miRNA changes in the mouse placenta due to bisphenol A exposure

Abstract

Aim:

To determine small RNA expression changes in mouse placenta induced by bisphenol A (BPA) exposure.

Methods:

Exposing female mice to BPA two weeks prior to conception through gestational day 12.5; whereupon fetal placentas were collected, frozen in liquid nitrogen and stored at -80°C. Small RNAs were isolated and used for small RNA-sequencing.

Results:

43 small RNAs were differentially expressed. Target mRNAs were closely aligned to those expressed by thymus and brain, and pathway enrichment analyses indicated that such target mRNAs regulate neurogenesis and associated neurodevelopment processes.

Conclusions:

BPA induces several small RNAs in mouse placenta that might provide biomarkers for BPA exposure. Further, the placenta might affect fetal brain development through the secretion of miRNAs.

Introduction

The placenta is in direct opposition to maternal tissue, and thus, it can be bathed by chemicals circulating in the maternal bloodstream. For the in utero period, the placenta acts in a variety of ways to aid in the exchange of nutrients, gases and wastes. The placenta also produces a range of hormones and cytokine factors that promote and protect the fetus against uterine alterations. Rodents and humans are unique in that both have an invasive hemochorial type of placentation where syncytiotrophoblast (syncytioTB) cells that mediate nutrient and gas exchange are directly bathed in maternal blood [1]. While the placenta has some ability to detoxify certain xenobiotic chemicals, as an endocrine organ, it can be vulnerable to such compounds, especially endocrine disrupting chemicals (EDCs).

EDCs are abundant in food products, everyday household items and in the environment. Bisphenol A (BPA) is one of the most prevalent EDCs as it is used as a plasticizer for plastic containers, found in the lining of canned good, cardboard boxes and receipts. Current estimates suggest that global production of BPA is around ∼ 20 billion lb [2]. The ubiquitous nature of BPA contamination has resulted in approximately 93% of the US population showing detectable amounts of BPA in their urine [3]. Dietary route is the primary source of exposure to BPA [4,5], although other routes of contact are possible [6,7]. Importantly, BPA is easily transmitted from mother to her developing fetus via the placenta [8,9], and as such, it is a major environmental concern during pregnancy.

We, and others, have previously shown that BPA exposure results in structural and functional changes in the mouse placenta [10–20]. Several studies have tested the effects of BPA in term human placental or trophoblast (TB)-derived cell lines [21–31], but this approach may not recapitulate all the placental responses that occur during the critical first and second trimesters [32]. Moreover, placental cell lines derived from neoplasms, e.g., BeWo, JEG-3 and JAR, may not be physiologically equivalent to non-transformed TB counterparts. Previous mouse studies have generally examined either transcriptomic responses or effects on placental morphology [10–20].

We used RNA-sequencing (RNA-seq) analyses to examine the global transcriptomic profile in embryonic age (E) 12.5 mouse placenta following dietary exposure to BPA or its substitute, bisphenol S (BPS). BPA and BPS changed the expression of an identical set of 13 genes [20]. Of which, 11 were suppressed and two (Actn2 and Efcab2) were increased. Four of the differentially expressed (DE) transcripts are considered enriched in the mouse placenta (Sfrp4, Coch, Gm9513 and Calm4) as determined by the TissueEnrich program [20]. Based on the DE gene-sets, WNT and chemokine signaling pathways, amino acid metabolism, and possibly neurotransmission are pathways were predicted to be affected in the BPA exposed placental samples [20].

Although such gene expression studies are important, miRNAs (miRs) can block the translation of mRNAs to a protein. miRs are transcribed as transcripts that span several kilobases in length [33,34], but they are then cleaved by RNase III enzymes, Drosha in the nucleus and Dicer in the cytoplasm to eventually yield 19–22 nt long mature miRs. miRs determine which mRNAs are translated into proteins by linking to RISC, and this complex than binds to the 3′ untranslated region of mRNA that results in mRNA destruction. In so doing, miRs are the final epigenetic regulators. An understanding of how BPA and other EDC affect miRs in the placenta has important public health ramifications as such epigenetic changes might be used to reveal those fetuses who are being exposed to such chemicals. Mitigation approaches might also be used to correct miR alterations in the placenta that may prevent later offspring health disorders.

BPA and other EDC affect miR patterns in other organs [35–38]. For instance, in the rat hypothalamus, developmental exposure to estradiol benzoate or polychlorinated biphenyls (PCBs) alters miR expression patterns in several brain regions (medial preoptic nucleus [MPN] and ventromedial nucleus [VMN]) manner but such patterns vary according to age and sex [39]. We have shown that BPA and other EDCs affect miR profiles in the hypothalamus of California mice [40,41]. BPA exposure has been linked to changes in miR expression patterns in whole human placenta and TB cell lines [22,42]. However, no studies to date have used a rodent model to establish actual causation for BPA-induced miR changes in the placenta. The hypothesis of the current studies was that BPA exposure would alter the miR profile in the placenta of C57BL6J. To test this hypothesis, we performed small RNA sequencing with BPA-exposed and control samples and used bioinformatics analyses to compare these results, as well as determine those mRNAs and pathways that might be affected by miRs DE in BPA-exposed placenta. Such placental miRs might also provide useful biomarkers for gestational EDC exposure.

Materials & methods

Animals & treatments

All animal experiments were approved by the Institute Animal Care and Use Committee (IACUC) and were done in compliance with the NIH Guidelines for the care and use of laboratory animals. Five- to six-week-old C57BL6J female and male mice (Jackson Labs, ME, USA) were housed in polypropylene cages, fed a phytoestrogen free diet (AIN93G; Envigo, WI, USA), and provided a nestlet (Ancare, NY, USA) for environmental enrichment. Mice were maintained on a 12-h light: 12-h dark cycle with the lights turning on at 7:00 am and shutting off at 7:00 pm. The average room temperature was 70°F, and the humidity range was between 30 and 70%. Females were provided a week habituation period before the experiments were initiated. They were then randomly placed based on a random generator number assigned to them to be in one of two treatments groups: those who were provided daily a Nabisco Nilla wafer (Nabisco, NJ, USA) containing 70% ethanol (8-24 μl volume as adjusted for body weight [bw] that was air dried beforehand onto the wafer) and those who were provided a daily wafer containing BPA (200 μg/kg bw reconstituted in ethanol with a similar volume as vehicle control and air dried onto the wafer). The BPA dose falls well below the diet-administered maximum nontoxic dose for rodents (200 mg/kg bw/day), is within the presumptive no observed adverse effect level (NOAEL) [43–47], and results in serum concentrations comparable to those identified in human populations [48–53]. Females were singly housed (unless paired overnight with a male), weighed weekly and volume of ethanol or BPA pipetted on to the wafer adjusted based on their updated weight. To minimize background BPA contamination, animals were housed in polypropylene cages with aspen shavings rather than corn cob and provided glass water bottles. BPA (Chemical CAS no. 80-05-7, purity >99%,) was purchased from Sigma-Aldrich (MO, USA) and stored in amber glass bottles with aluminum foil around them to minimize exposure to light. It was reconstituted in polypropylene tubes. After two weeks of receiving one of these treatments, females were housed with breeder males, and the next morning, they were examined for a presence of a vaginal plug. The day one was observed, and it was considered as embryonic age (E) 0.5 days post coitus. In the case a vaginal plug was not observed, males and females were separated and then paired again that evening. Females were maintained on the respective treatments until they were humanely euthanized via CO₂ inhalation followed by cervical dislocation at E 12.5. These combined methods are recommended by the American Veterinary Medical Association Guidelines for euthanasia of laboratory animals. Dams were thus exposed to BPA for two weeks prior to conception through E 12.5. After dams were euthanized, each uterine horn was incised, and the uterine position of each conceptus was denoted. Fetal tissue was collected for PCR sexing. The fetal placental tissue (as determined by the discoid morphology) was dissected from the underlying uterine tissue, including decidua and was frozen in liquid nitrogen, as done previously [20]. We have previously used histological analysis to confirm that only fetal placental tissue was collected. Gestational day 12.5 is a common day selected in the current and our past studies [20], as it is a point where the placenta is fully mature, but the genital ridge has not yet differentiated into a gonad that produces steroid hormones that could cause confounding effects. It is also equivalent to about mid-gestation in humans.

Fetal PCR sexing & placental RNA isolation

Fetal DNA was isolated with the DNeasy Blood & Tissue Kit (catalogue no. 69504; Qiagen, MD, USA), and it was used for PCR amplification for Sry (Y-chromosome specific gene, forward primer: 5′TCATGAGACTGCCAACCACAG3′; reverse primer: 5′CATGACCACCACCACCACCAA3′) and Myog (autosomal control gene; forward primer: 5′TTACGTCCATCGTGGACAGC3′; reverse primer: 5′TGGGCTGGGTGTTAGTCTTA3′), as detailed in [54]. For these analyses, only female placental samples were used with each one being from a different litter. We did not have sufficient male samples from different litters. Four BPA-exposed and four control placental samples were used for these studies, which should provide sufficient replicates based on our previous miR studies [40,41].

RNA was isolated from each of the placental samples with the Qiagen AllPrep DNA/RNA/miRNA Universal Kit (catalogue no. 80224; Qiagen, MD, USA). The quantity and quality of the RNA were determined with a Nanodrop ND1000 spectrophotometer (Nanodrop Products, DE, USA). The results were further confirmed by analyzing the RNA on the Fragment Analyzer (Advanced Analytical Technologies, IA, USA). Only samples with a RNA integrity number (RIN) score above 7 were used.

Illumina TruSeq small RNA library preparation

Small RNA sequencing was performed by the University of Missouri Genomics Technology Core Facility. Libraries were constructed according to the manufacturer's protocol with reagents supplied in Illumina's TruSeq small RNA sample preparation kit (Illumina, CA, USA). A two-step ligation process was performed with total RNA to add adapters to the 3′and 5′ ends of the small RNA, respectively. The modified small RNA was reverse transcribed using SuperScript III Reverse Transcriptase. A PCR amplification was done to enrich the small RNA library. Resulting small RNA libraries were pooled and purified by gel electrophoresis on a 6% polyacrylamide gel as recommended by Illumina. Bands consistent with the desired DNA insert size of 19–45 bases were excised from the gel. The DNA fragments (libraries) were retrieved from the gel slice by elution with water and ethanol precipitation. Purified library pool was quantified with Qubit HS DNA kit, and the fragment size determined by an Agilent Fragment Analyzer Automated CE system. Libraries were diluted based on Illumina's standard sequencing protocol for sequencing on the NextSeq 500 (Illumina).

Bioinformatics analyses of small RNA-seq data

sRNAnalyzer [55], which is a flexible and customizable pipeline for the analysis of small RNA-seq data, was used for this analysis. The adapters and any low-quality sequencing data were removed by cutadapt (version 3.2) [56]. The filtered clean reads were mapped to all miRNA database by Bowtie (version 1.3.0) [57]. The align command resulted in an output of several files, including feature, profile, read distribution and an unmatched sequence files. DESeq2 [58] was used to analyze DE small RNAs between the BPA exposed and control placenta. Small RNAs were considered upregulated if they exhibited an absolute fold-change ≥2 and adjusted p-value ≤0.05. To determined sample-to-sample distance heatmap, raw counts data were transformed by rlog function in DESeq2 and transformed count matrix was transposed to get heatmap by DESeq2 built in dist function. A volcano plot was generated by using plot function of DESeq2.

Target mRNA prediction & pathway analyses

To predict potential mRNA targets for those miRs that exhibited differential expression, the miRror 2.0 tool [59] was used. Eleven databases searched included PITA_TOP, PicTar_4way, TargetRank-all (TRnk all), TargetScan Conserved (TScan), microCosm (mCosm), miRanda Conserved (microRNA.org), DIANA-microT (microT), EIMMO-MirZ (MirZ), miRDB, RNA22, MAMI and Map2 (miRNAMap2). Based on the predicted mRNAs, functional enrichment analyses with the WEB-based Gene SeT AnaLysis Toolkit (WebGestalt) [60] and Gene Ontology biological terms was used to ascertain which pathways might be affected. Tissue-specific gene enrichment analysis was determined by TissueEnrich [61]. We used the mouse ENCODE [62] dataset to carry out the enrichment analysis with default settings. Enrichments were considered significant if p-value was ≤0.01 and fold-change ≥2.

Results

General features

The total number of small RNAs screened was 40,933. The average number of small RNA reads was 14,422,125.5, the average number of mapped reads was 9,324,998.6 and the average mapping rate percentage was 61% (Supplementary Table 1). The size of the small RNAs detected ranged from 19–27 base pairs (bp) with 22 bp being the predominant size. (Figure 1A). The volcano plot reveals that several small RNAs were DE based on a false discovery rate (FDR; q value ≤ 0.05; Figure 1B). The heat map based on the DE small RNAs is shown in Figure 1C.

Figure 1. . General features of the small RNA sequencing results.

(A) Base pair size range of detected small RNAs. The most common size of small RNAs detected was 22 bp. (B) Volcano plot of small RNAs that was differentially expressed based on a false discovery rate ≤ 0.05. Those that showed reduced expression in the BPA-exposed placenta are illustrated with green circles, while upregulated small RNAs in the bisphenol A placenta are depicted in red. Those shown in gray were not differentially expressed in BPA versus control placenta. (C) Heat map based on the differentially expressed small RNAs. The legend to the right of the figure represents a color continuum for differentially expressed small RNAs with those depicted in green showing the greatest reduction in expression and those shown in red had increased expression.

BPA: Bisphenol A; Ctrl: Control.

DE small RNAs

Small RNA-seq results show that 43 small RNAs were DE between BPA versus control placenta with 22 being upregulated in BPA and 21 downregulated in the BPA-exposed group (Supplementary File 1). The top ten miRs and other small RNAs upregulated in BPA placenta were miR-151-3p, miR-148-3p, miR-381-3, miR-125a-5p, piR-has-5937, miR-191-5p, miR-542-5p, miR-183-3p, miR-29a-3p and miR-369-3p. The top ten miRs and other small RNAs that were down-regulated in BPA placenta include miR-152-3p, miR-540-3p, miR-322-1-5p, mir-423, miR-144-5p, miR-30e-5p, miR-210-5p, miR-98-5p, miR-434-1-5p and miR-222-3p. Another miR that was down-regulated in the BPA placenta group was miR-146b-5p.

Predicted target mRNAs

After determining DE miRs between BPA and control placenta, we next determined those mRNAs that are predicted to be affected by these miRs, as determined by the modeling databases listed above in the methods section [59,63,64]. Supplementary File 2 lists the mRNAs that are likely to be affected by the DE miRs. As shown, 142 mRNAs are affected by the DE expressed miRs. The prediction at the outset was that the target mRNAs would be associated with the placenta. However, the target mRNAs were linked to the thymus, cerebellum, olfactory bulb, brain cortex, E 14.5 brain and heart (Figure 2).

Figure 2. . Tissue-specific gene enrichment based on target mRNAs.

Tissue-specific gene enrichment analysis based on target mRNAs was determined by TissueEnrich [61]. The mouse ENCODE [62] dataset was used for the enrichment analysis with default settings. Enrichments were considered significant if the p-value was ≤0.01 and fold-change ≥2. The target mRNAs are linked to the thymus, cerebellum, olfactory bulb, brain cortex, E 14.5 brain and heart.

E: Embryonic age.

Pathways predicted to be affected based on BPA-induced placental miR changes

Pathway enrichment analysis revealed that the mRNAs targeted by the DE miRs are associated with neural pathways, including neurogenesis, generation of neurons, neuron differentiation, neuron development and neuron projection development (Figure 3 & Table 1). Other pathways likely affected include cell projection organization, plasma membrane bounded cell projection organization, cation transmembrane transport, metal ion transport and inorganic cation transmembrane transport. Target mRNAs within neurogenesis included Ache, Adora2a, Afg312, Barhl1, Brinp3, Brsk1, Cdk16, Cngb1, Crk and Epb41l3.

Figure 3. . Pathway enrichment analysis based on target mRNAs.

Pathway enrichment analysis was performed based on Gene Ontology biological terms and was done using the WEB-based Gene SeT AnaLysis Toolkit (WebGestalt) [60], and revealed that the mRNAs targeted by the differenty expressed miRNAs are associated with neural pathways, including neurogenesis, generation of neurons, neuron differentiation, neuron development and neuron projection development. Other pathways likely affected include cell projection organization, plasma membrane bounded cell projection organization, cation transmembrane transport, metal ion transport and inorganic cation transmembrane transport. The diagram generated with this program shows how the enriched pathways relate to each other based on the lines connecting the various pathways to one another.

Table 1. . Pathway enrichment analysis based on target mRNAs. Pathway enrichment analysis based on Gene Ontology biological terms, which was done using the WEB-based gene set analysis toolkit (WebGestalt).

Gene set	Description	Size	Expect	Ratio	p-value	FDR
GO:0048699	Generation of neurons	1526	9.5646	3.032	4.72E-08	0.0004255
GO:0022008	Neurogenesis	1634	10.242	2.8316	2.05E-07	0.000872
GO:0030182	Neuron differentiation	1372	8.5994	3.0235	2.90E-07	0.000872
GO:0031175	Neuron projection development	990	6.2051	3.3843	8.25E-07	0.0018597
GO:0048666	Neuron development	1119	7.0136	3.1367	1.5405E-06	0.0027784
GO:0120036	Plasma membrane bounded cell projection organization	1434	8.988	2.4477	7.4723E-05	0.10789
GO:0098662	Inorganic cation transmembrane transport	682	4.2746	3.2751	9.4817E-05	0.10789
GO:0098655	Cation transmembrane transport	771	4.8325	3.104	9.5708E-05	0.10789
GO:0030030	Cell projection organization	1473	9.2324	2.3829	0.00011067	0.11089
GO:0030001	Metal ion transport	813	5.0957	2.9437	0.00017136	0.14155

FDR: False discovery rate; GO: Gene ontology.

Discussion

The current studies sought to determine BPA-induced miR and other small RNA changes in the mouse placenta at mid-gestation (E 12.5) as BPA and other EDCs might induce phenotypic changes by altering mRNA profiles within a given organ. Although previous studies have examined the correlations of maternal BPA exposure and miRs in the human placenta [22,42], inadequate information is known how such chemicals might affect miRNA expression patterns in the mouse placenta. Target mRNAs were then determined based on the DE miR.

Small RNAs that were DE between BPA versus control placenta included about half that were upregulated and half that were downregulated. One other miR that was down-regulated in the BPA placenta group was miR-146b-5p. Comparison of the DE miR identified in the mouse placenta to those previously identified in the human placental lines exposed to BPA reveals that the only one that is similar in both studies was miR146 (Supplementary File 3). The miR146 family includes four members: miR146a-5p, miR-146a (recently renamed miR-146a-3p, miR146b-5p and miR-146b-3p). In both human placenta cell lines [42], 3A and HTR-8ab, miR146a was upregulated in both human placental cell lines, 3A and HTR-8A, whereas miR146b-5p showed reduced expression in the mouse placenta. Overexpression of miR-146a in these cell lines reduced cellular proliferation and rendered the cells more vulnerable to a DNA mutagenic agent [42]. Genome-wide miR expression profiling revealed that maternal exposure to BPA significantly correlated with overexpression of miR-146a in whole human placenta [22]. Developmental exposure to California mice to BPA, genistein, or the combination of these two EDC upregulated miR-146 in the hypothalamus of males and females [40]. In the mouse testes, BPA-induced miR-146a-5p that in turn impaired steroidogenesis through negative regulation of MTA) signaling [36]. Even though it is not clear why it is downregulated in the mouse placenta, it may be related to the specific isoform, miR146b-5p. In humans, maternal smoking is associated with the suppression of miR-146a in the placenta [65]. The collective studies suggest that miR-146 might be sensitive in a range of organs to xenoestrogen exposure in mammals and could serve as a barometer for such exposure.

Various forms of let-7 were also DE in human trophoblast cells lines exposed to BPA and mouse placenta. For instance, let-7f and g were elevated in both human lines treated with BPA [42]. In the mouse placenta, let-7b-5p was considerably upregulated, but let-7d had reduced expression. Several let-7 forms have been previously identified in the placenta and extra-embryonic tissues [66]. Conceivably, miR-146 and let-7 may be useful biomarkers of BPA and possibly other xenoestrogen exposure in mouse and humans. If further work reveals that changes in such small RNA expression changes in the placenta lead to associated fetal diseases, therapeutic approaches might be designed based on these small RNAs.

While both of these small RNAs appear to be expressed in mouse and placental tissues, it is possible that there are differences in other small RNA expression patterns across the placenta of these two species. While similarities exist between TB cells between mouse and human, there are also notable differences that may contribute to variation in small RNA expression patterns under normal conditions and in response to BPA exposure. Thus, it is essential to examine how BPA and related EDC affect individual human and mouse TB lineages.

A total of 142 target mRNAs were predicted to be affected by the panel of DE miRs. We presumed that such target mRNAs would be enriched in the placenta. However, TissueEnrich revealed that they represent those enriched in the thymus and central nervous system. Further, enrichment analysis revealed that pathways predicted to be affected are those involved in neurogenesis, neuron development, and neuron projection development. Such results were unexpected and suggest further linkages between the placenta–brain axis [67]. Whether miR from the placenta can circulate in extracellular vesicles to the developing neural tissue remains uncertain. Such extracellular vesicles containing miRs have been identified in maternal plasma samples with miR populations fluctuating throughout pregnancy [68]. Past studies have also shown similar genes are expressed in the placenta and brain, such as glucose transporters, Ogt, and human GRB10 [69–72].

One of the limitations of the current study is that we only tested placenta from female conceptuses. It is possible that early BPA exposure may lead to sex-dependent differences in small RNA expression. Yet, we did not know such sex differences when examining global transcriptomic profiles in the placenta following BPA exposure [20]. In future work, we will also plan to test multiple time points throughout gestation as miR profiles in the placenta may fluctuate throughout pregnancy.

Another limitation is that the current studies were done with whole mouse placental tissues, but this organ comprises heterogenous populations of cells, including those that form the labyrinth and junctional regions, such as parietal trophoblast giant cells at the interface with maternal tissue. While single nuclei RNA-seq approaches have been used to screen transcriptome profiles in individual murine trophoblast cells [73,74], such approaches have not currently been adapted for analyzing small RNAs in this organ. Further, the transcriptome profile of parietal trophoblast giant cells is not represented in these studies. These cells endoreplicate their nuclear genome resulting in large cells with nuclei of a diameter of 50 μm or greater. Their size presumably explains why their genetic signature patterns are not reflected in the current mouse single nuclei and single cell RNA-seq approaches [73,74]. We are in the process of differentiating mouse trophoblast stem cells to parietal trophoblast giant cells. This approach will facilitate to examine small RNA profiles in undifferentiated and differentiated trophoblast cells, as well as to determine how BPA and other factors affect these individual cell populations.

Conclusion

The current findings reveal that early exposure to BPA alters placental small RNA profiles in the mouse with approximately equal number being up regulated as those downregulated. In contrast to previous work that suggest BPA and other EDCs upregulates miR146 members in the human placenta and other organs, the only miR-146 form, miR146b-5p, exhibited reduced expression in the mouse placenta following maternal BPA exposure. Notwithstanding, the findings suggest that miR-146 forms might be vulnerable to BPA exposure, which could be exploited for diagnostic purposes. Surprisingly target mRNAs most closely aligned to those expressed by the thymus and brain rather than the placenta. Such associations with the latter were also reflected in pathway enrichment analyses that indicated such target mRNAs regulate neurogenesis and associated neurodevelopment. If further studies bare out this linkage, it suggests further ties between the placenta and fetal brain development that could thus be impacted by contact to maternal EDCs. In sum, the current worker provides potential biomarkers for BPA and possibly other EDC exposure and potentially suggests new paradigms in thinking about the placenta-brain axis.

Future perspective

While the current studies have advanced our understanding of how developmental exposure to BPA affects small RNA expression patterns in the mouse placenta, much work remains to be done. As detailed above, it is essential to pinpoint how BPA affects small RNA expression patterns in individual mouse trophoblast cells, which can be done through single nuclei RNA-seq for small RNAs, assuming this methodology becomes available, or via cell culture studies. It will also be important to screen other EDCs, such as BPS, other xenoestrogens and xenoandrogens, to determine if there are common small RNAs that they target. Examining for sex differences in relation to such exposure will also be essential. Lastly, it will be important to elucidate whether such small RNA changes induced by these chemicals affect mRNA populations in the placenta and/or the fetal brain. In this aspect, it will be essential to use labeling methods to track miRs and other small RNAs originating from the placenta and potentially reaching the brain through extracellular vesicles.

Summary points.

• Bisphenol A (BPA) is used as a plasticizer in many common household items.

• BPA can affect transcriptome and DNA methylation profiles in the placenta and other organs.

• It is uncertain whether BPA alters small RNA expression patterns in the mouse placenta.

• Mouse dams were fed 200 μg/kg body weight BPA daily for two weeks and bred.

• Placental samples were collected at gestational day 12.5 for small RNA-sequencing.

• Forty-three small RNAs were differentially expressed.

• Target mRNAs are closely aligned to those expressed by the thymus and brain.

• Pathway enrichment showed predicted target mRNAs regulate neurogenesis and neurodevelopment processes.

• Current findings provide potential biomarkers, small RNAs, for BPA exposure in the mouse placenta.

• The placenta might affect fetal brain development through the secretion of miRNAs.