Skip to main content
NCBI home page
American Journal of Cancer Research logoLink to American Journal of Cancer Research
. 2021 Nov 15;11(11):5726–5742.

Increased lactate in AML blasts upregulates TOX expression, leading to exhaustion of CD8+ cytolytic T cells

Ying Chen 1,2,3,4, Zhongxin Feng 2,3,4, Xingyi Kuang 2,3,4, Peng Zhao 1,2,3,4, Bingqing Chen 2,3,4, Qin Fang 5, Weiwei Cheng 2,3,4, Jishi Wang 2,3,4
PMCID: PMC8640829  PMID: 34873490

Abstract

Recently, the role of lactate as merely an end product of cancer cell metabolism has been reassessed. Lactate has been implicated in more biological processes than previously understood and drives tumor progression. Here, we demonstrated that the bone marrow lactate concentrations in acute myeloid leukemia (AML) patients were substantially higher than those in their healthy control counterparts. Moreover, AML blasts from bone marrow expressed significantly higher lactate dehydrogenase-A (LDHA) levels. Further studies revealed that LDHA expression was regulated through the HIF1α pathway. Elevated lactate levels were indicative of alterations in CD8+ T cell cytolytic phenotype and activity. An in vitro study showed that the lactate treatment group had significantly higher percentages of CD8+ TEM and CD8+ TEMRA cells as well as higher PD-1 expression in these cells than the control group. Lactate induced the loss of the effector function of CD8+ T cells by altering lytic granule exocytosis. T cell dysfunction is characterized by an increase in terminally differentiated phenotypes, sustained expression of PD-1, and accelerated decline of cytolytic competence. Moreover, the TOX gene was found to be correlated with lactate production and implicated in CD8+ T cell dysfunction. AML patients in complete remission after chemotherapy had markedly lower lactate concentrations, reduced CD8+ TEM and CD8+ TEMRA cells and PD-1 expression, and increased perforin and granzyme B. However, no difference was found in the relapsed patients. The study presented here has established lactate as a predictive biomarker for patient response to antitumor therapies and demonstrated that targeting this gene in AML patients could be a meaningful precision therapeutic strategy.

Keywords: CD8+ T cell, lactate, programmed death-1, TOX, acute myeloid leukemia

Introduction

Acute myeloid leukemia (AML) is an aggressive haematological malignancy that is often associated with poor overall survival. Despite the significant efforts made in the treatment of AML, unmet clinical needs remain [1]. With the emergence of novel molecular technologies and improved genetic understanding, cancer immunotherapy has garnered significant research interest following initial successes in checkpoint blockade intervention and T cell engineering. Rapidly evolving immunotherapeutic modalities hold significant promise for transforming the treatment paradigm for AML [2-4]. However, curative treatment for AML remains a bottleneck. A deeper understanding of the interactions between tumor cells and T cells and the mechanisms underlying CD8+ T cell functional attenuation is essential.

CD8+ T cells are mainly comprised of four differentiation subsets, designated as follows: naïve T (Tnaïve) cells, central memory T (TCM) cells, effector memory T (TEM) cells, and effector memory cells re-expressing CD45RA. The linear differentiation model proposes that naïve CD8+ T cells first arise with coexpression of CD45RA and CCR7 and, following antigenic stimulation, differentiate into TCM and TEM subsets, characterized by lack of CD45RA and CCR7 expression, respectively. Upon further stimulation, T cells develop a terminally differentiated phenotype and re-express CD45RA [5,6]. TEM and TEMRA cells exhibit distinct expression profiles and are associated with effector functions that mediate apoptosis of tumor cells [7]. Chronic antigen stimulation, however, can lead to gradual loss of effector function and T cell depletion [8,9]. The exhausted phenotype of T cells is often associated with the coexpression of immune inhibitory signals (e.g., PD-1, CTLA4, Tim-3 and Lag-3) that suppress antitumor immunity [10]. Moreover, exhausted CD8+ T cells are often associated with reduced levels of cytotoxic proteins such as perforin and granzyme B, which are responsible for the maintenance of T cell proliferation and direct destruction of tumor cells [11]. The transcriptional regulator thymocyte selection-associated high-mobility group box protein (TOX) has been implicated in various stages of T cell differentiation. Several recent studies correlated TOX overexpression with T cell exhaustion in scenarios of persistent infection and tumors [12-16]. Overexpression of TOX has also been robustly correlated with high frequencies of PD-1 and Tim-3. In addition, TOX was found to be a critical regulator of the expression of several other inhibitory receptors (e.g., Pdcd1, Lag3, and Cd244) [17,18].

Increasing research suggests that the release of tumor metabolites promotes immunosuppression through extracellular matrix remodeling and drives CD8+ T cells toward exhaustion [19]. For decades, lactate has been viewed merely as a by-product of cellular metabolism; however, its potential as a key regulator in cancer development has only been recognized in recent years. Abnormal lactate metabolism has been correlated with poor prognosis and disease-free survival in several cancer types [20-25]. Whereas lactate has been studied extensively as an immunosuppressive metabolite associated with both impaired innate and adaptive immunity [26-29], the mechanisms governing this process remain incompletely understood.

The present study demonstrates for the first time that lactate production in AML blasts promotes exhaustion of effector T cells and downregulation of perforin and granzyme B by overexpressing TOX in CD8+ T cells, thereby incapacitating the mechanisms required for the destruction of tumor cells.

Materials and methods

Patient and healthy donor material

The study protocol was approved by the ethics committee of the Affiliated Hospital of Guizhou Medical University. All patients recruited provided written informed consent to participate in the study in compliance with the Declaration of Helsinki. The baseline characteristics of these patients are presented in Table S1. Bone marrow mononuclear cells (BMMCs) were obtained from healthy donors and AML patients at diagnosis and after chemotherapy. Complete remission (CR) was achieved when the following criteria were met: blasts present in the bone marrow (BM) <5% as determined by morphological evaluation, neutrophil count >1×109/L, and platelet count >1×1011/L.

Primary AML blast cells and cell lines

Enrichment of CD34+ cells from bone marrow was performed using human CD34+ microbeads purchased from Miltenyi biotec. OCI-AML3 and Kasumi-1 cells were kindly provided by Guizhou Provincial Laboratory of Haematopoietic Stem Cell Transplantation Center. Culturing was performed in RPMI 1640 medium comprising 10% foetal calf serum, 2 mmol/L L-glutamine, 100 U/mL penicillin, and 100 mg/mL streptomycin. Each cell line was tested for the presence of mycoplasma, and STR analysis was implemented for identity confirmation.

In vivo model of acute myeloid leukemia

Female NOD/SCID mice (Model Organisms Centre, Shanghai, China) were used for the in vivo experiments. All protocol procedures on mice conformed to the institutional policy on the animal use of Guizhou Medical University, China. The in vivo model was established as previously reported [30]. The mice were irradiated at a dose of 2.5 Gy. On day 0, the mice received an intravenous administration of 2×105 OCI-AML3 cells. At day 3, the mice received 107 in vitro preactivated T cells and were subsequently assigned to 3 groups by randomization, namely, 2 treatment groups and 1 control group, each containing 14 mice. After two weeks, six mice from each group were sacrificed, followed by femoral bone marrow aspiration. Survival analyses were performed using Kaplan-Meier curves.

CD8+ T cell isolation and in vitro stimulation

Mononuclear cells were isolated by density gradient centrifugation, followed by T cell purification using magnetically labelled beads from Miltenyi Biotech. Thereafter, autologous leukemic blasts with a stable knockout of LDHA that were exposed to 80 Gy of radiation were mixed with purified T cells (at a responder-to-stimulator ratio of 1:1), which were then incubated for 96 h in RPMI-1640 medium comprising 10 mM HEPES, 10% heat-inactivated FCS, 100 U/ml penicillin and 100 ng/mL streptomycin. The variance of individual data due to different donors was not statistically significant.

Flow cytometry

For staining, antibodies directed against CD3, CD8, CCR7 (CD197), CD45RA, PD-1 (CD279), and TOX were used. Detailed information on the antibodies and manufacturers is presented in Table S2. A fixation and permeabilization step were performed with the Intracellular Fixation and Permeabilization Buffer Set (eBioscience) following the manufacturer’s instructions. Samples were analysed on an LSR II flow cytometer (Becton Dickinson), with at least 5,000 gated events per sample. For analysis of the data obtained, FlowJo Software was used. Sorting of CD8+ T cell subsets was performed based on the surface expression of CD45RA and CCR7 according to the recommendations in the guidelines for the use of flow cytometry and cell sorting in immunological studies.

RNA isolation and TCRβ sequencing

Following enrichment of CD8+ T cells using the DynabeadsTM CD8 Positive Isolation Kit (Thermo Fisher Scientific), RNA extraction was performed with the Ultrapure RNA Kit (Cwbiotech, Beijing, China) according to the manufacturer’s protocol. The RNA samples were quantified using a Qubit RNA HS Assay Kit (Thermo Fisher Scientific). RNA integrity was checked with the Agilent RNA 6000 Nano Kit and Agilent 2100 Bioanalyzer. Reverse transcription (20 ng of total RNA) was performed (SuperScript IV VILO Master Mix; Thermo Fisher Scientific), followed by target amplification (25 ng cDNA) using the OncomineTM TCR Beta-LR Assay Kit (Thermo Fisher Scientific). Purified library samples were diluted 1:100, and after an elution step, they were quantified using the Ion Library Quantitation Kit (Thermo Fisher Scientific). The enriched samples were loaded onto an Ion 530 chip for sequencing, and the sequencing data were analysed by Ion Reporter Software.

Repertoire analysis, including the indexes of diversity and clonality, was performed using the Oncomine™ TCR Beta-LR Assay in Ion Reporter™ Software. The frequency and sequence profiles were established by the Shannon index. Shannon entropy was calculated as -∑ R i=1 pi log2(pi ), where pi indicates the frequency of the ith clone, and R indicates the total number of clones. Samples with many clones of similar frequencies have high Shannon diversity.

Luciferase reporter assay

Luciferase activities were measured using the luciferase assay system from Promega. Briefly, the wild-type and mutant LDHA HRE constructs were inserted into luciferase reporter plasmids. The cells were harvested at 24 hours after transfection and resuspended in lysis buffer. Cell lysates were cleared by centrifugation, and 10 ml of supernatants was mixed with an equal volume of Luciferase Assay Reagent and subsequently analysed for luciferase activity with a luminometer.

Western blotting

The pellets were resuspended in RIPA lysis buffer solution (P0013E, Beyotime). The total protein content was quantitatively measured using a Pierce™ BCA Protein Assay Kit (Thermo Fisher Scientific). The extracted proteins were separated on SDS-PAGE gels and then transferred to PVDF membranes (Millipore) before incubation in the presence of primary antibodies at 4°C overnight. Thereafter, the membranes were washed in phosphate-buffered saline three times for 10 min prior to incubation with secondary antibodies at RT for 2 h. Tubulin and histone H3 were used as protein loading controls. Detailed information on the antibodies and manufacturers is presented in Table S2.

Immunofluorescence

AML or CD8+ T cells were harvested after incubation and then fixed in 4% paraformaldehyde. Afterward, the cells were co-cultured with primary antibodies overnight at 4°C. After rinsing in PBS, fluorophore-labelled secondary antibodies were added. The cells were washed with PBS again prior to staining with DAPI for 20 min. Finally, 15 μl of mounting media and sterile coverslips were applied to the slides.

Gene interference construct

Stable knockdown of HIF-1α, LDHA and TOX was performed using lentiviral transduction particles (Sigma-Aldrich). For HIF-1α, the following lentiviral transduction particles were used: TRCN0000003808, TRCN0000003809, TRCN0000003810, TRCN0000003811, and TRCN0000010819; for LDHA, the lentiviral transduction particles used were: TRCN0000164922, TRCN0000165175, TRCN0000158441, TRCN0000026538 and TRCN0000026554; and for TOX, the lentiviral transduction particles used were: TRCN0000019475, TRCN0000019476, TRCN0000019478, and TRCN0000019477. Lentiviruses that stably overexpress HIF1α and LDHA were purchased from Gene Pharma (Shanghai, China). The cells were transduced on RetroNectin (Clontech Laboratories)-coated 12-well plates at a density of 100 μg/ml following the supplier’s protocol. Next, the wells were blocked with 2% (w/v) BSA in PBS for 30 min at RT before BSA aspiration, and lentiviral particles were added to each well at a volume of 0.5 ml. The plates were then spun at 3,700 r.p.m. for 2 h at RT to increase the interaction between the lentiviral particles and RetroNectin. After harvesting the supernatant by centrifugation, 1-4 million cells were added per well in 1 ml of medium. This was followed by an additional centrifugation step at RT, 1,300 r.p.m. for 10 min prior to incubation at 37°C to improve integration with the lentiviral particles [31].

Measurement of lactate

The lactate concentration was measured in the bone marrow fluid or cell culture supernatant using a lactate assay kit (Abcam, ab65331) according to the manufacturer’s instructions.

Quantitative real-time PCR (qRT-PCR)

Total RNA was isolated using TRIzol reagent (Invitrogen) and then quantified via a Nanodrop spectrophotometer (Thermo Fisher Scientific). LDHA gene expression levels were determined using SYBR Green Supermix (Thermo Fisher Scientific) by qPCR conducted in an ABI 7500 instrument. The expression levels of the LDHA gene (F: GGAGATCCATCATCTCTCC; R: GGAGATCCATCATCTCTCC) and TOX gene (F: CCCCATGAACCATAATGGCCT; R: CCCAGCATATTGGAGACTGTGA) were determined by qRT-PCR, and Rplp0 was used for normalization of gene expression data. The relative gene expression level in a target sample was calculated by the 2-ΔΔCt formula described in an earlier study [32].

Chromatin immunoprecipitation (ChIP) assay

Cell fixation was proceeded with incubation in PBS containing 1% formaldehyde for 10 min, followed by the addition of lysis buffer on ice. Chromatin was then fragmented by sonication to 200-500 bp in length. The resultant DNA was immunoprecipitated using anti-lysine-lactylation antibody (PTM-1401-RM, PTM Biolabs) and Dynabeads. Once complete, chromatin fragments containing the target protein were enriched and TOX promoter sequence was analysed (F: GTGGAACGGATGAAGAACT; R: TGTCCTTGGTGAGAGGTC).

ELISAs

ELISA kits (Thermo Fisher Scientific and RayBiotech) were used to investigate the concentration levels of perforin and granzyme B. After harvesting 105 cells in each group, a standard sandwich ELISA was utilized to quantitatively determine the LDHA levels with a commercially available kit (Aviva Systems Biology).

Statistical analysis

To examine the significance of differences between the two independent groups, the Mann-Whitney U-test was applied. A multiple group comparison procedure was performed using analysis of variance (ANOVA). Correction for multiple tests was performed using the false discovery rate method. Matched paired comparisons were performed using the Wilcoxon signed-rank test.

Results

Notably higher lactate levels in newly diagnosed AML patients

For the purpose of lactate measurement, bone marrow sampling was performed in 22 newly diagnosed AML patients and 32 healthy control participants. The mean BM lactate concentration of the AML patients was higher than the mean BM lactate concentration of the healthy donors (Figure 1A). Among the various cell populations in bone marrow, AML blast, CD4+ T, CD8+ T and B cells were assessed for relative LDHA mRNA and protein expression levels. The relative mRNA and LDHA protein expression levels in AML blast cells were found to be much higher than the relative mRNA and LDHA protein expression levels in other cell types (Figure 1B-D).

Figure 1.

Figure 1

Open in a new tab

Notably higher lactate levels in newly diagnosed AML patients. A. Lactate concentrations in the bone marrow of 22 AML patients and 32 healthy donors. B. Comparison of relative mRNA expression levels of LDHA across several cell types (AML blast, CD8+/CD4+ T and B cells) derived from AML BM samples. C. Comparison of the protein expression levels of LDHA across several cell types (AML blast, CD8+/CD4+ T and B cells) derived from AML BM samples. Left panel: Protein expression levels of LDHA detected by Western blotting in 5 AML samples. Right panel: LDHA quantification values in all samples. D. Comparison of LDHA protein concentrations across several cell types (AML blast, CD8+/CD4+ T and B cells) derived from AML BM samples by ELISA. ns, not significant.

HIF1α activation upregulates LDHA expression and induces lactate production in AML blast cells

Motivated by the above results, we propose that AML blast cells are responsible for sustained glycolysis and pronounced lactate production. Lactate dehydrogenase A (LDHA) is a critical cytosolic enzyme, an essential hallmark of tumor progression, and a significant regulator of the glycolytic process, primarily responsible for pyruvate-lactate reactions [33,34]. The interconnection between LDHA and HIF1α was analysed by constructing a protein-protein interaction (PPI) network using the STRING v10 database (Figure 2A). Previous studies have identified HIF1α binding sites that are enriched for an ACGTG motif [35]. To determine the potential regulatory role of HIF1α in LDHA expression at the transcriptional level, we performed promoter analysis, with a focus on the search for the presumed HIF1α binding sites. HIF1α overexpression was found to be associated with enhanced LDHA reporter activity. Two putative regions bound to HIF1α were confirmed, and either mutated region was found to reverse the enhancement of promoter activity. The mutation of one binding site moderately decreased the promoter activity, but the mutation of both binding sites completely ablated the promoter activity (Figure 2B).

Figure 2.

Figure 2

Open in a new tab

HIF1α activation upregulates LDHA expression and induces lactate production in AML blast cells. A. Prediction of functional associations between LDHA and HIF1α through protein-protein interaction (PPI) network construction using the STRING database. B. Induction of luciferase activity in cells transfected with the HIF1α promoter-reporter construct and an empty vector control. The “X” represents the mutant-type consensus sequences. The red letters in the binding domain indicate the presumed or mutated consensus sequences. M, mutant; WT, wild-type. C, D. Analysis of HIF1α and LDHA expression in the Kasumi-1 cell line by quantitative immunofluorescence. Kasumi-1 cells were transduced with a lentivirus containing HIF1α-shRNA or control-shRNA constructs. Cells were labelled with HIF1α or LDHA antibody. DNA in nuclei was counterstained with DAPI dye. Scale bar: 10 μm. E, F. Protein expression levels of LDHA in Kasumi-1, OCI-AML3 and primary AML blast cells after knocking down or overexpressing HIF1α. G. The three sets of cells were cultured for 12, 24, 48 and 72 hours after knocking down or overexpressing HIF1α. The culture supernatant was then assayed for lactate concentration. *P<0.01.

We next performed lentiviral transduction for the stable knockdown or overexpression of the target cells. Figure 2C and 2D show the expression levels of HIF1α and LDHA, respectively, determined by immunofluorescence assays after HIF1α knockdown or overexpression. Western blot analysis and sandwich enzyme immunoassay showed decreased LDHA protein levels in the Kasumi-1 cell line, OCI-AML3 cell line and primary AML blast cells after HIF1α knockdown. In contrast, the expression levels of LDHA protein were upregulated after overexpression of HIF1α (Figure 2E, 2F). After in vitro incubation for 24 hours, the lactate content in the cultures of the overexpression group was significantly higher than the that in the cultures in the control group; in contrast, the opposite was observed in the knockdown group, where the lactate content in the cultures was significantly lower than the lactate content in the cultures in the control group. However, no significant differences were observed for the lactate levels between the culture results (48 h vs. 72 h) in either the overexpression or control group (Figure 2G).

Elevated levels of lactate are linked to the loss of CD8+ cytotoxic T cells

The addition of lactate at all concentrations tested (0, 2.5, 5.0, 7.5 mM) during incubation did not increase the frequency of apoptotic CD8+ T cells (Figure 3A). Local acidosis is an important hallmark of the tumor micromilieu and is a result of enhanced glycolytic metabolism and sustained accumulation of lactate. To examine the potential association between lactate and T-cell proliferation, graded concentrations of lactate were added to cultures of CD8+ T cells, and no pro-inhibitory effect was observed (Figure 3B). Cytotoxic T cells induce apoptosis mainly through the perforin/granzyme B pathway [11]. Thus, the potential relationship between lactate levels and the expression index of perforin and granzyme B in AML patients was examined. Remarkably, a strong correlation with perforin (r=0.748, P<0.01) and granzyme B (r=0.752, P<0.01) was noted (Figure 3C). Tumor-derived lactate indeed exerted an exposure-dependent inhibitory effect on perforin and granzyme B secretion in activated CD8+ T cells (Figure 3D, 3E). In earlier studies, CD8+ and CD4+ T cells were shown to express Slc16a1 and Slc5a12 [36], which are major lactate transporters involved in the suppression of T cell function. This finding was validated in the present study (Figure 3F). Slc16a1 expression was not changed after exposure to lactate (Figure 3G). Pharmacological blockade of Slc16a1 using specific inhibitors resulted in elevated percentages of perforin and granzyme B in CD8+ T cells (Figure 3H). These findings were consistent with earlier studies indicating that import of lactate into CD8+ T cells is dependent on the interaction with Slc16a1, leading to the downregulation of perforin and granzyme B.

Figure 3.

Figure 3

Open in a new tab

Elevated levels of lactate are linked to the loss of CD8+ cytotoxic T cells. A. Lactate levels and CD8+ T cell apoptosis. For apoptotic cell evaluation, CD8+ T cells were exposed to increasing doses (0, 2.5, 5.0, 7.5 mM) of lactate for 72 hours, and flow cytofluorometric analysis was performed per the Annexin V/PI protocol. B. Lactate levels and T cell proliferative effect. CD8+ T cells were exposed to increasing doses (0, 2.5, 5.0, 7.5 mM) of lactate for 72 hours, and carboxyfluorescein succinimidyl ester (CFSE) was used to assess the division frequency of CD8+ T cells. C. Significant correlation between lactate concentrations and perforin and granzyme B production. D, E. Association between lactate levels and perforin/granzyme B production. Upon stimulation, CD8+ T cells were exposed to increasing doses (0, 2.5, 5.0, 7.5 mM) of lactate for 72 hours, and the culture supernatant was harvested and assayed for perforin and granzyme B production. F. Western blotting determination of Slc16a1 and Slc5a12 protein expression levels in CD4+ and CD8+ T cells from AML specimens. G. Association between lactate levels and Slc16a1 protein expression. CD8+ T cells were exposed to increasing doses (0, 2.5, 5.0, 7.5 mM) of lactate for 72 hours, and the expression levels of Slc16a1 were assessed by Western blotting. H. Upon stimulation, CD8+ T cells were treated with lactate (5 mM) alone or in combination with AR-C155858 (20 nM), anti-Slc16a1 antibody (2.5 μg/ml) or Slc5a12 antibody (2.5 μg/ml) for 72 hours. The culture supernatant was harvested and assayed for perforin and granzyme B production. ns, not significant. *P<0.05, **P<0.01.

Elevated lactate is associated with TOX upregulation and dysfunctional CD8+ T cells

The decrease in naïve T cells and TCM subsets together with the increase in TEM and TEMRA subsets in CD8+ T cells have been attributed to dysfunctional and exhausted T cells after prolonged exposure to the tumor microenvironment, limiting their ability to proliferate and produce cytokines [37]. The frequencies of TEM, TEMRA and TEM plus TEMRA cells were congruous with the levels of lactate production (Figure 4B). In addition, the expression levels of PD-1 in these cell subsets were also found to be significantly associated with lactate concentrations (Figure 4C). These findings were further confirmed in an in vitro model in which lactate mediated upregulated PD-1 expression (Figure 4D, 4E).

Figure 4.

Figure 4

Open in a new tab

Lactate concentrations and CD8+ T cell differentiation/PD-1 expression. A. Top: Gating strategy of flow cytometry to discriminate TN, TCM, TEM, and TEMRA cells. Bottom: PD-1 expression in TN, TCM, TEM, and TEMRA cells. B. Correlation between lactate production and TEM, TEMRA and TEM plus TEMRA subset frequencies in AML patients. C. Correlation between lactate concentrations and PD-1 expression ratios in TEM, TEMRA and TEM plus TEMRA cells. D. TEM plus TEMRA subset frequencies in response to lactate treatment. Upon stimulation, CD8+ T cells were incubated in the presence of 5 mM lactate for 72 hours and then collected for flow cytometry analysis. E. Association between lactate levels and PD-1 expression in TEM and TEMRA cells. Upon stimulation, CD8+ T cells were incubated in the presence of 5 mM lactate for 72 hours and then collected for flow cytometry analysis. F. Lactate concentrations were not significantly correlated with the Shannon indexes, a measure of TCR diversity, in TEM and TEMRA cells. G. Lactate concentrations were not significantly correlated with the ratios of highly expanded clones (HECs, clonotypes with a frequency of more than 0.1% in each sample) in TEM and TEMRA cells.

CD8+ T cells with cytotoxic effector functionality trigger apoptosis of tumor cells through T cell receptor (TCR) activation. The diversity of the TCR repertoire may reflect the general propensity of tumor antigen recognition [38-40]. Restricted TCR diversity and persistent expanded clones were observed in BM samples from AML patients [41-43]. Importantly, no congruence was noted between the Shannon indexes and lactate production or between the expression of highly expanded clones (HECs, defined as clonotypes with abundance greater than 0.1% in each sample [44]) and lactate concentrations (Figure 4F, 4G).

To substantiate the regulatory role of lactate, we next investigated whether lactate mediated its effect on TOX expression. Elevated lactate levels were shown to upregulate TOX expression, and this effect was subdued after treatment with the Slc16a1 inhibitor AR-C155858 (Figures S1A and 5A-C). Recent studies have established lactate as a crucial regulator of gene transcription via histone lactylation. To confirm this finding, ChIP experiments were carried out to determine histone lactylation on the promoter region of TOX. Lactate treatment was observed to have increased the histone lactylation levels in the TOX promoter (Figure S1B, S1C), corroborating the regulatory role of lactate and the close involvement of histone lactylation [45-47]. The knockdown of TOX reversed the upregulatory effect of lactate on TEM and TEMRA ratios and PD-1 expression in TEM plus TEMRA cells (Figure 5D, 5E).

Figure 5.

Figure 5

Open in a new tab

Lactate upregulates TOX expression. A. Quantitative immunofluorescence of TOX expression in CD8+ T cells. Upon stimulation, CD8+ T cells were incubated with 5 mM lactate or subjected to treatment with 20 nM Slc16a1 inhibitor (AR-C155858) for 72 hours. Cells were stained with TOX antibody. DNA in nuclei was counterstained with DAPI dye. Scale bar: 10 μm. B. TOX protein expression analysis by Western blotting. CD8+ T cells were treated in the same manner as stated above. C. Representative flow cytometry histograms and quantification of TOX expression in CD8+ T cells are shown in the left and right panels, respectively. D. Potential pro-differentiation role of lactate in CD8+ T cells through TOX expression. Left: Flow cytometry plots showing coexpression of CD45RA and CCR7 on CD8+ T cells. Right: Fraction of TEM plus TEMRA cells among total CD8+ T cells. E. Lactate-mediated PD-1 expression upregulation in TEM and TEMRA cells. Representative flow cytometry histograms and quantification of PD-1 expression in CD8+ T cells are shown in the left and right panels, respectively. Data are representative of at least three independent experiments. F. According to the experimental protocol, the mouse experimental design was as follows. On day 0, 2×105 OCI-AML3 cells were injected into the lateral tail vein of NOD/SCID mice, which were pre-exposed to γ irradiation at a dose of 2.5 Gy. On day 14, mice (n=6) in each group were euthanized under general anaesthesia. Immediately thereafter, BM aspirates were collected from the femora of the hind legs. G. Quantification of TOX expression in CD8+ T cells. TOX expression in CD8+ T cells was quantified by flow cytometry. H. Determination of PD-1 expression in TEM and TEMRA subsets. I. Kaplan-Meier plot showing the survival probability of the mice. L, Lactate.

In a murine model, following the injection of OCI-AML3 and CD8+ T cells, a remarkable increase in the expression levels of TOX and PD-1 in TEM and TEMRA subsets was noted in the LDHA overexpression group at week 2 relative to the control group. Meanwhile, the expression levels of TOX and PD-1 in the LDHA knockdown group were lower than the expression levels of TOX and PD-1 in the control group (Figure 5G, 5H). The Kaplan-Meier plot showing the survival of the mice after receiving a tail vein infusion of OCI-AML3 cells revealed that overexpression of LDHA largely reduced mouse survival, while stable knockdown of LDHA significantly increased mouse survival (37 and 57.5 days, respectively, versus 50 days for the control) (P=0.021).

Changes in lactate levels and CD8+ T cell distribution in AML patients before and after chemotherapy

Detailed information on the paired samples is listed in Figure 6A. Four out of a total of 22 newly diagnosed patients were lost to follow-up. Half of the remaining patients achieved remission, and the other half relapsed after chemotherapy. Lactate concentrations and LDHA protein concentrations of AML blast cells were compared in the 18 patients against the following metrics: TOX and PD-1 expression, perforin and granzyme concentrations and differentiation of CD8+ T cells. The results indicated that for patients who achieved complete remission after chemotherapy, taking the data at diagnosis as baseline, the lactate concentrations, TOX expression in CD8+ T cells, fraction of TCM plus TEMRA cells in the total CD8+ T cells, and PD-1 expression all decreased after chemotherapy (P=0.018, 0.024, 0.025, and 0.012, respectively), and perforin and granzyme B concentrations increased (P=0.044 and 0.042, respectively). For patients who relapsed after chemotherapy, there was no difference in the above parameters (P>0.05). For the LDHA protein concentration of AML blast cells in relapsed patients before and after chemotherapy, no significant difference was found. Moreover, in both patient groups, there was no difference in the LDHA protein concentration of CD8+ T cells at diagnosis or after chemotherapy.

Figure 6.

Figure 6

Open in a new tab

Changes in lactate levels and CD8+ T cell distribution in AML patients before and after chemotherapy. A. Schematic representation of matched samples collected at diagnosis and post-chemotherapy. Samples from 9 patients who relapsed and 9 patients who achieved CR after chemotherapy were collected and paired for analysis. B, C. Quantitative measurement of lactate levels and LDHA protein concentrations using ELISA. D-F. Flow cytometry quantification of TOX expression levels, proportion of TEM plus TEMRA cells, and PD-1 expression in TEM and TEMRA cells. G, H. Quantitative measurement of perforin and granzyme B production using ELISA.

Discussion

Proteins that promote effector T cell suppression are broadly categorized into three groups: inhibitory receptors (iRs) during T cell activation, e.g., programmed cell death protein 1 (PD1); immunological tumor-promoting cells within the microenvironment, including regulatory T cells (Tregs) and myeloid-derived suppressor cells (MDSCs); and a diverse range of soluble factors, e.g., indoleamine-2,3-dioxygenase (IDO), nucleotides, arginase, and tumor-derived metabolites [19,48,49]. AML blasts arise from myeloid progenitors and accumulate in the bone marrow, an environment favorable for their maturation and differentiation [50]. The high recurrence rates after chemotherapy, limited donor availability in hematopoietic stem cell transplantation (HSCT), and lack of breakthroughs in immunotherapy for AML have prompted extensive investigation into the role of AML blasts in the bone marrow microenvironment in mediating CD8+ T cell dysfunction.

Excessive lactate production has been hitherto reported in several solid tumors [22-25]. J. Feng et al. demonstrated the role of tumor-derived lactate in the regulation of PD-L1 promoter activity through the GPR81 signaling pathway. The production of lactate in lung cancer cells was shown to attenuate the cAMP signaling system by GPR81 receptor stimulation, thereby contributing to CD8+ T cell exhaustion [51]. A recent study by Karin Fischer et al. measured lactate concentrations in several malignancies and revealed that the maximum serum lactate levels were notably higher in patients than in healthy individuals (8.7 mM vs. 2.2 mM) [23]. The present study measured lactate concentrations in bone marrow samples from AML patients and healthy donors. Consistently, the lactate concentrations in the bone marrow samples from AML patients ranged from 3.18-7.49 mM (mean 5.18 mM), whereas the lactate concentrations in the bone marrow samples from healthy donors ranged from 0.64-4.66 mM (mean 2.60 mM). In an in vitro model, Karin Fischer et al. demonstrated that increasing the concentration of lactate from 5 to 15 mM could effectively inhibit the proliferation of human cytotoxic T lymphocytes (CTLs) and limit the cytotoxic activity to a great extent. In addition, Mendler et al. showed that 10 mM lactate triggered the activation of the JNK/c-Jun and p38 pathways and interfered with IFN-γ production [52]. Consistent with their results, CD8+ T cells treated with 10 mM lactate significantly inhibited cytokine production, and IFN-γ production was disrupted when the concentration was increased to 20 mM (data not shown). A major consideration in the design of the present study is the suitability of the lactate concentrations used for in vitro imitation of the intra-tumoral micromilieu. In this context, concentration gradients (2.5, 5.0, and 7.5 mM) were used for subsequent in vitro experiments. Following exposure to 2.5, 5.0, and 7.5 mM lactate, no changes were noted regarding T cell proliferation and apoptosis. However, 5 mM lactate was sufficient to induce a significant inhibition of perforin and granzyme B production.

AML blasts are highly dependent on the bone marrow niche to facilitate their maturation and proliferation. The bone marrow is highly heterogeneous and home to a wide array of cell types [50]. As a result, it is crucial to assess the LDHA protein expression of the main cell types to determine the origin of lactate. LDHA has been shown in earlier studies to be expressed on cancer cells and enhance glycolysis by converting pyruvate into lactate. Earlier studies have established elevated LDHA levels as a predictor of tumor progression and poor survival outcomes [33,34,53,54]. We observed notably higher LDHA protein expression in AML blasts than in other cell types analysed, i.e., CD4+ T, CD8+ T and B cells. However, one major limitation of this study is that although AML blasts were identified as the subset with the highest LDHA expression, due to different total cell counts and varying ratios of cell types, the specific fraction of lactate derived from AML blasts was not determined. Thus, our findings need to be validated in additional studies with refined approaches.

In contrast to TEM and TEMRA cells, T naïve and TCM cells, despite their proliferative nature and ability to induce IL-2 production, have limited effector function [6]. Immunophenotypic analyses revealed a marked increase in the abundance of TEM and TEMRA cells and a decrease in the abundance of naïve T and TCM cells in AML patients compared with healthy controls. Moreover, elevated expression of PD-1 and Tim-3 was also noted in AML patients, which was associated with T cell exhaustion [37,55,56]. Our study identified strong correlations between lactate concentrations and percentages of CD8+ TEM and CD8+ TEMRA cells as well as PD-1 expression levels. In vitro experiments indicated that lactate could substantially increase the overall percentages of CD8+ TEM and CD8+ TEMRA cells. Meanwhile, lactate was also shown to promote PD-1 expression in TEM and TEMRA cells. Hence, lactate appears to work in both ways; it may increase the ratio of effector T cells, and it may also upregulate the expression of PD-1 in such effector T cells, driving them toward exhaustion. TOX has been previously reported as an essential biomarker for T cell differentiation and tumor progression [13,18]. Recent research has revealed that TOX is implicated in T cell survival of exhausted T cells in chronic infections [12]. Knockdown of the TOX gene led to reduced PD-1 mRNA and protein expression and reinforced the phenotype of effector T cells [17]. Sekine et al. showed that TOX expression was overwhelmingly found in TEM and TEMRA cells [15,57]. These findings indicated that both the exhausted T cell phenotype and the effector T cell phenotype can express TOX. After knocking down the TOX gene, the previously observed effects of lactate on the TEM/TEMRA ratio and PD-1 expression subsided, suggesting that lactate exerted its proapoptotic effect on CD8+ T cells through the TOX gene.

Immune checkpoint blockade has shown clinical efficacy in solid tumors. CAR-T cell therapy has also achieved initial success by harnessing the potential of the immune system. Despite advances in solid tumors, these forms of immunotherapy have limited efficacy against AML. The results of the present study showed that increased lactate levels in AML blasts upregulate TOX expression in CD8+ T cells and trigger T cell exhaustion, potentially hampering cytolytic function. Lactate secreted by AML blasts mediates the inhibition of cytotoxic T cells, which may partially be responsible for the low success rate of immunotherapy. Our data add to a growing body of literature in support of lactate as a major determinant of antitumor responses in immunotherapy.

Acknowledgements

This work received grants from the National Natural Science Foundation of China. (Grant No. 81660616 and 81960032), the Social Development Research Project of Guiczhou Province (Grant No. [2015]3036) and the National Centre for Clinical Medicine of Hematological Diseases (2020ZKPB03).

Disclosure of conflict of interest

None.

Supporting Information

ajcr0011-5726-f7.pdf (369.9KB, pdf)

References

  • 1.Nair R, Salinas-Illarena A, Baldauf HM. New strategies to treat AML: novel insights into AML survival pathways and combination therapies. Leukemia. 2021;35:299–311. doi: 10.1038/s41375-020-01069-1. [DOI] [PubMed] [Google Scholar]
  • 2.Vago L, Gojo I. Immune escape and immunotherapy of acute myeloid leukemia. J Clin Invest. 2020;130:1552–1564. doi: 10.1172/JCI129204. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Lichtenegger FS, Krupka C, Haubner S, Kohnke T, Subklewe M. Recent developments in immunotherapy of acute myeloid leukemia. J Hematol Oncol. 2017;10:142. doi: 10.1186/s13045-017-0505-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Isidori A, Cerchione C, Daver N, DiNardo C, Garcia-Manero G, Konopleva M, Jabbour E, Ravandi F, Kadia T, Burguera AF, Romano A, Loscocco F, Visani G, Martinelli G, Kantarjian H, Curti A. Immunotherapy in acute myeloid leukemia: where we stand. Front Oncol. 2021;11:656218. doi: 10.3389/fonc.2021.656218. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Brummelman J, Pilipow K, Lugli E. The single-cell phenotypic identity of human CD8(+) and CD4(+) T cells. Int Rev Cell Mol Biol. 2018;341:63–124. doi: 10.1016/bs.ircmb.2018.05.007. [DOI] [PubMed] [Google Scholar]
  • 6.van der Leun AM, Thommen DS, Schumacher TN. CD8(+) T cell states in human cancer: insights from single-cell analysis. Nat Rev Cancer. 2020;20:218–232. doi: 10.1038/s41568-019-0235-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Carrasco J, Godelaine D, Van Pel A, Boon T, van der Bruggen P. CD45RA on human CD8 T cells is sensitive to the time elapsed since the last antigenic stimulation. Blood. 2006;108:2897–2905. doi: 10.1182/blood-2005-11-007237. [DOI] [PubMed] [Google Scholar]
  • 8.Ando M, Ito M, Srirat T, Kondo T, Yoshimura A. Memory T cell, exhaustion, and tumor immunity. Immunol Med. 2020;43:1–9. doi: 10.1080/25785826.2019.1698261. [DOI] [PubMed] [Google Scholar]
  • 9.Reiser J, Banerjee A. Effector, memory, and dysfunctional CD8(+) T cell fates in the antitumor immune response. J Immunol Res. 2016;2016:8941260. doi: 10.1155/2016/8941260. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Blank CU, Haining WN, Held W, Hogan PG, Kallies A, Lugli E, Lynn RC, Philip M, Rao A, Restifo NP, Schietinger A, Schumacher TN, Schwartzberg PL, Sharpe AH, Speiser DE, Wherry EJ, Youngblood BA, Zehn D. Defining ‘T cell exhaustion’. Nat Rev Immunol. 2019;19:665–674. doi: 10.1038/s41577-019-0221-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Voskoboinik I, Whisstock JC, Trapani JA. Perforin and granzymes: function, dysfunction and human pathology. Nat Rev Immunol. 2015;15:388–400. doi: 10.1038/nri3839. [DOI] [PubMed] [Google Scholar]
  • 12.Alfei F, Kanev K, Hofmann M, Wu M, Ghoneim HE, Roelli P, Utzschneider DT, von Hoesslin M, Cullen JG, Fan Y, Eisenberg V, Wohlleber D, Steiger K, Merkler D, Delorenzi M, Knolle PA, Cohen CJ, Thimme R, Youngblood B, Zehn D. TOX reinforces the phenotype and longevity of exhausted T cells in chronic viral infection. Nature. 2019;571:265–269. doi: 10.1038/s41586-019-1326-9. [DOI] [PubMed] [Google Scholar]
  • 13.Arora M, Kumari S, Singh J, Chopra A, Chauhan SS. Expression pattern, regulation, and clinical significance of TOX in breast cancer. Cancer Immunol Immunother. 2021;70:349–363. doi: 10.1007/s00262-020-02689-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Guo L, Li X, Liu R, Chen Y, Ren C, Du S. TOX correlates with prognosis, immune infiltration, and T cells exhaustion in lung adenocarcinoma. Cancer Med. 2020;9:6694–6709. doi: 10.1002/cam4.3324. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Heim K, Binder B, Sagar , Wieland D, Hensel N, Llewellyn-Lacey S, Gostick E, Price DA, Emmerich F, Vingerhoet H, Kraft ARM, Cornberg M, Boettler T, Neumann-Haefelin C, Zehn D, Bengsch B, Hofmann M, Thimme R. TOX defines the degree of CD8+ T cell dysfunction in distinct phases of chronic HBV infection. Gut. 2020;70:1550–1560. doi: 10.1136/gutjnl-2020-322404. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Saleh R, Taha RZ, Toor SM, Sasidharan Nair V, Murshed K, Khawar M, Al-Dhaheri M, Petkar MA, Abu Nada M, Elkord E. Expression of immune checkpoints and T cell exhaustion markers in early and advanced stages of colorectal cancer. Cancer Immunol Immunother. 2020;69:1989–1999. doi: 10.1007/s00262-020-02593-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Kim K, Park S, Park SY, Kim G, Park SM, Cho JW, Kim DH, Park YM, Koh YW, Kim HR, Ha SJ, Lee I. Single-cell transcriptome analysis reveals TOX as a promoting factor for T cell exhaustion and a predictor for anti-PD-1 responses in human cancer. Genome Med. 2020;12:22. doi: 10.1186/s13073-020-00722-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Wang X, He Q, Shen H, Xia A, Tian W, Yu W, Sun B. TOX promotes the exhaustion of antitumor CD8(+) T cells by preventing PD1 degradation in hepatocellular carcinoma. J Hepatol. 2019;71:731–741. doi: 10.1016/j.jhep.2019.05.015. [DOI] [PubMed] [Google Scholar]
  • 19.Gajewski TF, Meng Y, Blank C, Brown I, Kacha A, Kline J, Harlin H. Immune resistance orchestrated by the tumor microenvironment. Immunol Rev. 2006;213:131–145. doi: 10.1111/j.1600-065X.2006.00442.x. [DOI] [PubMed] [Google Scholar]
  • 20.Walenta S, Mueller-Klieser WF. Lactate: mirror and motor of tumor malignancy. Semin Radiat Oncol. 2004;14:267–274. doi: 10.1016/j.semradonc.2004.04.004. [DOI] [PubMed] [Google Scholar]
  • 21.Walenta S, Schroeder T, Mueller-Klieser W. Lactate in solid malignant tumors: potential basis of a metabolic classification in clinical oncology. Curr Med Chem. 2004;11:2195–2204. doi: 10.2174/0929867043364711. [DOI] [PubMed] [Google Scholar]
  • 22.Branco M, Linhares P, Carvalho B, Santos P, Costa BM, Vaz R. Serum lactate levels are associated with glioma malignancy grade. Clin Neurol Neurosurg. 2019;186:105546. doi: 10.1016/j.clineuro.2019.105546. [DOI] [PubMed] [Google Scholar]
  • 23.Fischer K, Hoffmann P, Voelkl S, Meidenbauer N, Ammer J, Edinger M, Gottfried E, Schwarz S, Rothe G, Hoves S, Renner K, Timischl B, Mackensen A, Kunz-Schughart L, Andreesen R, Krause SW, Kreutz M. Inhibitory effect of tumor cell-derived lactic acid on human T cells. Blood. 2007;109:3812–3819. doi: 10.1182/blood-2006-07-035972. [DOI] [PubMed] [Google Scholar]
  • 24.Walenta S, Wetterling M, Lehrke M, Schwickert G, Sundfor K, Rofstad EK, Mueller-Klieser W. High lactate levels predict likelihood of metastases, tumor recurrence, and restricted patient survival in human cervical cancers. Cancer Res. 2000;60:916–921. [PubMed] [Google Scholar]
  • 25.Blatt S, Voelxen N, Sagheb K, Pabst AM, Walenta S, Schroeder T, Mueller-Klieser W, Ziebart T. Lactate as a predictive marker for tumor recurrence in patients with head and neck squamous cell carcinoma (HNSCC) post radiation: a prospective study over 15 years. Clin Oral Investig. 2016;20:2097–2104. doi: 10.1007/s00784-015-1699-6. [DOI] [PubMed] [Google Scholar]
  • 26.Calcinotto A, Filipazzi P, Grioni M, Iero M, De Milito A, Ricupito A, Cova A, Canese R, Jachetti E, Rossetti M, Huber V, Parmiani G, Generoso L, Santinami M, Borghi M, Fais S, Bellone M, Rivoltini L. Modulation of microenvironment acidity reverses anergy in human and murine tumor-infiltrating T lymphocytes. Cancer Res. 2012;72:2746–2756. doi: 10.1158/0008-5472.CAN-11-1272. [DOI] [PubMed] [Google Scholar]
  • 27.Comito G, Iscaro A, Bacci M, Morandi A, Ippolito L, Parri M, Montagnani I, Raspollini MR, Serni S, Simeoni L, Giannoni E, Chiarugi P. Lactate modulates CD4(+) T-cell polarization and induces an immunosuppressive environment, which sustains prostate carcinoma progression via TLR8/miR21 axis. Oncogene. 2019;38:3681–3695. doi: 10.1038/s41388-019-0688-7. [DOI] [PubMed] [Google Scholar]
  • 28.Gottfried E, Kunz-Schughart LA, Ebner S, Mueller-Klieser W, Hoves S, Andreesen R, Mackensen A, Kreutz M. Tumor-derived lactic acid modulates dendritic cell activation and antigen expression. Blood. 2006;107:2013–2021. doi: 10.1182/blood-2005-05-1795. [DOI] [PubMed] [Google Scholar]
  • 29.Pucino V, Bombardieri M, Pitzalis C, Mauro C. Lactate at the crossroads of metabolism, inflammation, and autoimmunity. Eur J Immunol. 2017;47:14–21. doi: 10.1002/eji.201646477. [DOI] [PubMed] [Google Scholar]
  • 30.Fiskus W, Sharma S, Shah B, Portier BP, Devaraj SG, Liu K, Iyer SP, Bearss D, Bhalla KN. Highly effective combination of LSD1 (KDM1A) antagonist and pan-histone deacetylase inhibitor against human AML cells. Leukemia. 2014;28:2155–2164. doi: 10.1038/leu.2014.119. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Chan SM, Thomas D, Corces-Zimmerman MR, Xavy S, Rastogi S, Hong WJ, Zhao F, Medeiros BC, Tyvoll DA, Majeti R. Isocitrate dehydrogenase 1 and 2 mutations induce BCL-2 dependence in acute myeloid leukemia. Nat Med. 2015;21:178–184. doi: 10.1038/nm.3788. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 2001;25:402–408. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
  • 33.Le A, Cooper CR, Gouw AM, Dinavahi R, Maitra A, Deck LM, Royer RE, Vander Jagt DL, Semenza GL, Dang CV. Inhibition of lactate dehydrogenase A induces oxidative stress and inhibits tumor progression. Proc Natl Acad Sci U S A. 2010;107:2037–2042. doi: 10.1073/pnas.0914433107. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Seth P, Csizmadia E, Hedblom A, Vuerich M, Xie H, Li M, Longhi MS, Wegiel B. Deletion of lactate dehydrogenase-A in myeloid cells triggers antitumor immunity. Cancer Res. 2017;77:3632–3643. doi: 10.1158/0008-5472.CAN-16-2938. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Semenza GL, Agani F, Booth G, Forsythe J, Iyer N, Jiang BH, Leung S, Roe R, Wiener C, Yu A. Structural and functional analysis of hypoxia-inducible factor 1. Kidney Int. 1997;51:553–555. doi: 10.1038/ki.1997.77. [DOI] [PubMed] [Google Scholar]
  • 36.Haas R, Smith J, Rocher-Ros V, Nadkarni S, Montero-Melendez T, D’Acquisto F, Bland EJ, Bombardieri M, Pitzalis C, Perretti M, Marelli-Berg FM, Mauro C. Lactate regulates metabolic and pro-inflammatory circuits in control of T cell migration and effector functions. PLoS Biol. 2015;13:e1002202. doi: 10.1371/journal.pbio.1002202. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Knaus HA, Berglund S, Hackl H, Blackford AL, Zeidner JF, Montiel-Esparza R, Mukhopadhyay R, Vanura K, Blazar BR, Karp JE, Luznik L, Gojo I. Signatures of CD8+ T cell dysfunction in AML patients and their reversibility with response to chemotherapy. JCI Insight. 2018;3:e120974. doi: 10.1172/jci.insight.120974. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Gros A, Robbins PF, Yao X, Li YF, Turcotte S, Tran E, Wunderlich JR, Mixon A, Farid S, Dudley ME, Hanada K, Almeida JR, Darko S, Douek DC, Yang JC, Rosenberg SA. PD-1 identifies the patient-specific CD8(+) tumor-reactive repertoire infiltrating human tumors. J Clin Invest. 2014;124:2246–2259. doi: 10.1172/JCI73639. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Han J, Duan J, Bai H, Wang Y, Wan R, Wang X, Chen S, Tian Y, Wang D, Fei K, Yao Z, Wang S, Lu Z, Wang Z, Wang J. TCR repertoire diversity of peripheral PD-1(+)CD8(+) T cells predicts clinical outcomes after immunotherapy in patients with non-small cell lung cancer. Cancer Immunol Res. 2020;8:146–154. doi: 10.1158/2326-6066.CIR-19-0398. [DOI] [PubMed] [Google Scholar]
  • 40.Hopkins AC, Yarchoan M, Durham JN, Yusko EC, Rytlewski JA, Robins HS, Laheru DA, Le DT, Lutz ER, Jaffee EM. T cell receptor repertoire features associated with survival in immunotherapy-treated pancreatic ductal adenocarcinoma. JCI Insight. 2018;3:e122092. doi: 10.1172/jci.insight.122092. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Feng Z, Fang Q, Kuang X, Liu X, Chen Y, Ma D, Wang J. Clonal expansion of bone marrow CD8(+) T cells in acute myeloid leukemia patients at new diagnosis and after chemotherapy. Am J Cancer Res. 2020;10:3973–3989. [PMC free article] [PubMed] [Google Scholar]
  • 42.Jin Z, Luo Q, Lu S, Wang X, He Z, Lai J, Chen S, Yang L, Wu X, Li Y. Oligoclonal expansion of TCR Vdelta T cells may be a potential immune biomarker for clinical outcome of acute myeloid leukemia. J Hematol Oncol. 2016;9:126. doi: 10.1186/s13045-016-0353-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Zhang J, Hu X, Wang J, Sahu AD, Cohen D, Song L, Ouyang Z, Fan J, Wang B, Fu J, Gu S, Sade-Feldman M, Hacohen N, Li W, Ying X, Li B, Liu XS. Immune receptor repertoires in pediatric and adult acute myeloid leukemia. Genome Med. 2019;11:73. doi: 10.1186/s13073-019-0681-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Han Y, Liu X, Wang Y, Wu X, Guan Y, Li H, Chen X, Zhou B, Yuan Q, Ou Y, Wu R, Huang W, Wang Y, Zhang M, Zhang Y, Zhu D, Zhu H, Yang L, Yi X, Huang C, Huang J. Identification of characteristic TRB V usage in HBV-associated HCC by using differential expression profiling analysis. Oncoimmunology. 2015;4:e1021537. doi: 10.1080/2162402X.2015.1021537. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Zhang D, Tang Z, Huang H, Zhou G, Cui C, Weng Y, Liu W, Kim S, Lee S, Perez-Neut M, Ding J, Czyz D, Hu R, Ye Z, He M, Zheng YG, Shuman HA, Dai L, Ren B, Roeder RG, Becker L, Zhao Y. Metabolic regulation of gene expression by histone lactylation. Nature. 2019;574:575–580. doi: 10.1038/s41586-019-1678-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Jiang J, Huang D, Jiang Y, Hou J, Tian M, Li J, Sun L, Zhang Y, Zhang T, Li Z, Li Z, Tong S, Ma Y. Lactate modulates cellular metabolism through histone lactylation-mediated gene expression in non-small cell lung cancer. Front Oncol. 2021;11:647559. doi: 10.3389/fonc.2021.647559. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Cui H, Xie N, Banerjee S, Ge J, Jiang D, Dey T, Matthews QL, Liu RM, Liu G. Lung myofibroblasts promote macrophage profibrotic activity through lactate-induced histone lactylation. Am J Respir Cell Mol Biol. 2021;64:115–125. doi: 10.1165/rcmb.2020-0360OC. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Frankenberger B, Noessner E, Schendel DJ. Immune suppression in renal cell carcinoma. Semin Cancer Biol. 2007;17:330–343. doi: 10.1016/j.semcancer.2007.06.004. [DOI] [PubMed] [Google Scholar]
  • 49.Zou W. Immunosuppressive networks in the tumour environment and their therapeutic relevance. Nat Rev Cancer. 2005;5:263–274. doi: 10.1038/nrc1586. [DOI] [PubMed] [Google Scholar]
  • 50.Jia B, Wang L, Claxton DF, Ehmann WC, Rybka WB, Mineishi S, Rizvi S, Shike H, Bayerl M, Schell TD, Hohl RJ, Zheng H. Bone marrow CD8 T cells express high frequency of PD-1 and exhibit reduced anti-leukemia response in newly diagnosed AML patients. Blood Cancer J. 2018;8:34. doi: 10.1038/s41408-018-0069-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Feng J, Yang H, Zhang Y, Wei H, Zhu Z, Zhu B, Yang M, Cao W, Wang L, Wu Z. Tumor cell-derived lactate induces TAZ-dependent upregulation of PD-L1 through GPR81 in human lung cancer cells. Oncogene. 2017;36:5829–5839. doi: 10.1038/onc.2017.188. [DOI] [PubMed] [Google Scholar]
  • 52.Mendler AN, Hu B, Prinz PU, Kreutz M, Gottfried E, Noessner E. Tumor lactic acidosis suppresses CTL function by inhibition of p38 and JNK/c-Jun activation. Int J Cancer. 2012;131:633–640. doi: 10.1002/ijc.26410. [DOI] [PubMed] [Google Scholar]
  • 53.Brand A, Singer K, Koehl GE, Kolitzus M, Schoenhammer G, Thiel A, Matos C, Bruss C, Klobuch S, Peter K, Kastenberger M, Bogdan C, Schleicher U, Mackensen A, Ullrich E, Fichtner-Feigl S, Kesselring R, Mack M, Ritter U, Schmid M, Blank C, Dettmer K, Oefner PJ, Hoffmann P, Walenta S, Geissler EK, Pouyssegur J, Villunger A, Steven A, Seliger B, Schreml S, Haferkamp S, Kohl E, Karrer S, Berneburg M, Herr W, Mueller-Klieser W, Renner K, Kreutz M. LDHA-associated lactic acid production blunts tumor immunosurveillance by T and NK cells. Cell Metab. 2016;24:657–671. doi: 10.1016/j.cmet.2016.08.011. [DOI] [PubMed] [Google Scholar]
  • 54.Jin L, Chun J, Pan C, Alesi GN, Li D, Magliocca KR, Kang Y, Chen ZG, Shin DM, Khuri FR, Fan J, Kang S. Phosphorylation-mediated activation of LDHA promotes cancer cell invasion and tumour metastasis. Oncogene. 2017;36:3797–3806. doi: 10.1038/onc.2017.6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Xu L, Yao D, Tan J, He Z, Yu Z, Chen J, Luo G, Wang C, Zhou F, Zha X, Chen S, Li Y. Memory T cells skew toward terminal differentiation in the CD8+ T cell population in patients with acute myeloid leukemia. J Hematol Oncol. 2018;11:93. doi: 10.1186/s13045-018-0636-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Williams P, Basu S, Garcia-Manero G, Hourigan CS, Oetjen KA, Cortes JE, Ravandi F, Jabbour EJ, Al-Hamal Z, Konopleva M, Ning J, Xiao L, Hidalgo Lopez J, Kornblau SM, Andreeff M, Flores W, Bueso-Ramos C, Blando J, Galera P, Calvo KR, Al-Atrash G, Allison JP, Kantarjian HM, Sharma P, Daver NG. The distribution of T-cell subsets and the expression of immune checkpoint receptors and ligands in patients with newly diagnosed and relapsed acute myeloid leukemia. Cancer. 2018;125:1470–1481. doi: 10.1002/cncr.31896. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Sekine T, Perez-Potti A, Nguyen S, Gorin JB, Wu VH, Gostick E, Llewellyn-Lacey S, Hammer Q, Falck-Jones S, Vangeti S, Yu M, Smed-Sorensen A, Gaballa A, Uhlin M, Sandberg JK, Brander C, Nowak P, Goepfert PA, Price DA, Betts MR, Buggert M. TOX is expressed by exhausted and polyfunctional human effector memory CD8(+) T cells. Sci Immunol. 2020;5:eaba7918. doi: 10.1126/sciimmunol.aba7918. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

ajcr0011-5726-f7.pdf (369.9KB, pdf)

Articles from American Journal of Cancer Research are provided here courtesy of e-Century Publishing Corporation

RESOURCES