The estrous cycle and skeletal muscle atrophy: investigations in rodent models of muscle loss

Abstract

Recent efforts have focused on further understanding female muscle physiology during exposure to muscle atrophic stimuli. A key feature of female rodent physiology is the estrous cycle. However, how such stimuli interact with the estrous cycle to influence muscle health remains uninvestigated.

Aim:

To investigate the impact of muscle atrophic stimuli on the estrous cycle and how these alterations correlate with musculoskeletal outcomes.

Methods:

A series of experiments were performed, including hindlimb unloading (HU), hindlimb unloading followed by 24 hours of reloading, (HU+24hrs Recovery), hindlimb unloading combined with dexamethasone treatment (HU+DEXA), and Lewis Lung Carcinoma (LLC) in female rodents. Estrous cycle phase was assessed throughout each intervention and correlated with musculoskeletal outcomes.

Results:

Seven or fourteen days of HU increased duration in diestrus or metestrus (D/M, low hormones) and negatively correlated with gastrocnemius mass. Time spent in D/M also negatively correlated with changes in grip strength and bone density after HU, as well as muscle recovery 24 hours after the cessation of HU. The addition of dexamethasone strengthened these relationships between time in D/M and reduced musculoskeletal outcomes. However, in LLC animals, estrous cyclicity did not differ from control animals and time spent in D/M did not correlate with either gastrocnemius mass or tumor burden. In vitro experiments suggest estrogen-induced enhanced protein synthesis may protect against muscle atrophy.

Conclusion:

Muscle atrophic insults correlated with estrous cycle alterations which, are associated with deteriorations to musculoskeletal outcomes. The magnitude of estrous cycle alterations depend on the atrophic stimuli.

Introduction

Muscle loss is an important predictor of longevity and general health in multiple diseases, muscle-specific or otherwise (Batt et al., 2019; Takamori et al., 2018). However, until recently, muscle atrophy was predominantly investigated in males, overlooking potentially important biological differences in muscle physiology between the sexes. Recent efforts have focused on investigating how males and females may differentially respond to induction of muscle atrophy. For example, female mice tend to have exacerbated early responses to induction of disuse atrophy compared to males, including greater catabolic signaling and stronger inhibition of anabolic signaling (Rosa-Caldwell et al., 2021). Conversely, in murine models of cancer cachexia, females maintain muscle mass more effectively than males (Hetzler et al., 2017; Lim et al., 2020). Importantly, these preclinical studies also appear to mirror human disease, including muscle loss due to critical illness and cancer (De Jonghe et al., 2002; Hendifar et al., 2009; Lipes et al., 2013), strongly supporting the necessity to further understand how biological sex interacts with the development of muscle atrophy.

Sex hormone differences between males and females are a fundamental feature of all mammalian species. In general, males have relatively stable sex hormone levels (predominantly testosterone) whereas females have fluctuating levels tied to the timing of ovulation (particularly estrogen and progesterone) as they cycle (termed the menstrual cycle in humans and the estrous cycle in all other mammals). The estrous cycle is broadly broken down into 4 primary phases: proestrus, estrus, metestrus, and diestrus (Butcher et al., 1974; Smith et al., 1975). During proestrus, estrogen peaks, and progesterone peaks shortly thereafter. Estrus corresponds to a declining estrogen and progesterone concentrations as well as ovulation (which heralds the end of proestrus and start of estrus). Metestrus and diestrus generally correspond to troughs in both progesterone and estrogen levels. These cyclic alterations in estrogen and progesterone are moderated by cyclic changes in luteinizing hormone and follicle-stimulating hormone, produced by the pituitary. In general, healthy rodents undergo full cycles every 4–6 days (Ajayi & Akhigbe, 2020). However, changes to the estrous cycle that prolong diestrus or metestrus, thus creating a lower overall hormonal state, may have implications for animal health.

Studies have begun to assess alterations to estrous cyclicity in association with muscle disuse and atrophy. A recent study in space-flown mice in low earth orbit concluded spaceflight itself does not appear to affect estrous cyclicity (Hong et al., 2021); however, this conclusion was based on a single measurement of vaginal wall staining, which does not describe alterations to the estrous cycle itself. Moreover, that same study found 0/10 mice in proestrus (during which estrogen and progesterone peak), compared to 2–3/10 mice in proestrus in control groups (Hong et al., 2021). These data imply possible alterations to estrous cyclicity in microgravity. A separate ground-based study found hindlimb unloading (a model for microgravity-induced muscle atrophy) to increase estrous cycle length, with less time spent in estrus and more time in diestrus over a 38-day period (Tou et al., 2004). However, how quickly these alterations develop and how they relate to musculoskeletal outcomes has not been investigated. In cancer cachexia, recent work has begun to establish that estrous cycle disruptions are potentially necessary for the induction of muscle loss (Counts et al., 2019; Hetzler et al., 2017). For example, in the Apc^Min/+ mouse, a genetic model of colorectal cancer, females that maintain a normal estrous cycle typically do not develop cachexia, compared to animals that become acyclic and do develop atrophy (Hetzler et al., 2017). Whether this holds for other forms of cancer, however, is uncertain (Rosa-Caldwell, Fix, et al., 2020). Moreover, simple dichotomizing the estrous cycle as either “normal” or “acyclic” potentially limits researchers’ ability to determine the impact of more subtle changes to estrous cycle and possible subsequent effects on the musculoskeletal system.

Thus, it is clear that key questions remain, such as: 1. Is the estrous cycle altered during the development of various forms of skeletal muscle atrophy and do these potential changes relate to musculoskeletal outcomes? 2. If alterations exist, how quickly do they develop? And 3. What signaling mechanisms may underlie these musculoskeletal alterations in relation to estrous cyclicity? To answer these questions, we completed a series of experiments in rodent (mouse and rat) models of atrophy to determine how alterations of the estrous cycle correlate with the development and progression of skeletal muscle atrophy.

Methods

Ethics Approval

All procedures were approved by Beth Israel Deaconess Medical Center or University of Arkansas Institutional Animal Care and Use Committees (Approval Numbers 025-2019 and 18109 respectively).

Animal Studies

Hindlimb unloading (mouse):

Hindlimb unloading (HU) was induced in 8-week-old female C57BL/6J mice obtained from Jackson Laboratories per prior reports (n=10) (Rosa-Caldwell et al., 2021; Rosa-Caldwell, Lim, et al., 2020). Briefly, animals’ tails were wrapped with specialized athletic tape and using a custom harness system, animals were hindlimb unloaded. Tails were monitored daily for signs of inadequate blood flow or necrosis. Animals were hindlimb unloaded for 7 days and then euthanized through 2% isoflurane inhalation followed by cardiac puncture according to IACUC guidelines. Gastrocnemius muscles were collected for measurement of tissue mass.

Hindlimb unloading (rat):

Hindlimb unloading (HU) was induced as previously described in 14-week-old Wistar Rats obtained from Charles River laboratories (Mortreux et al., 2018, 2019). Briefly, animals were hindlimb unloaded using a specialized harness system that wraps around the animal’s pelvis to maintain hindlimb unloading. Animals either had no harness (CON, n=6) or were hindlimb unloaded (HU, n=8) for 14 days. Before and after interventions, animal hindlimb strength was measured by rear paw grip force using a grip bar attached to a Chatillon Ametek DFE-II force gauge (Ametek, Berwyn, PA). Animals were grabbed at the shoulders to ensure they could not bite the researcher, nor could front paws touch the grip bar. (scuffed). Then hindlimbs were placed on the bar. After the animal was clearly gripping the bar with its feet, a trained researcher gently pulled the animal back from the bar until the animal let go of the bar. The corresponding force was recorded and repeated at least two times with at least 30–60 seconds between trials. After 14 days of intervention, animals were euthanized by CO₂ inhalation followed by cardiac puncture, according to IACUC guidelines. Gastrocnemius and soleus muscles were collected, as well the femur. Gastrocnemius muscles were weighed, soleus muscle was used for mRNA analysis, and femurs were analyzed for bone mineral density.

All animals were maintained on a 12:12 light cycle with ab libitum access to food and water. The investigators understand the ethical principles under which Experimental Physiology operates and our work complies with Experimental Physiology’s animal ethics checklist.

Dexamethasone Treatment (rat):

In a separate cohort of rats (14-week-old Wistar), females were hindlimb unloaded as described above (n=3–6). However, to induce a more catabolic environment and simulate intensive care unit (ICU) conditions, animals were also given daily doses of dexamethasone (Sigma-Aldrich, Cat # D2915-100MG) at a dosage of 3.75 mg/kg/day similar to prior literature (Aru et al., 2019; Chiu et al., 2011). Water soluble dexamethasone was dissolved in 10% sucrose:water solution at a concentration of 7.5μg/μL. Dexamethasone solution was given orally to rats every morning during the HU intervention. Animals were hindlimb unloaded and treated with dexamethasone for 14 days (HU+DEXA). After HU+DEXA intervention, animals were euthanized by CO₂ inhalation followed by cardiac puncture.

Muscle recovery (rat):

In a separate experiment, 14-week-old Wistar female rats were hindlimb unloaded for 14 days as described above. Animals were then reloaded to full weight bearing for 24 hours (n=12). After 14 days of HU and 24 hours of reloading, grip force was measured immediately before euthanasia. Rats were euthanized by CO₂ inhalation followed by cardiac puncture.

Implantation of Lewis Lung Carcinoma Cells (LLC) (mouse):

Cancer induction was completed as described (Brown et al., 2017, 2018). Briefly, 8-week-old female mice were injected with 1×10⁶ Lewis Lung Carcinoma (LLC) cells (ATCC, Cat # CRL-1642) in the right hind flank (n=30). After LLC injection, animals were singly housed similar to HU mice. Cancer was allowed to progress for 25–28 days, after which, animals were euthanized through 2% isoflurane inhalation followed by cardiac puncture. Gastrocnemius muscles and tumors were collected for measurement of tissue masses. 8 animals had to be euthanized early due to excessive tumor burden or necrotic skin lesions resulting in a final n of 22. Control animals (n=10) for the hindlimb unloading and LLC mouse experiment were 8 week old singly housed females.

Estrous Cycle monitoring (all):

Monitoring of the estrous cycle was completed as previously described for all rat and mouse studies (Caligioni, 2009; Lim et al., 2020). Using a small pipet tip, ~50μL of ultra-pure H₂O was inserted at the vaginal opening, with care not to fully insert into the vagina. The vaginal opening was flushed 2–3 times with the H₂O to collect vaginal wall cells. Once cells were collected, the sample was pipetted onto a microscope slide and allowed to dry. Once dry, the vaginal cells were stained with 0.1% crystal violet solution in distilled H₂O (Sigma-Aldrich, Cat# C0775-25G). The slides were rinsed with water and then imaged using a white light microscope at 40X magnification. Estrous cycle phase was determined using previously published criteria (Caligioni, 2009). Specifically, proestrus was defined by the predominant presence of nucleated epithelial cells, estrus was defined as predominantly non-nucleated cornified epithelial cells. Metestrus was defined by the presence of nucleated epithelial cells, cornified cells and leukocytes. Diestrus was defined by presence of leukocytes. Time in each phase was calculated by dividing the number of days in that phase by the number of days in the intervention. Proestrus and estrus were combined as one “high hormone” time point, due to the peaks in estrogen and progesterone in proestrus with lingering progesterone during estrus. Metestrus and diestrus were combined as a lower hormonal state (Caligioni, 2009) for analysis. All vaginal lavages for rat and mouse studies were collected at approximately the same time of day for all studies (8:00–10:00AM for rats and 3:00–5:00PM for mice). All estrous cycle ratings for each experiment were completed by one trained researcher. The researcher was completely blinded to condition. Additionally, vaginal smears were cross-validated within the researcher at two separate time points (r = 0.87) and with an additional independent researcher (r = 0.70).

microCT

Femurs were scanned using Microcomputed tomographic (μCT) imaging as previously described (Bouxsein et al., 2010). Scans were performed using a μCT40 tabletop device (Scanco Medical AG, Brüttisellen, Switzerland). Scanning parameters were completed according to guidelines (Bouxsein et al., 2010). Specifically, scans were performed with 15 μm³ isotropic voxel size, 70 kVp and 114 mA peak x-ray tube potential and intensity, 300 ms integration time, and were subjected to Gaussian filtration as previously reported (Ko et al., 2020). All scans were performed by the same experienced research technician within a two week period. Primary outcomes of interest were femoral bone mineral density (BMD) and trabecular bone volume fraction (Tb.BV/TV).

Cell Culture Media

All experiments were completed with C2C12 myoblasts (ATCC, Cat# CRL-1772). Cells were grown in media containing, DMEM (ThermoFisher Scientific, Cat# 11960051) 20% Fetal bovine serum (ThermoFisher Scientific, Cat# 16000044) and 1% penicillin-streptomycin (ThermoFisher Scientific Cat# 15070063). After cells reached ~70% confluence, cells were then differentiated with media containing 2% Hormone-free Fetal Bovine Serum (ThermoFisher Scientific, Cat# 12676029), 1% penicillin-streptomycin, 5% HEPES (ThermoFisher Scientific, Cat # 15630080), and 0.2% Insulin-Transferrin solution (ThermoFisher Scientific, Cat# 41400045) Cells differentiated for ~5 days, at which point experiments were begun.

Hormone treatments

All hormone treatments were completed in serum free DMEM media supplemented with 1% penicillin streptomycin solution. Estradiol (Millipore Sigma, Cat# E3301) was diluted to a concentration of 60pg/mL corresponding to peak serum estrogen concentrations noted in the proestrus phase in female mice (Butcher et al., 1974, 1978; Kramer & Bellinger, 2009; Smith et al., 1975). Progesterone (Millipore Sigma, Cat# P8783) was diluted to a concentration of 30 ng/mL corresponding to peak serum progesterone concentrations noted during the end of proestrus/start of estrus phase of the estrous cycle (Butcher et al., 1974, 1978; Kramer & Bellinger, 2009; Smith et al., 1975). For treatments containing both estrogen and progesterone, estrogen and progesterone were combined at 60pg/mL and 30 pg/mL respectively.

Dexamethasone Treatment

To test the effects of hormones on glucocorticoid included muscle wasting we incubated myotubes in dexamethasone (DEXA). Dexamethasone (Alfa Aesar, CAT# a17590) was dissolved in ethanol then diluted to 100ng/mL in cell culture media for all experiments similar to prior reports (Lee et al., 2018, 2019; Qiu et al., 2018). Ethanol was used as a vehicle control for dexamethasone experiments. Once myotubes were differentiated, myotubes treated with either control (vehicle), dexamethasone supplemented media (DEXA), dexamethasone supplemented media + estradiol (60 pg/mL), dexamethasone supplemented media + progesterone (30ng/mL), dexamethasone supplemented media + estrogen + progesterone (60 pg/mL and 30 ng/mL). Cells were incubated for 24 hours and then analyzed for myotube diameter, protein synthesis via SuNSET (detailed below), and mRNA analysis of genes related to protein anabolism and catabolism.

Lewis Lung Carcinoma Media Treatment

Treatment of cells with Lewis Lung Carcinoma (LLC) conditioned media (LCM) was performed as previously described, with minor modifications (Brown et al., 2018; Puppa et al., 2014). Briefly, C2C12 or LLC cells at ~100% confluence were incubated in 20% FBS growth media. After 24hrs of incubation, media was collected and filtered. Media was then diluted with serum free DMEM cell culture media supplemented with 1% penicillin-streptomycin to a final concentration of 30% conditioned media and 70% serum free DMEM. C2C12 conditioned media, prepared in the same manner, served as a control for these experiments. LCM was then supplemented with estrogen (60pg/mL), progesterone (30ng/mL) or estrogen and progesterone combined (60pg/mL and 30ng/mL). Conditioned media was placed on differentiated myotubes and incubated for 24hrs. Myotubes were then analyzed for myotube diameter and mRNA analysis.

JC1 staining and imaging

JC1 fluorescent dye was used as a fluorescent dye for mitochondrial polarization and myotube diameter imaging. JC1 dye (ThermoFisher, Cat# T3168) was diluted to 2 μg/mL in cell growth media. After atrophic treatments, myotubes were rinsed with phosphate buffered saline (PBS). Myotubes were then incubated in JC1 dye for 30 minutes. After 30 minutes of JC1 incubation, JC1 dye was removed and myotubes were rinsed with PBS and imaged using a Nikon Ti-S inverted epifluorescent microscope (Melville, NY) equipped with FITC and TRITC filters and associated software (NIS-Elements Basic Research, Nikon, Melville, NY). JC1 was quantified as the ratio of red:green fluorescence, where a greater red:green ratio was indicative of greater mitochondrial polarization. Neither cell treatments (Dexamethasone or Lewis Lung Carcinoma treatment) resulted in any differences in JC1 staining between any groups (data not shown).

SunSET Analysis of Protein Synthesis

SunSET analysis was completed as previously described (Brown et al., 2018; Goodman et al., 2011). Briefly, a working concentration of puromycin (75mM, VWR, Cat# 80054-140) was diluted to 1 μM using serum free cell culture media. After atrophic interventions, puromycin solution was placed on myotubes and allowed to incubate for 30 min. Myotubes were then harvested using protein homogenization buffer (recipe previously described elsewhere (Greene et al., 2015). Samples were then loaded into ~10% SDS-polyacrylamide gel (PAGE) and transferred onto PDVF membranes. Membranes were blocked using LiCor Intercept blocking buffer (LiCor, Lincoln, NE, Cat# 927-60001) and incubated in puromycin primary antibody (MilliporeSigma, Burlington, MA, Cat# MABE343) diluted 1:20,000 in blocking buffer. After ~24hrs of primary incubation, membranes were washed with Tris-Buffered Saline and incubated in puromycin secondary (Jackson ImmunoResearch Labs, West Grove, PA, Cat# 115-035-206) diluted to 1:20,000 for ~90 minutes. Membranes were then incubated with WesternSuren PREMIUM Chemiluminescent Substrate (LiCor, Cat# 926-95000) and imaged using LiCor Odyssey Fc Imaging system. Because puromycin becomes incorporated into proteins as they are being transcribed during the 30min incubation period, greater puromycin content was interpreted as greater protein synthesis rates (Goodman et al., 2011; Goodman & Hornberger, 2013). All samples were run on the same membrane for puromycin assay, but image was cropped to better represent groups discussed.

mRNA Analysis

RNA was isolated from either animal soleus tissue or cells as previously described (Greene et al., 2015). After atrophic interventions cells were harvested with 1 mL of Trizol to harvest RNA. Once RNA was isolated, cDNA was synthesized using commercial reagents (SuperScript^™ VILO^™ Master Mix, Cat# 11755050, ThermoFisher Scientific,). cDNA for either animal tissue or cells were analyzed using SYBR primers or Taqman probes as appropriate using a QuantStudio 3 Realtime PCR instrument or ABI 750 Fast Real-time PCR Instrument and the ^−ΔΔCt method. (ThermoFisher Scientific, Waltham, MA). Primer sequences are found in Table 1. Taqman probes included: 18s (Clone #Mm03928990_g1), Lc3 (Clone #Mm00458725_g1), Redd1 (Clone #Mm00512504_g1), Deptor (Clone #Mm01195339_m1), Atrogin (Clone #Mm00499523_m1), Murf1 (Clone #Mm01185221_m1), p62 (Clone #Mm00448091_m1), NfKB (Clone #Mm00476361_m1), Foxo3 (Clone #Mm01185722_m1), MyoD (Clone #Mm00440387_m1), MyoG (Clone #Mm00446194_m1), Igf1 (Clone #Mm00439560_m1), Tgfβ (Clone # Mm01178820_m1), Tnfα (Clone # Mm00443258_m1). All samples were normalized to 18s values, which did not differ between groups.

Table 1:

Primer sequences for primers used in this study

Primer	Forward	Reverse
Pax7	GAT TAG CCG AGT GCT CAG AAT CAA G	GTC GGG TTC TGA TTC CAC GTC
MyoD	GAC CCA GAA CTG GGA CAT GGA	TGA GTC GAA ACA CGG ATC ATC ATA G
MyoG	AACTACCTTCCTGTCCACCTTCA	GTCCCCAGTCCCTTTTCTTCCA

Statistical Analysis

Data were analyzed by correlation analysis, t-test, or simple 1-way ANOVA with Tukey post-hoc as appropriate. For animal experiments, significance was denoted at p<0.05. For cell culture experiments, due to the limited biological replicates, we considered p<0.10 moderate evidence for effect and p<0.05 strong evidence for effect. These differences are denoted in cell culture figures. All data were analyzed and visualized with GraphPad Prism Software (San Diego, California).

Results

Estrous cycle is disrupted by hindlimb unloading, and correlates with muscle size in both mice and rats

We hindlimb unloaded (HU) 8-week-old female mice for 7 days, while assessing estrous cycle stage through daily vaginal lavages (Figure 1A). After 7 days of HU, there was no significant difference between control (CON) and HU mice in either percentage of time spent in either proestrus or estrus (P/E, p=0.171) nor in percentage of time spent in diestrus or metestrus (D/M, p=0.149) (Figure 1B & C). We then extended the hindlimb unloading intervention to 14 days in female rats. We found 14 days of HU to be sufficient to result in ~20% less time spent in P/E (p=0.005) and ~20% more time spent in D/M (p=0.003) in HU compared to CON rats (Figure 1D & 1E). However, in both mice and rats, time spent in either P/E or D/M correlated with gastrocnemius mass. Indeed, less time spent in D/M correlated with greater gastrocnemius mass (Figure 1F & 1G, r = −0.51, p=0.034 in mice and r = −0.63, p=0.016 in rats, respectively), whereas greater time spent in P/E correlated with larger gastrocnemius mass (Figure 1H & 1I, r = 0.43, p=0.074 in mice and r = 0.64, p=0.013 in rats, respectively). Of note, the overall relationship between these variables was stronger with longer durations of HU. Though we should acknowledge we cannot specifically conclude if these relationships were due to longer durations of HU or species differences. Regardless, these data imply disuse atrophy corresponds to estrus cycle changes. Because time spent in D/M mirrored P/E after 7 days and 14 days of HU, subsequent data are only presented as time spent in D/M.

Figure 1:

Changes in the estrous cycle with 7 and 14 days of hindlimb unloading (HU). A. Representative images for defining different stages of the estrous cycle from rats. Magnification 40X. B. Percent of time spent in either proestrus or estrus during 7 days of HU in mice. C. Percent of time spent in either metestrus or diestrus during 7 days of HU in mice. D. Percent of time spent in either proestrus or estrus during 14 days of HU in rats. E. Percent of time spent in either metestrus or diestrus during 14 days of HU in rats. F. Correlation between time spent in either metestrus and diestrus and gastrocnemius mass after 7 days of HU in mice. G. Correlation between time spent in either metestrus and diestrus and gastrocnemius mass after 14 days of HU in rats. H. Correlation between time spent in either proestrus or estrus and gastrocnemius mass after 7 days of HU in mice. I: Correlation between time spent in either metestrus or diestrus after 14 days of HU in rats. ** denotes p<0.05. Dotted lines represent 95% confidence intervals. Data are presented as Mean ± SD.

HU-related changes in the estrous cycle correlate with differences in multiple musculoskeletal outcomes

Based on data demonstrating HU to affect the estrous cycle and subsequent muscle mass in both mice and rats, we then sought to investigate how these alterations to the estrous cycle may correlate with other musculoskeletal outcomes. In 14 day HU female rats, time spent in D/M strongly correlated with changes in grip force after 14 days of unloading (Figure 2A, r = −0.71, p=0.004), suggesting a relationship between time spent in a low sex steroid hormone state (i.e., diestrus/metestrus) and voluntary muscular function after 14 days of HU. Because bone quality and density are known to be affected by sex hormones (Cauley, 2015), we next investigated skeletal outcomes in relation to estrous cycle. Trabecular bone mineral density in the distal femoral metaphysis appeared to correlate with estrous cycle phases; however, this relationship did not reach statistical significance (Figure 2B, r = −0.51, p=0.061 respectively). A similar, albeit less pronounced, pattern was also noted in femoral trabecular thickness in relation to estrous cycle phase (Figure 2C, r= −0.37, p=0.187 respectively). Taken together, these combined data demonstrate HU is sufficient to result in aberrations in the estrous cycle, and by 14 days these estrous cycle aberrations are correlated with reductions in muscle strength and may be related to skeletal health.

Figure 2:

Correlation of estrous cycle phase and musculoskeletal health in rats. A. Correlation between time spent in either metestrus or diestrus and percent change in grip force strength after 14 days HU. B.. Correlation between time spent in either metestrus or diestrus and bone mineral density (BMD) after 14 days HU. C. Correlation between time spent in either metestrus or diestrus and trabecular thickness (Tb. Thickness) after 14 days HU. Dotted lines represent 95% confidence intervals.

Changes in estrous cycle influence regulators of myogenesis and influence muscle recovery after a period of disuse

Next, we sought to understand how alterations to the estrous cycle may affect modulators of myogenesis and subsequent muscle recovery after disuse. Only HU animals are graphed and quantified because CON Ct values were used to quantify fold-difference in HU animals compared to CON and graphing CON values would violate the assumption of independence necessary for correlational analysis. In 14-day HU female rats, we saw no relationship between satellite cell marker Pax7 mRNA content and estrous cycle markers (r = −0.17, p=0.686 respectively, Figure 3A). However, in these same animals we observed a fairly strong but non-significant relationship between MyoD mRNA content and estrous cycle markers (Figure 3B), with less time spent in D/M correlated with greater overall MyoD mRNA content (r = −0.70, p=0.082). Additionally, MyoG mRNA content displayed a similar relationship to MyoD, with greater time spent in D/M generally associated with lower MyoG (r = −0.57, p=0.179, Figure 3C). While these relationships did not reach statistical significance, the overall pattern, particularly between estrous cycle and MyoD and MyoG, appear to imply a correlational relationship between estrous cycle and myogenesis markers. Though we should note all mRNA analysis were conducted in the soleus muscle and we cannot rule out the possibility that different muscle phenotypes (such as the gastrocnemius) may demonstrate a different relationship between estrous cycle and cellular signaling.

Figure 3:

Relationship between estrous cycle, myogenic markers and muscle recovery. A. Correlation between Pax7 mRNA content and percent time in either metestrus or diestrus during 14 days of HU. B. Correlation between MyoD mRNA content and percent time in either metestrus or diestrus during 14 days of HU. C. Correlation between MyoG mRNA content and percent time in either metestrus or diestrus during 14 days of HU. D. Correlation between grip strength after 14 days of HU and 24 hours of recovery and percent time in either diestrus or metestrus. E. Correlation between percent change in grip strength from 14 days of HU to 24 hours of recovery and percent time in either diestrus or metestrus. Dotted lines represent 95% confidence intervals.

Based on these relationships of muscular strength and myogenic genes and estrous cyclicity, we hypothesized animals that spent more time in P/E and less time in D/M would recover more fully after a period of disuse. We hindlimb unloaded female rats for 14 days, after which animals were reloaded at full bodyweight for 24 hours. Rear paw grip strength was measured before HU, after 14 days of HU, and after 24 hours of recovery. We found time in time in D/M was negatively associated with maximal grip strength after 24 hours of recovery (r = −0.58, p=0.048, Figure 3D). However, percent change in grip strength from 14 days of disuse to 24 hours of recovery was not correlated by D/M (r = −0.25, p=0.433, Figure 3E). Taken together, these data suggest that greater time spent in a low hormonal state slow muscle recovery after a period of disuse. These relationships appear to be driven by greater losses in muscle strength and myogenic capacity during the progression of disuse and not necessarily altered recovery trajectory after the cessation of disuse.

Stronger atrophic pathologies induce greater aberrations to the estrous cycle and muscular strength

Next, we sought out to determine how the relative “intensity” of muscle atrophy may alter these relationships between estrous cycle and muscle outcomes. Female rats underwent HU for 14 days with concurrent treatment of 3.75mg/kg/day of dexamethasone(Aru et al., 2019; Chiu et al., 2011) (HU+DEXA) to simulate ICU-associated muscle loss (i.e., disuse atrophy + glucocorticoid treatment)(Yang et al., 2018). We found HU+DEXA to enhance estrous cycle and muscular aberrations during disuse. Specifically, HU+DEXA animals spent more time in D/M compared to either CON or HU (~60% and 40% greater respectively, p<0.0001, Figure 4A).

Figure 4:

Relationship between estrous cycle stage and musculoskeletal outcomes using a combination of atrophic stimuli. A. Time spent in either diestrus or metestrus between control (CON), hindlimb unloaded (HU) or hindlimb unloaded combined with dexamethasone (HU+DEXA) for 14 days. B. Correlation between percent change in grip strength after 14 days of intervention and time spent in diestrus or metestrus. C. Correlation between muscle endurance and time spent in diestrus or metestrus.

These exacerbated changes in the estrous cycle corresponded to greater decreases in grip strength. Importantly, the relationship between time spent in D/M in relation to grip strength was enhanced compared to HU alone, likely due to greater variability in both variables (r = −0.87, p<0.0001 respectively, Figure 4B). We further examined if inclusion of dexamethasone treated animals contributed to the previously noted relationship between 24-hour muscle recovery and estrous cycle. Similar to prior observations, we find less time spent in D/M is associated with greater strength after 24 hours of recovery (r = −0.70, p=0.004). Overall, these experiments implied more severe atrophy (i.e., hindlimb unloaded combined with glucocorticoids) is associated with greater alterations to estrous cycle, worse musculoskeletal outcomes, and an overall stronger relationship between estrous cyclicity and musculoskeletal health.

Maintenance of estrous cycle during cancer progression maintains muscle mass despite tumor burden.

We next investigated a different form of muscle atrophy, cancer associated muscle wasting, also known as cancer cachexia. We used a commonly known Lewis Lung Carcinoma (LLC) mouse model, which is generally considered “mild” compared to other cachexia models(Rosa-Caldwell, Fix, et al., 2020). We note after 25–28 days of cancer growth, there were no differences in time spent in D/M between control (CON) and LLC mice (Figure 5A, p=0.902). Contrasting HU animals (both mice and rats), the LLC mice showed no relationship between gastrocnemius mass and amount of time spent in D/M (Figure 5B, r = −0.03, p=0.861). Importantly, as previously reported in these animals, there were no pair-wise differences between CON and LLC gastrocnemius masses and no mice that became acyclic(Lim et al., 2020). While estrous cycle and muscle mass appeared protected during LLC in female mice, these protections were not related to reduced tumor burden, with no relationship between estrous cycle and tumor burden in these animals (Figure 5C, r<0.05, p=0.986). Of note, in the prior study of these animals, female mice had greater tumor burden compared to males (~1.84 v. 2.93 grams)(Lim et al., 2020). Yet despite the larger tumor burden in females, overall muscle mass was maintained compared to males(Lim et al., 2020). These data appear to imply that there when there is no alteration to estrous cycle, there appears to be limited or no muscle loss. However, at this point we cannot determine the causality of these relationships.

Figure 5:

Relationship between estrous cycle and muscle size during Lewis Lung Carcinoma (LLC) growth. A. Time spent in either diestrus or metestrus after 25–28 days of LLC tumor growth. B. Correlation between gastrocnemius mass and time spent in either diestrus or metestrus. C. Correlation between tumor size and time spent in either diestrus or metestrus. Dotted lines represent 95% confidence intervals. Data are presented as Mean ± SD.

Estrogen enhances protein synthetic rate, which may be sufficient to protect muscle mass against atrophic stimuli.

Our in vivo data demonstrate: certain muscle pathologies are associated with alterations in the estrous cycle and these alterations of the estrous cycle (or lack thereof) appear to correlate with differences in muscle atrophy. Therefore, we sought to further investigate possible cellular mechanisms underlying these phenotypes using in vitro models. Preservation of muscle mass is presumably at least partially mediated through hormonal signaling, with two primarily ovary-derived hormones being estradiol and progesterone. To understand the individual and combined effects of these hormones, C2C12 myotubes were incubated in media containing an atrophic stimulus or atrophic stimulus in addition to estradiol (60 pg/mL), progesterone (30 ng/mL) or estradiol and progesterone combined (60 pg/mL and 30 ng/mL, respectively). These values were chosen because they generally correspond to peak estradiol and progesterone serum values during proestrus (Butcher et al., 1974, 1978; Kramer & Bellinger, 2009; Smith et al., 1975).

Current technology did not allow us to specifically induce disuse atrophy in vitro; however, considering that dexamethasone contributed to the relationship between muscle loss and estrous cycle alterations, we used dexamethasone as an atrophic treatment to investigate possible cellular modulators of noted phenotypic alterations. Twenty-four hours of dexamethasone (DEXA) treatment was sufficient to result in ~35% lower myotube diameter compared to healthy control myotubes (Figure 6A). Estradiol-treated myotubes (DEXA+E) were ~37% larger compared to DEXA alone. However, dexamethasone combined with progesterone (DEXA+P) or estradiol and progesterone (DEXA+E+P) did not mitigate atrophy (Figure 6A). We then investigated protein synthetic function with the well-established SuNSET technique (Goodman & Hornberger, 2013), where we find DEXA+E to have ~60% greater protein synthesis compared to DEXA, DEXA+P or DEXA+E+P, suggesting estradiol stimulated protein synthesis likely accounts for the myotube diameter protection (Figure 6B). Additionally, we measured mRNA content for various regulators of muscle anabolism and catabolism. Overall, hormone treatments tended to attenuate the induction of muscle atrophic markers (Figure 7A), in particular Atrogin and p62. However, contrary to our expectations, sex steroid hormone treatments also tended to lower mRNA content of growth factor Igf1, and myogenic markers MyoD and MyoG (Figure 7B). Interestingly, DEXA+E+P appeared to attenuate induction of Deptor, an inhibitor of mTOR (Kazi et al., 2011), which has been shown to be induced in both LLC and HU models (Brown et al., 2018; Rosa-Caldwell et al., 2021). Taken together, these in vitro data appear to suggest estradiol is strong mediator of muscle preservation during dexamethasone-induced atrophy, its effect being largely driven by greater protein synthetic rates, which may be acting independently of dexamethasone.

Figure 6:

In vitro data investigating influence of estradiol (E) and progesterone (P) on dexamethasone (DEXA) induced changes in myotubes. A. Myotube diameter after 24 hours of dexamethasone (DEXA, 100ng/mL) incubation with or without E (60pg/mL) and/or P (30ng/mL) added concurrently with the dexamethasone. Inset graphs represent control (CON) myotubes incubated with vehicle controls compared to DEXA. Larger graphs compare DEXA alone compared to DEXA+E, DEXA+P or DEXA+E+P. The dotted line represents the mean myotube diameter for CON myotubes. B. Protein synthesis measured by puromycin incorporation and immunoblot quantification. Inset graphs represent control (CON) myotubes incubated with vehicle controls compared to DEXA. Larger graphs compare DEXA alone compared to DEXA+E, DEXA+P or DEXA+E+P. * denotes p<0.05, ^# denotes p <0.10. All samples were run on the same membrane for puromycin assay, but image was cropped to better represent groups discussed. Data are presented as Mean ± SD

Figure 7:

In vitro data investigating influence of estradiol (E) and progesterone (P) on dexamethasone (DEXA) induced changes to mRNA content in myotubes. A. mRNA content of various cellular regulators of protein catabolism. Horizontal graphs quantify CON v. DEXA for a particular gene. Large vertical graph represents how DEXA+E, DEXA+P or DEXA+E+P compared to DEXA alone, which was set to zero. B. mRNA content for regulators of protein anabolism, myogenesis or inhibition of mTOR. Horizontal graphs quantify CON v. DEXA for a particular gene. Large vertical graph represents how DEXA+E, DEXA+P or DEXA+E+P compared to DEXA alone, which was set to zero. * denotes p<0.05, ^# denotes p <0.10. Data are presented as Mean ± SD. Note: due to elongation of the x-axis the SD for some groups may be difficult to see.

Absence of female sex steroid hormones is sufficient for muscle atrophy to occur during exposure to tumor-conditioned media

Finally, because prior work has found female sex steroid hormones protective against musculoskeletal degradation in female Apc^Min/+ (Counts et al., 2019), we attempted to investigate in vitro if sex steroid hormones may have possibly accounted for lack of muscle wasting in our LLC mice. C2C12 cells were cultured with Lewis Lung Carcinoma conditioned media (LCM)(Brown et al., 2018) with or without estradiol (LCM+E), progesterone (LCM+P), or estradiol combined with progesterone (LCM+E+P), or a vehicle control (CON) (Further described in Materials and Methods). After 24 hours of incubation, LCM resulted in ~25% lower myotube diameter compared to CON (Figure 8A). However incubation with any of the hormones was sufficient to protect myotube diameter from LCM-induced myotube atrophy (Figure 8A).

Figure 8:

In vitro data investigating influence of estradiol (E) and progesterone (P) on Lewis Lung Carcinoma induced muscle atrophy. A. Myotube diameter after 24 hours of Lewis Lung Carcinoma conditioned media (LCM, 30% conditioned media in serum free DMEM) incubation with or with or without E (60pg/mL) and/or P (30ng/mL) added concurrently with the LCM. Inset graphs represent control (CON) myotubes incubated with vehicle controls compared to LCM. Larger graphs compare LCM alone compared to LCM+E, LCM+P or LCM+E+P. The dotted line represents the mean myotube diameter for CON myotubes. B. mRNA content of regulators of mitochondrial quality control. Horizontal graphs quantify CON v. LCM for a particular gene. Large vertical graph represents how LCM+E, LCM+P or LCM+E+P compared to LCM alone. * denotes p<0.05, ^# denotes p <0.10. Data are presented as Mean ± SD. Note: due to elongation of the x-axis the SD for some groups may be difficult to see.

Because deterioration of mitochondrial quality is speculated to be a predominant driver of cancer-induced muscle loss (Brown et al., 2017), we measured mRNA content for regulators of mitochondrial quality control. Incubation with hormones generally attenuated induction of mitochondrial fission and mitophagy markers, though these differences did not reach statistical significance (Figure 8B). Specific to inflammatory makers and protein turnover rates, we do not find any key regulators of protein catabolism or anabolism altered in such a way to fully explain our myotube phenotype (Figure 9A & 9B). Paradoxically, some markers of protein catabolism, such as Atrogin, were greater with hormone incubation, as were inhibitors of mTORl, Redd1 and Deptor (Figure 9A& 9B). However, LCM+E+P overall had lower Tgfβ content compared to LCM, which may correspond to the noted myotube diameter protections with hormone incubations. Regardless, though there was no clear signaling pathway explaining estradiol and progesterone-moderated protection of myotube diameter, our data imply altered sex hormonal status (i.e. low hormones) is sufficient for the development of LCM-induced atrophy. However, this low hormonal state does not appear to develop in vivo mice which corresponds to no muscle atrophy, overall implying hormonal status may be influencing the progression and development of muscle atrophies, particularly in cancer cachexia.

Figure 9:

In vitro data investigating influence of estradiol (E) and progesterone (P) on Lewis Lung Carcinoma induced changes to mRNA content. A. mRNA content for cellular regulators of protein catabolism. Horizontal graphs quantify CON v. LCM for a particular gene. Large vertical graph represents how LCM+E, LCM+P or LCM+E+P compared to LCM alone. B. mRNA content for regulators of protein anabolism, myogenesis or inhibition of mTOR Horizontal graphs quantify CON v. LCM for a particular gene. Large vertical graph represents how LCM+E, LCM+P or LCM+E+P compared to LCM alone. * denotes p<0.05, ^# denotes p <0.10. Data are presented as Mean ± SD. Note: due to elongation of the x-axis the SD for some groups may be difficult to see.

Discussion

We evaluated the relationship between estrous cycle aberrations in female rodents across multiple modes of muscle atrophy and recovery and found that disuse atrophy resulting from hindlimb unloading was correlated with estrous cycle changes characterized by reduced estrogen and progesterone levels. Furthermore, these estrous cycle changes correlated with musculoskeletal outcomes such as changes in muscle mass and strength. However, other types of muscle atrophy, such as that induced by Lewis Lung Carcinoma, were not associated with estrous cycle changes in mice, which corresponded to a less cachectic phenotype. Taken together, these results imply a complex and perhaps condition-specific relationship between the estrous cycle and skeletal muscle health.

Surprisingly, alterations to the estrous cycle developed within 7 days of disuse. It is of course difficult to determine if these estrous cycle changes contribute to muscle atrophy or vice versa, or if the two are independent and are simply direct consequences of the specific intervention. A recent study established that female mice demonstrate reduced protein turnover and accelerated muscle loss within 24–48 hours of disuse compared to males (Rosa-Caldwell et al., 2021). Therefore, it is possible the rapid induction of muscle atrophy and decrease in protein turnover within the first 24–48 hrs is sufficient to instigate initial estrous cycle changes, which then persist over the course of disuse. Conversely, it is also possible the initiation of disuse is sufficient to elicit subtle changes to hormonal secretion, which in turn, facilitates and mediates muscle loss during the development of disuse. In fact, it is well documented that hindlimb unloading induces a transient increase in corticosterone in rodents, which is typically resolved after 4–6 days (Knox et al., 2004; Ortiz et al., 1999; Tou et al., 2004). Given that the estrous cycle and corticosterone are regulated by the hypothalamic-pituitary axis, it is possible that the stress of hindlimb unloading increases secreted corticosterone. Greater corticosterone content, in turn, limits secretion of luteinizing and follicle-stimulating hormone, thus altering the estrous cycle and contributing to further muscle loss. Alternatively, the stress response and estrous cycle alterations may occur concurrently with the muscle catabolic response and these two processes are only parallel events, and do not directly contribute or act upon each other. More work is needed to further understand the complexities of these relationships. Regardless, the current data clearly demonstrate estrous cycle alterations correlate with musculoskeletal outcomes during disuse in both mice and rats, with a lower estrogenic profile associated with reduced musculoskeletal health.

Notably, we find the more marked the disuse atrophy, the stronger the relationship between estrous cycle cyclicity and musculoskeletal outcomes. The addition of dexamethasone to HU resulted in greater disruption of the estrous cycle and subsequent muscle atrophy. These data suggest a linear relationship between estrous cycle disruption and musculoskeletal outcomes is conserved, or even strengthened, as the intensity of the atrophic stimuli increase. These novel data highlight that atrophic stimuli can interact to additively influence both hormonal cyclicity and muscle quality. This combination of atrophic stimuli has important clinical ramifications because atrophic stimuli rarely occur as isolated events. For example, in many patients, disuse atrophy is combined with glucocorticoid treatment commonly in ICU settings (Yang et al., 2018), and these data demonstrate muscle atrophies are synergistic with each other.

Additionally, our in vitro data strongly suggest that estrogen could greatly influence muscle size associated with glucocorticoid-associated atrophy, likely through enhanced protein synthesis (potentially mediated by decreased inhibition of mTOR through lower Deptor content) and suppressed degradative signaling (lower Atrogin and p62 content). These data overall demonstrate sex steroid hormone status influences mechanisms responsible for muscle size during glucocorticoid-induced atrophy, building upon prior literature on this topic (Spangenburg et al., 2012).

Contrasting disuse atrophy, Lewis Lung Carcinoma, a well-established model of muscle atrophy in males (Rosa-Caldwell, Fix, et al., 2020), did not alter estrous cycle nor muscle size in female mice. Other works using a colorectal model of cancer-cachexia (Apc^Min/+) have found muscle loss in female mice, but generally only in female mice that become acyclic (~30% of animals) (Hetzler et al., 2017). Given prior evidence that alterations in the estrous cycle are associated with muscle loss in cancer-cachexia (Hetzler et al., 2017) and that we found maintenance of the estrous cycle in tumor-bearing non-atrophied mice, estrous cyclicity or associated hormonal secretion appear critical for the maintenance of muscle mass in this condition. One additional piece of evidence that suggests sex steroid hormones may be underlying these differences is our in vitro data showing atrophy of C2C12 cells cultured with Lewis Lung Carcinoma conditioned media (LCM) without hormones. Yet, myotube diameter was preserved with the inclusion of sex steroid hormones estradiol and progesterone, suggesting these hormones facilitate muscle mass maintenance during atrophic stimuli. These data are further corroborated by research utilizing an estradiol pellet transplant in ovariectomized Apc^Min/+ mice and finding estradiol supplementation is sufficient to protect against cachexia in ovariectomized animals (Counts et al., 2019). Taken together, these data suggest the degree of estrous cycle dysregulation and cachexia development in females varies depending on cancer type. However, physiological processes interacting to preserve or alter the estrous cycle and associated hormonal secretion remains unknown and warrant further investigation.

A particularly interesting finding in the present study was that estrous cycle alterations may also impact muscle recovery. Prior results in rodents as well as clinical data suggest that given sufficient recovery time, muscle mass and strength will recover from disuse atrophy (Petersen et al., 2017; Scott et al., 2020; Shimkus et al., 2018). However, given the relationship between estrous cycle and musculoskeletal outcomes, alterations to estrous cycle and subsequent hormonal profiles could delay recovery. Prior work has found estrogen status to be an important modulator of muscle regeneration after exercise induced muscle damage (Tiidus et al., 2001). And recent evidence strongly implicates ERβ as a mediator of muscle regeneration and presumably recovery (Seko et al., 2020; Velders et al., 2012). Therefore, it is possible that lower serum estradiol concentrations observed in association with muscle atrophy may result in reduced ERβ activation, which, in turn, may slow muscle recovery after a period of muscle loss. Additionally, given that other non-pathological stimuli are known to alter sex steroid hormone profiles, such as low energy availability commonly found in astronauts, female athletes, and female service members (Laurens et al., 2019; Logue et al., 2020; O’Leary et al., 2020), this relationship between estrous/menstrual cycles and muscle recovery may be an important consideration for future training and recovery paradigms.

The scientific community has understood the importance of estradiol itself for various musculoskeletal outcomes for decades. In fact, the loss of estrogens associated with menopause has been associated with lower bone mineral density and muscle mass (Collins et al., 2019; Spangenburg et al., 2012). Other recent works have further described the mechanistic actions of estradiol and associated ER-receptors for muscle physiology, such as facilitating oxidative metabolism (LaBarge et al., 2014) and more recently, moderating muscle regeneration through ERβ receptor activation (Seko et al., 2020; Velders et al., 2012). Additionally, the scientific literature has also begun to elucidate how progesterone may influence muscle health, such as increased mitochondrial polarization and metabolism through a mitochondrially-embedded progesterone receptor (Bottje et al., 2017; Dai et al., 2013; Mir et al., 2013). Therefore, it is not surprising that alterations to estradiol and progesterone serum concentrations affect musculoskeletal health. However, the more interesting finding of this study is that different forms of muscle atrophy (disuse vs. cancer) appear to have different associations with estrus cycle cyclicity and corresponding musculoskeletal outcomes. These data may partially explain different phenotypic outcomes between males and females across different muscle pathologies (Rosa-Caldwell & Greene, 2019).

Given the design of this manuscript there are limitations that should be acknowledged. From the current data, we cannot establish causality for estrous cycle changes and muscle atrophy. Further studies in ovariectomized animals would be necessary to better understand these relationships. Additionally, there is a possibility that species differences between mice and rats may confound some of our results in ways we can not necessarily predict; however the relative stability of our findings across species suggests these estrous cycle disruptions during atrophic stimuli are conserved across mammalian species. Additionally, we did not measure uterine masses in these studies, which would further clarify this estrous cycle-muscle size relationship.

In conclusion, disuse-associated muscle atrophy is associated with disruption of estrous cyclicity, characterized by decreased time in proestrus/estrus stages, and overall lower estradiol levels. These changes to sex hormone profiles correlate to musculoskeletal alterations during disuse atrophy. However, the estrous cycle did not appear altered in a murine model of cancer-cachexia, which was associated with preserved muscle mass. The association of detrimental muscle effects with disruption of estrous cyclicity suggests that sex steroid hormone alterations during atrophic stimuli may be an important consideration in the pathophysiology of muscle loss in females and may warrant further investigation.

New Findings:

What is the central question of this study?

Is the estrous cycle affected during disuse atrophies and if so, how do estrous cycle changes relate to musculoskeletal outcomes?

What is the main finding and its importance?

Rodent estrous cycles are altered during disuse atrophy, which corresponds to musculoskeletal outcomes. However, the estrous cycle does not appear changed in Lewis Lung Carcinoma, which corresponded to no differences in muscle size compared to healthy controls. These findings suggest a relationship between estrous cycle and muscle size during atrophic pathologies.

Data Availability Statement

All data are available upon request to the corresponding author.