells were identified as arch associated catecholaminergic cells (aac’s).⁵⁵ By 78 hpf, both genes were expressed in PA1-7, although hand1 expression was restricted to the ventral-most domain of hand2 expression in each PA (Figure 5A,B). hand1 expression subsequently became restricted to PA1-2 at 5 dpf and thereafter, while hand2 remained expressed in PA1-7 (Figure 1I–P). As the musculoskeletal derivatives of the PAs started to differentiate during jaw elongation (6 pdf; Figure 1K,L; Figure 5C–F), hand1 and hand2 expression was not detected in cartilages, such as Meckel’s cartilage in PA1 and the ceratohyal cartilage in PA2 (Figure 5G–J). Both genes were expressed in pharyngeal mesenchyme and differentiating muscles within their respective domains (Figure 5G, H). At 9 dpf, hand1, and hand2 were both detected in the oral mesenchyme and developing teeth of the lower jaw (Figure 5I,J), but not of the upper jaw (Figure 5G,H). hand1 expression was more robust anterior to Meckel’s cartilage, while hand2 expression was stronger posterior to Meckel’s cartilage (Figure 5I,J). hand1 and hand2 were not detected in the dental mesenchyme of the upper and lower pharyngeal jaws (Figure 5M–P).

FIGURE 5.

hand1 and hand2 expression in the developing cichlid pharyngeal arches. A and B, hand1, A, and hand2, B, overlapping expression in the 3 dpf pharyngeal arches. hand1, A, expression is more restricted than hand1 to the ventral-most domain. C to F: hand1 (C,E) and hand2 (D,F) expression in the 7 dpf pharyngeal arches. hand1 (C, lateral; E, ventral) expression is restricted to pharyngeal arches 1 to 2, while hand2 (D, lateral; F, ventral) is expressed in all arches. G and H: hand1, G, and hand2, H, expression is not detected in the 9 dpf upper jaw dental mesenchyme. Dorsal to the top. I and J, hand1, I, and hand2, J, expression in the 9 dpf lower jaw. hand1, I, expression is strongest at the midline (left in image), and in the dental mesenchyme. hand2 expression is detected in the mesenchyme posterior Meckel’s cartilage. Neither gene is detected in Meckel’s cartilage. Anterior to the top. K and L, hand1, K, and hand2, L, expression in the 9 dpf hyoid arch. hand1 and hand2 are both expressed in midline mesenchyme in the region connecting to the cardiac outflow tract. hand2 is also expressed in mesenchyme around the hypo- and cerato-hyal cartilages, L, Anterior to the top. M to P, hand1 (M,O) and hand2 (N,P) expression is not detected in the 9 dpf upper (M,N) and lower (O,P) pharyngeal jaw dental mesenchyme. Anterior to the top. ch, ceratohyal; gX, vagal ganglion; hh, hypohyal; Mc, Meckel’s cartilage; PA, pharyngeal arch; pec, pectoral fin. Scale: 50 μm

Our results show that PA expression of hand1 is very similar in Caz to the mouse, and that hand2 expression is very similar in Caz, zebrafish, and mice, except for aac’s, which express hand2 in zebrafish⁵⁵ and hand1 in Caz. The presence of hand1 expression in the dental mesenchyme of the Caz lower oral jaw, and its absence from the upper oral jaw and the upper/lower pharyngeal jaws makes it seem unlikely that the singular loss of hand1 in the genomes of Cypriniforms underlies oral tooth loss in this lineage.

2.6 |. hand1 and hand2 expression in the peripheral nervous system

The sympathetic branch of the peripheral nervous system (PNS) regulates homeostasis in vertebrates and is entirely derived from NC cells.⁵⁶ Sympathetic neurons and supporting cells lie either in paravertebral ganglia lying bilaterally ventral to the spinal column or in prevertebral ganglia located between paravertebral ganglia and target organs. Paravertebral ganglia include the sympathetic trunk ganglia, where both Hand1 and Hand2 are expressed in mice, whereas their prevertebral ganglionic expression includes the paraaortic ganglia and adrenal medulla.^15,18,19 Hand2 is required for noradrenergic neuron differentiation, where it also activates Hand1 expression, which in contrast is not required.^15–17 A similar requirement for Hand2 was shown in zebrafish for noradrenergic neuron differentiation in cervical sympathetic ganglia and, unlike in mice, in the locus coeruleus of the central nervous system.²³ hand2 expression was not reported in zebrafish sympathetic trunk ganglia and its requirement for sympathetic trunk noradrenergic neuron differentiation was not tested due to early lethality of the zebrafish hands off mutant.^23,27

In the cichlid trunk, both hand1 and hand2 expression was detected in sympathetic ganglia starting at 6 dpf (Figure 1K–P and Figure 6A–C). Sympathetic cell clusters expressing either gene became connected along the A-P axis during the next 2 days of development, resulting in bilateral chains running on either side of the dorsal aorta along the entire trunk and tail (Figure 6L). We interpret these ganglionic chains as sympathetic trunks. In the head, hand1 and hand2 were also detected in the vagal (cranial nerve X) ganglion starting at 5 dpf (Figure 1I–P). Sagittal histological sections from same-staged larvae of Nile tilapia confirmed this structure as the vagal (Figure 6F,I). Ventral observations after removal of pharyngeal structures revealed a physical connection between hand1 and hand2 expressing components of the PNS of the head and trunk (Figure 6J–L). In teleosts, sympathetic chains extend into the head, where they are associated with cranial nerves.⁵⁷ Our results show that, as in mouse, cichlid hand genes are expressed in the sympathetic branch of the PNS.

FIGURE 6.

hand1 and hand2 expression in the developing cichlid PNS. A to C, hand1, A, and hand2, B, expression in sympathetic ganglia at 7 dpf. C, sagittal section showing sympathetic ganglia at 7 dpf (arrows). D to I, hand1 and hand2 are expressed in the vagal ganglion. D and G, hand1 expression in the vagal ganglion in lateral view. E and H, hand2 expression in the vagal ganglion in lateral view. F and I, sagittal section showing vagal ganglion histology. J to L, hand1, J, and hand2, K, expression in the peripheral nervous system extends into the head region and labels the left and right sympathetic ganglion chains, L. Scale: 50 μm. eb1-4, epibranchial 1-4; gT1, first trunk sympathetic ganglion; gX, vagal ganglion; k, kidney; my, myotome; not, notochord; pec, pectoral fin; SG, sympathetic ganglion; SN, sympathetic nerve; th, thymus

3 |. CONCLUSIONS

Overall, a comparison of our results in cichlids with other vertebrates (Table 1) suggests an evolutionary history of Hand genes in which expression in some embryonic structures such as the gut, PAs, and the sympathetic PNS were fixed in the common ancestor of lobe- and ray-finned fish. In contrast, in the appendages, Hand2 expression appears to have been fixed, while Hand1 expression diverged in lobe- and ray-finned fish lineages. Evolution of the four-chambered heart in mammals, and the roles for Hand1 and Hand2 in left-right ventricle patterning, respectively, imply a lineage-specific divergence in Hand gene expression between lobe- and ray-finned fishes. Our results suggest that a primitive role for Hand1 and Hand2 may have been in specifying the epicardium and myocardium, respectively. Lastly, LPM expression was shuffled between Hand1, in non-cypriniform teleosts, and Hand2 in zebrafish and mammals,^8,27 A similar expression swap took place in aac’s between non-cypriniforms (hand1 expression) and cypriniforms (hand2 expression).

TABLE 1.

Summary of Hand gene expression in chordate embryos

			Gnathostomes
	Cephalochordates amphioxus	Agnathans lamprey	Ray-Finned fishes			Tetrapods
taxon region			zebrafish	cichlid		frog		chick		mouse
	AmphiHand	LjHandA	hand2	hand1	hand2	Hand1	Hand2	Hand1	Hand2	Hand1	Hand2
LPM	yes6,31	yes6	yes27,32	yes	no33	yes35	no21	CC19	yes19	no18	yes8
Heart	subintestinal vessel anlag*31	yes6	unif.27	AP unif. epicard.	AP unif. myocard.	unif. 35	no21	unif. 19	unif. 19	LV + OFT myocard. 19	AP unif. then RV myocard.19 see14
Append.	NA	NA	post. (pc) 27	unif. (pc,pl,dr,an)	post. (pc,pl,dr,an)	?	?	ventral 22	post. 36	no bud expr.18,22	post. 11,36
Gut	post. hindgut31	ventral to gut6	mderm + enteric NC12	mchyme	mchyme	?	punctate21	?	?	mderm 14	enteric NC12
PA’s	mderm6	yes6	NC ventral + aac’s24	NC ventral most + aac’s	NC ventral	yes35 ventral most	NC ventral21	yes19	yes19	NC ventral most18,19,49	NC ventral8,19
PNS	NA	NA	cerv. g. 23	ST	ST	?	?	ST19	ST19	ST15,17,18	ST15,16

Abbreviations: aac, arch associated catecholaminergic cells; an, anal fin; AP, anterior-posterior; Append., appendages; CC, cardiac crescent; cer. g., cervical ganglion; epicard., epicardium; expr, expression; LPM, lateral plate mesoderm; LV, left ventricle; mchyme, mesenchyme; mderm, mesoderm; NC, neural crest; OFT, outflow tract; PA, pharyngeal arches; pc, pectoral fin; pi, pelvic fin. dr, dorsal fin; PNS, peripheral nervous system; post., posterior; RV, right ventricle; ST, sympathetic trunks; unif., uniform.

In the cypriniform lineage, our results suggest that the loss of hand1 could have impacted fin and/or mandibular development. The function of hand1 in teleost fin development is unknown, and the cypriniform fin is representative of the ancestral teleost configuration,⁴⁰ suggesting that loss of hand1 may not have had an effect on fin development in this lineage. In contrast, the absence of oral teeth is a defining feature of Cypriniforms and correlates with the loss of hand1 in this lineage. However, our results do not strongly support a causal role for hand1 loss in the loss of oral teeth in Cypriniform evolution as it is expressed in dental mesenchyme of the cichlid lower, but not upper jaw. Thus, the morphological effects of the loss of hand1 on developing fins, jaws, and teeth as well as other cell types at later stages in the Cypriniform lineage remain a mystery. Experimental tests of hand1 function in non-Cypriniform teleosts will be required to address these hypotheses.

4 |. EXPERIMENTAL PROCEDURES

4.1 |. Animal care

All animals were reared and euthanized following protocols approved by the IACUC at the University of North Carolina, Wilmington. C. azureus brood stocks were purchased from a pet store and maintained at 28°C in 55-gal tanks. Adults were fed Northfin Food Cichlid Formula 3 mm sinking pellets. Fertilized eggs were collected from mouth-brooding females a few hours after fertilization. Embryos were reared in cichlid egg tumblers and staged under a microscope following Fujimura and Okada (2007).³⁸

4.2 |. Image capture

Observations and images were either made using a dissecting microscope Leica M165FC equipped with Planapo 1.6X M-series objective and a Leica DFC7000T camera controlled by the LAS X software, or using a Zeiss Axioskop 2 FS Plus compound microscope equipped with a Qimaging Micropublisher 6 camera controlled by Ocular software. Image processing was performed in Adobe Photoshop. Figures were prepared in Adobe Illustrator.

4.3 |. In situ hybridization

Embryos and larvae were fixed and processed for whole-mount in situ hybridization as described in Le Pabic et al., (2007)⁵⁸ with the following modifications: for the proteinase K treatment step, specimens 5 dpf and younger were incubated for 10 minutes and specimens 6 dpf and older were incubated for 20 minutes in a 60 μg/mL solution. Prehybridization was overnight and probe incubation was 48 hours. Post-hybridization washes were 2 x 15 minutes in 2XSSCT and 3 x 2 hours 0.2XSSCT at 65° C. Block incubation was overnight and antibody incubation was 48 hours. In situ hybridization probes were generated from RT-PCR amplified regions of C. azureus hand1 and hand2 cDNAs using the following primers: CA_Hand1_F: TTACCAGCATCACCACCAC, CA_Hand1_R: TTCTTCTCGGCTCCTAAGGA, CA_Hand2_F: GTCATGCACCATCACGACA, CA_Hand2_R: CAGTTCCAGAGCCCAGACAT. The amplified C. azureus hand1 fragment was 501 bp long and over 99% identical (500/501 identities) to its M. zebra ortholog (Malawi cichlid reference genome, sequence ID XM_004551130.2). The amplified C. azureus hand2 fragment was 696 bp long and 100% identical to its M. zebra ortholog (Malawi cichlid reference genome, sequence ID XM_004562238.3). mRNA was extracted from deyolked 54hpf C. azureus embryos. In situ hybridization was conducted using antisense probes prepared from pGem-t-easy vectors (Promega) containing cDNA fragments corresponding to C. azureus hand1 and hand2.