Abstract
Background
BlaAFM-1 (GenBank Accession No. 143105.1) is a new B1 subclass metallo-β-lactamase gene discovered by our group, and isolated from an Alcaligenes faecalis plasmid that renders carbapenem antibiotics ineffective. In this study, we generated a fast and reliable assay for blaAFM-1 detection.
Methods
We designed optimum loop-mediated isothermal amplification (LAMP) primers and constructed a recombinant plasmid AFM-1 to specifically detect blaAFM-1. Optimal LAMP primers were used to assess sensitivity of the recombinant plasmid AFM-1 and blaAFM-1-supplemented samples (simulated sputum and simulated feces). Fifty two samples, without blaAFM-1, were used to assess LAMP real-time assay specificity; these samples were verified by conventional PCR and sequencing for the absence of blaAFM-1. Three hundred clinical Gram-negative carbapenem-resistant strains were tested by LAMP assay for strains carrying blaAFM-1, which were confirmed by conventional PCR and Sanger sequencing. We calculated the sensitivity and its 95% confidence interval (95% CI), specificity and its 95% CI, and predictive values of the LAMP assay and conventional PCR/sequencing by investigating positive and negative clinical strains.
Results
The lowest limit of detection for the recombinant plasmid AFM-1 and blaAFM-1-supplemented samples (in both simulated sputum and simulated feces) was 101 copies/reaction. All amplification curves of the 52 blaAFM-1-free bacteria strains were negative, suggesting the LAMP assay had excellent specificity for detecting blaAFM-1. Among the 300 clinical strains, eight were positive for blaAFM-1 using LAMP. These LAMP results were consistent with conventional PCR and Sanger sequencing data. As with conventional PCR/sequencing, the LAMP method exhibits 100% sensitivity (95% CI 59.8–100%) and 100% specificity (95% CI 98.4–100%) for blaAFM-1 detection. The LAMP assay is also time-efficient (1 h) for blaAFM-1 detection.
Conclusions
We established a new LAMP assay with high sensitivity and specificity to detect the novel B1-β-lactamase gene, blaAFM-1.
Supplementary Information
The online version contains supplementary material available at 10.1186/s12941-021-00486-z.
Keywords: Carbapenemase-producing organisms, BlaAFM-1 gene, B1 subclass metallo-β-lactamase, LAMP
Background
In recent years, the rate of carbapenem resistance in Gram-negative bacteria has been increasing and is now a worldwide problem [1, 2]. When compared with bacteria susceptible to carbapenem antibiotics, their disease causing potential leads to extremely high morbidity and mortality rates [3], with limited therapeutic options for carbapenem resistance Gram-negative organisms [4].
Carbapenemase production is an important mechanism underpinning bacterial resistance to carbapenem antibiotics. Carbapenemases are divided into three categories; A, B, and D Ambler classes [5, 6]. Ambler class B carbapenemases are also called metallo-β-lactamases (MBLs). Members of the MBLs include NDM (New Delhi metallo-β-lactamase), VIM (Verona integron-encoded metallo-β-lactamase), and IMP (imipenemase metallo-β-lactamase) which have now spread globally [4, 7]. Some bacteria can acquire drug-resistance genes from other bacteria via plasmid conjugation; this process has considerably compromised many clinical settings [4, 8]. Thus, carbapenemase gene detection is of great clinical significance.
In this study, a novel B1-β-lactamase gene blaAFM-1 (GenBank Accession No. 143105.1) was identified by our group on a plasmid from Alcaligenes faecalis. When compared with nucleotide and amino acid homologies of other B1-β-lactamase genes, the highest comparative identities were 85% and 87%, respectively. Conjugation assays indicated that blaAFM-1 is transferred from the donor strain (A. faecalis) to the recipient strain (Escherichia coli). Moreover, the Carba NP test also showed that carbapenemase AFM-1 could hydrolyze carbapenems. More interestingly, several strains, i.e., Comamonas testosteroni, Stenotrophomonas maltophilia, Bordetella trematum, and Comamonas aquatica were shown to harbor blaAFM-1 in clinical carbapenem-resistant Gram-negative strains.
Loop-mediated isothermal amplification (LAMP) uses six specific primer sets for six different regions of a target sequence. The Bst polymerase, with strand displacement activity and nucleic acid amplification functions, is used to perform nucleic acid amplifications under constant temperature conditions [9–11]. In this study, we established and evaluated a fast and reliable assay for detecting blaAFM-1 using the LAMP assay.
Materials and methods
Primer design
The blaAFM-1 sequence was downloaded from GenBank (GenBank Accession No. 143105.1). To determine the optimal primer set, several sets of primers were designed by Primer Explorer V4 software (http://primerexplorer.jp/e/). Each set consisted of six primer sequences, one pair of inner primers (BIP and FIP), one outer pair (F3 and B3), and one pair of loop primers (LF and LB). We selected the optimal LAMP primer set, with the highest amplification efficiency. Primers were designed by Guangzhou Bangce Biotechnology Co., Ltd (Guangzhou, China), and synthesized by Sangon Biotech Co., Ltd (Shanghai, China) (Table 1).
Table 1.
Optimal LAMP primer sets for blaAFM-1
| Primer | Sequences (5′–3′) | Position& (bp) |
|---|---|---|
| F3 | TTGGTGAGCAGGTGGATA | 95–112 |
| B3 | AAGGTCAGGCTGTGCT | 479–494 |
| FIP(F1c + F2) | TCATCGGTCCAGGCGGTAGGCAACATACCTCGTTCAT | – |
| BIP(B1c + B2) | TCAGACCAGCCAGATCCTCAACCATCTTGTCCTGATGCG | – |
| LF | CGCCATCCTTGACGATCA | 241–258 |
| LB | CTGGATTAAGCAAGAGATCAATCTG | 300–324 |
&The complete coding sequence of AFM-1 is taken as reference sequences
F3 and B3, outer primers; FIP and BIP, inner primers; LF and BF, loop primers
Construction of the recombinant plasmid AFM-1
BlaAFM-1 was chemically synthesized and ligated into the pET28-a(+) vector (Beijing Liuhe Huada Gene Technology Co., Ltd, Beijing, China) to construct the recombinant plasmid AFM-1 (Beijing Liuhe Huada Gene Technology Co., Ltd). Next, the plasmid was transformed into competent E. coli Top10 cells (Beijing Liuhe Huada Gene Technology Co., Ltd), and plated onto Luria Broth agar containing 4 μg/mL meropenem for overnight incubation at 37 °C. The next day, plasmid DNA was extracted from colonies using the Qiagen bacterial plasmid extraction kit (TianKangxin (Beijing) Technology Co., Ltd. Beijing, China), and the primers pET-F/R (Sangon Biotech (Shanghai) Co., Ltd) (Table 2) were used to PCR amplify the recombinant plasmid AFM-1. The plasmid was sequenced to verify the correct blaAFM-1 insert.
Table 2.
Conventional PCR primers
| Gene | Primers (5′–3′) | Length (bp) | Annealing temperature (°C) |
|---|---|---|---|
| Recombinant plasmid AFM-1 | pET-F: GATCCCGCGAAATTAATACG | 1123 | 59.1 |
| pET-R: GGCCCCAAGGGGTTATGCTAG | |||
| blaAFM-1 | AFM-1-F: CGATTGGTGAGCAGGTGGATAAGG | 336a | 60.5 |
| AFM-1-R: TCGACAAGGCATTGGCGTAAGTG | |||
| blaAFM-1 (full length) | AFM-F: ATGATTACGAAATCGAACATCGCG | 804b | 58.0 |
| AFM-R: TCAGCGCAGCTTGTCGGC |
aFragment amplified by specific primers for blaAFM-1
bFragment obtained from the full-length amplification of blaAFM-1
LAMP assay
The real-time fluorescence LAMP assay reaction system contained: 12.5 μL reaction solution, 1 μL Bst polymerase, 0.5 μL fluorescent dye, 3 μL ultrapure water, primer mixtures (1 μL internal primers BIP/FIP, 1 μL outer primers F3/B3, and 1 μL loop primers LF/LB at final concentrations of 1.6, 0.2, and 0.8 μM, respectively), 2 μL target DNA template, and 20 μL paraffin oil. Except for the DNA template, all other reagents were supplied by Guangzhou Bangce Biotechnology Co., Ltd. The positive control was a DNA template containing blaAFM-1, while the negative control was sterilized distilled water. The mixture was amplified on a LightCycler® 480 Real-Time PCR System (Roche Diagnostics, Basel, Switzerland) for 60 min at 60–65 °C (optimal temperature was 63 °C). One cycle of 63 °C for 30 s at holding stage; 60 cycles of 63 °C for 15 s, 60 cycles of 63 °C for 45 s at cycling stage. The fluorescence signal value at the 45th second of each cycling cycle was collected, the fluorescence channel was used to select the FAM channel, and positive (blaAFM-1-positive) results generated S-shaped curves within 40 cycles.
PCR assay
For conventional PCR, we used a 20 μL final reaction volume, including 10 μL 2 × Rapid Taq Master Mix, 7.4 μL sterilized distilled water, 0.8 μL upstream and 0.8 μL downstream AFM-1 primers (Table 2), and 1 μL DNA template. The PCR parameters were: 95 °C pre-denaturation for 5 min and then 40 cycles comprising 95 °C denaturation for 30 s, 58 °C annealing for 30 s, 72 °C extension for 30 s and 72 °C for 3 min. We electrophoresed the product on a 1.5% agarose gel, and stained and visualized it with ethidium bromide on a UV illuminator (Bio-Rad, USA). PCR amplification products were sent to Sangon Biotech for sequencing.
LAMP assay sensitivity
Once constructed, we calculated the initial concentration of the recombinant plasmid AFM-1, DNA concentrations were calculated by the following equation (ng/μL = optical density260 × dilution factor × 50), then adjusted to 105 copies/reaction for the LAMP assay. Copy numbers were calculated using the following formulae [copies/μL = 6.02 × 1023copies/mol × DNA concentration (ng/μL) × 10−9)/(660 × DNA length (bp)], followed by ten-fold serial dilutions to generate 105, 104, 103, 102, 101, and 100 copies/reaction. The minimum limit of detection was determined according to LAMP amplification curves.
The turbidity of A. faecalis AN70 strain bacterial solution expressing blaAFM-1 was adjusted to 0.5 McFarland units, and diluted with 0.9% NaCl solution (Sangon Biotech). This solution was mixed with the AN70 strain suspension. This solution was then mixed with blaAFM-1-free sputum and blaAFM-1-free feces samples, respectively, to generate blaAFM-1-supplemented sputum simulated sample and blaAFM-1-supplemented fecal simulated sample, respectively. Then genomic DNA was extracted with MagBeads sputum DNA Extraction Kit (Beijing Newcomb Technology Development Co., Ltd. Beijing, China) and MagBeads Feces DNA Extraction Kit (Beijing Newcomb Technology Development Co., Ltd.), respectively. BlaAFM-1-free sputum and blaAFM-1-free feces acted as negative controls. The final simulated sample concentrations were serially diluted 105, 104, 103, 102, 101, and 100 copies/reaction, from high to low. The recombinant plasmid AFM-1 and simulated samples were then used in the LAMP assay to assess sensitivity. We then compared and evaluated the sensitivity of the recombinant plasmid AFM-1 and simulated samples.
LAMP assay specificity
LAMP assay specificity was determined using 52 blaAFM-1-free strains (mainly collected from Nanfang hospital which is a tertiary comprehensive hospital), including six standard strains [obtained from National Center for Clinical Laboratories (Beijing, China)], 16 templates carrying the β-lactamase gene or carbapenemase gene, nine common Enterobacterales strains, six common non-fermenting strains, ten common Gram-positive cocci, four common fungi, and a human leukocyte sample. Recombinant plasmid AFM-1 was used as a positive control (Additional file 1: Table S1). Strain DNA was extracted using the Ezup column bacterial genomic DNA extraction kit (Sangon Biotech), and strains containing blaAFM-1 were confirmed by conventional PCR and sequencing. All strains were subjected to LAMP assay, under the same conditions, with specificity identified from amplification curves.
LAMP assay validation with clinical strains
Three hundred clinical Gram-negative carbapenem-resistant strains were collected to validate the LAMP assay. All carbapenem-resistant Gram-negative strains were identified and antimicrobial susceptibility tests were performed using the BD phoenix 100 Automated Microbiology System (BD Diagnostics, Franklin Lakes, NJ, USA). DNA from strains was extracted using the Ezup column bacterial genomic DNA extraction kit (Sangon Biotech). The blaAFM-1 gene was detected by LAMP and conventional PCR/sequencing. LAMP and PCR reactions were processed and sequenced as previously described. Recombinant plasmid AFM-1 and sterilized distilled water were used as positive and negative controls, respectively. We then compared differences between results.
Statistical analysis
Positive and negative numbers of the blaAFM-1 gene detected by the LAMP assay and conventional PCR/sequencing were counted, respectively. A 2 × 2 diagnostic test characteristics of the LAMP assay against PCR/sequencing table was drawn. Sensitivity, specificity and their 95% CIs, predictive values of clinical strains were calculated by these two methods.
Results
Optimal LAMP primer set
Using the same reaction conditions, we screened our optimal primer sets for the highest amplification efficiency (Fig. 1a).
Fig. 1.
a Amplification curve of the optimal primer sets. b–d The sensitivity of recombinant plasmid AFM-1, a sputum-simulated sample, and a feces-simulated sample, respectively. Amplification curves were obtained by diluting recombinant plasmid AFM-1 DNA, sputum-simulated sample, and feces-simulated sample from 105 copies/reaction to 100 copies/reaction, respectively. Sterile distilled water was used as a negative control
LAMP assay sensitivity
LAMP amplification curves indicated that the minimum limit of detection for blaAFM-1 from the recombinant plasmid AFM-1, two simulated (sputum simulated and feces simulated) samples were both 101 copies/reaction (Fig. 1b–d).
LAMP assay specificity
Due to LAMP specificity, except for recombinant plasmid AFM-1 which contained blaAFM-1 and generated S-shaped curves within 40 cycles, the other 52 samples without blaAFM-1 were not amplified. These data agreed with PCR amplification/sequencing data and indicated that the LAMP real-time assay exhibited high specificity for blaAFM-1.
Clinical strain validation
We used our LAMP assay to investigate 300 Gram-negative carbapenem-resistant strains; eight strains were identified as carrying blaAFM-1 (Fig. 2, Additional file 1: Table S2 for the information on positive strains), in agreement with conventional PCR results. Importantly, no false positive results were identified using the LAMP assay (Table 3). For clinical validation, when compared with conventional PCR/sequencing, the sensitivity, specificity, and predictive values of the LAMP method for detecting blaAFM-1 were 100% (Table 3). The 95% CI for sensitivity was 59.8–100%, and 98.4–100% for specificity.
Fig. 2.
Evaluation of the LAMP method with 300 clinical strains, eight strains (out of 300) generated S-shaped type amplification curves using LAMP.
Table 3.
Assay characteristics for blaAFM-1 detection in clinical strains (300)
| PCR/sequencing (+)* | PCR/sequencing (−)# | Total number | Sensitivity | Specificity | PPV | NPV | |
|---|---|---|---|---|---|---|---|
| LAMP (+) | 8 | 0 | 8 | 100% | 100% | 100% | 100% |
| LAMP (−) | 0 | 292 | 292 | ||||
| Total number | 8 | 292 | 300 |
*The number of strains that carry the blaAFM-1 gene; #The number of strains that do not carry the blaAFM-1 gene; PPV, positive predictive value; NPV, negative predictive value
Discussion
MBLs hydrolyze almost all types of β-lactams (including meropenem), but not aztreonam [5, 12]. Equally, lactamase inhibitors are also ineffective against MBLs [5, 12]. Due to disease risks and limited therapies for carbapenemase-producing organisms, especially MBL-producing organisms, the rapid and early detection of carbapenemases is an urgent requirement. BlaAFM-1, as a new member of the subclass B1 carbapenemase gene family, was first discovered on a broad host conjugative IncW plasmid, which easily conferred blaAFM-1 to other bacteria, therefore, AFM-1 enzyme is likely a certain risk.
To the best of our knowledge, LAMP technologies have been extensively used for bacteria, virus, and parasites [11]. LAMP internal and outer primers can increase reaction specificity, and loop primers can shorten reaction times, and increase sensitivity. It has been reported that when a recombinant plasmid containing the target gene, LAMP sensitivity was generally 100–10,000 times that of the PCR method [13]. Also, LAMP amplification does not require temperature cycling, and crude unpurified DNA can be used as a template to detect blaAFM-1 by LAMP assay [11, 14], which greatly shortens detection times. The LAMP assay takes 1 h to complete, is user-friendly, and simply requires the mixing of reaction solution, primers, Bst polymerase and templates in a constant temperature instrument. Due to strategic LAMP primer design, these primers not only detected blaAFM-1, but also distinguished other MBL genes, such as blaNDM-1; this gene displayed the highest identity (85%) with blaAFM-1, but was not amplified by the LAMP assay.
Notably, given the high sensitivity of the LAMP assay, it may also produce false positive results during reaction times due to high amplification efficiencies [11, 15, 16], To reduce false positives, aerosol pollution must be prevented during procedures, therefore paraffin oil addition will prevent this [11].
This study had several limitations. Firstly, the number of clinically verified strains was small and errors may have occurred during sensitivity and specificity assay calculations, therefore larger sample sizes are required for comprehensive clinical verification. Secondly, when compared with conventional culture assays, LAMP is rapid and time-efficient. However, its application to clinical specimens remains to be thoroughly explored and verified. Lastly, the β-lactamase and carbapenemase genes, used for LAMP-specificity evaluation, were single drug resistance genes. The coexistence of two or more drug resistance genes were not evaluated for LAMP specificity, thus further investigations are needed in the future.
Conclusions
The LAMP method was used to detect blaAFM-1 for the first time. When compared with conventional PCR/sequencing, our method was rapid, sensitive, and specific, and is suitable for laboratory applications.
Supplementary Information
Additional file 1: TableS1. Specimens for evaluating the specificity of the LAMP. TableS2. Information on positive strains.
Acknowledgements
We thank International Science Editing (http://www.internationalscienceediting.com) for editing this manuscript.
Abbreviations
- LAMP
Loop-mediated isothermal amplification
- 95% CI
95% Confidence interval
- MBLs
Metallo-β-lactamases
- NDM
New Delhi metallo-β-lactamase
- VIM
Verona integron-encoded metallo-β-lactamase
- IMP
Imipenemase metallo-β-lactamase
Authors’ contributions
YQ was responsible for experiments, data sorting and analysis. XD drafted tables and figures. Yuan Peng participated in collecting experimental strains and revising the manuscript. YR contributed to the experimental design and helped complete manuscript drafting. All authors read and approved the final manuscript.
Funding
This study was supported by Grants from the Natural Science Foundation of Guangdong Province (2021A1515012249), Guangdong Province Science and Technology Project (No. 2014A010107011 and No. 2015A020211011), Guangzhou City Science and Technology (No. 201510010167), and National Natural Science Foundation of China (No. 81601819).
Availability of data and materials
This article contains all the research data and materials of this research. Our data are readily available upon reasonable request.
Declarations
Ethical approval and consent to participate
Formal consent was obtained from the Medical Ethics Committee of NanFang Hospital, under approval number NFEC-2014-002. The study was approved by the institutional ethical committee, with waived informed consent.
Consent for publication
Not applicable.
Competing interest
We declare no competing interests.
Footnotes
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Yingcheng Qin, Xiaonv Duan and Yuan Peng contributed equally to this work
Contributor Information
Yingcheng Qin, Email: 1807238925@qq.com.
Xiaonv Duan, Email: 2458068747@qq.com.
Yuan Peng, Email: PYuan1993@163.com.
Yongyu Rui, Email: yongyuruigroup@sina.com.
References
- 1.Gniadek TJ, Carroll KC, Simner PJ. Carbapenem-resistant non-glucose-fermenting gram-negative bacilli: the missing piece to the puzzle. J Clin Microbiol. 2016;54:1700–1710. doi: 10.1128/JCM.03264-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Paul M, Daikos GL, Durante-Mangoni E, Yahav D, Carmeli Y, Benattar YD, Skiada A, Andini R, Eliakim-Raz N, Nutman A, Zusman O, Antoniadou A, Pafundi PC, Adler A, Dickstein Y, Pavleas I, Zampino R, Daitch V, Bitterman R, Zayyad H, Koppel F, Levi I, Babich T, Friberg LE, Mouton JW, Theuretzbacher U, Leibovici L. Colistin alone versus colistin plus meropenem for treatment of severe infections caused by carbapenem-resistant Gram-negative bacteria: an open-label, randomised controlled trial. Lancet Infect Dis. 2018;18:391–400. doi: 10.1016/S1473-3099(18)30099-9. [DOI] [PubMed] [Google Scholar]
- 3.Nordmann P, Poirel L. Epidemiology and diagnostics of carbapenem resistance in gram-negative bacteria. Clin Infect Dis. 2019;69:S521–S528. doi: 10.1093/cid/ciz824. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Bonomo RA, Burd EM, Conly J, Limbago BM, Poirel L, Segre JA, Westblade LF. Carbapenemase-producing organisms: a global scourge. Clin Infect Dis. 2018;66:1290–1297. doi: 10.1093/cid/cix893. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Queenan AM, Bush K. Carbapenemases: the versatile beta-lactamases. Clin Microbiol Rev. 2007;20:440–458. doi: 10.1128/CMR.00001-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Astocondor-Salazar L. Betalactamases: the evolution of the problem. Rev Peru Investig Salud. 2018;2(2):42–49. doi: 10.35839/repis.2.2.224. [DOI] [Google Scholar]
- 7.Viau R, Frank KM, Jacobs MR, Wilson B, Kaye K, Donskey CJ, Perez F, Endimiani A, Bonomo RA. Intestinal carriage of carbapenemase-producing organisms: current status of surveillance methods. Clin Microbiol Rev. 2016;29:1–27. doi: 10.1128/CMR.00108-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Bebrone C. Metallo-beta-lactamases (classification, activity, genetic organization, structure, zinc coordination) and their superfamily. Biochem Pharmacol. 2007;74:1686–1701. doi: 10.1016/j.bcp.2007.05.021. [DOI] [PubMed] [Google Scholar]
- 9.Zhong LL, Zhou Q, Tan CY, Roberts AP, El-Sayed Ahmed MAE, Chen G, Dai M, Yang F, Xia Y, Liao K, Liang Y, Yang Y, Feng S, Zheng X, Tian GB. Multiplex loop-mediated isothermal amplification (multi-LAMP) assay for rapid detection of mcr-1 to mcr-5 in colistin-resistant bacteria. Infect Drug Resist. 2019;12:1877–1887. doi: 10.2147/IDR.S210226. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Sekiguchi J, Asagi T, Miyoshi-Akiyama T, Kasai A, Mizuguchi Y, Araake M, Fujino T, Kikuchi H, Sasaki S, Watari H, Kojima T, Miki H, Kanemitsu K, Kunishima H, Kikuchi Y, Kaku M, Yoshikura H, Kuratsuji T, Kirikae T. Outbreaks of multidrug-resistant Pseudomonas aeruginosa in community hospitals in Japan. J Clin Microbiol. 2007;45:979–989. doi: 10.1128/JCM.01772-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Liu W, Zou D, Li Y, Wang X, He X, Wei X, Shao C, Li X, Shang W, Yu K, Liu D, Li Y, Guo J, Yin Z, Yuan J. Sensitive and rapid detection of the new Delhi metallo-beta-lactamase gene by loop-mediated isothermal amplification. J Clin Microbiol. 2012;50:1580–1585. doi: 10.1128/JCM.06647-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Logan LK, Weinstein RA. The epidemiology of carbapenem-resistant enterobacteriaceae: the impact and evolution of a global menace. J Infect Dis. 2017;215:S28–S36. doi: 10.1093/infdis/jiw282. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Vielba-Fernandez A, de Vicente A, Perez-Garcia A, Fernandez-Ortuno D. Monitoring methyl benzimidazole carbamate-resistant isolates of the cucurbit powdery mildew pathogen, Podosphaera xanthii, using loop-mediated isothermal amplification. Plant Dis. 2019;103:1515–1524. doi: 10.1094/PDIS-12-18-2256-RE. [DOI] [PubMed] [Google Scholar]
- 14.Takano C, Kuramochi Y, Seki M, Kim DW, Omagari D, Sasano M, Chang B, Ohnishi M, Kim EJ, Fuwa K, Kilgore PE, Hoshino T, Hayakawa S. Molecular serotype-specific identification of Streptococcus pneumoniae using loop-mediated isothermal amplification. Sci Rep. 2019;9:19823. doi: 10.1038/s41598-019-56225-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Srisrattakarn A, Lulitanond A, Wilailuckana C, Charoensri N, Wonglakorn L, Saenjamla P, Chaimanee P, Daduang J, Chanawong A. Rapid and simple identification of carbapenemase genes, bla NDM, bla OXA-48, bla VIM, bla IMP-14 and bla KPC groups, in Gram-negative bacilli by in-house loop-mediated isothermal amplification with hydroxynaphthol blue dye. World J Microbiol Biotechnol. 2017;33:130–140. doi: 10.1007/s11274-017-2295-5. [DOI] [PubMed] [Google Scholar]
- 16.Dong D, Liu W, Li H, Wang Y, Li X, Zou D, Yang Z, Huang S, Zhou D, Huang L, Yuan J. Survey and rapid detection of Klebsiella pneumoniae in clinical samples targeting the rcsA gene in Beijing. China Front Microbiol. 2015;6:519. doi: 10.3389/fmicb.2015.00519. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Zheng F, Sun J, Cheng C, Rui Y. The establishment of a duplex real-time PCR assay for rapid and simultaneous detection of blaNDM and blaKPC genes in bacteria. Ann Clin Micob Anti. 2013;12:1–5. doi: 10.1186/1476-0711-12-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Li S, Duan X, Peng Y, Rui Y. Molecular characteristics of carbapenem-resistant Acinetobacter spp. from clinical infection samples and fecal survey samples in Southern China. BMC Infect Dis. 2019;19:900. doi: 10.1186/s12879-019-4423-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Yang Q, Rui Y. Two multiplex real-time PCR assays to detect and differentiate Acinetobacter baumannii and non- baumannii Acinetobacter spp. carrying blaNDM, blaOXA-23-Like, blaOXA-40-Like, blaOXA-51-Like, and blaOXA-58-like genes. PLoS ONE. 2016;11:e0158958. doi: 10.1371/journal.pone.0158958. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Wang F, Wu K, Sun J, Wang Q, Chen Q, Yu S, Rui Y. Novel ISCR1-linked resistance genes found in multidrug-resistant Gram-negative bacteria in southern China. Int J Antimicrob Agents. 2012;40:404–408. doi: 10.1016/j.ijantimicag.2012.06.016. [DOI] [PubMed] [Google Scholar]
- 21.Wu K, Wang F, Sun J, Wang Q, Chen Q, Yu S, Rui Y. Class 1 integron gene cassettes in multidrug-resistant Gram-negative bacteria in southern China. Int J Antimicrob Agents. 2012;40:264–267. doi: 10.1016/j.ijantimicag.2012.05.017. [DOI] [PubMed] [Google Scholar]
- 22.Li S, Peng Y, Rui Y. Multiplex real-time PCR assays to detect Stenotrophomonas maltophilia carrying sul1, sul2, and sul3 genes. J Microbiol Methods. 2019;156:52–59. doi: 10.1016/j.mimet.2018.12.002. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Additional file 1: TableS1. Specimens for evaluating the specificity of the LAMP. TableS2. Information on positive strains.
Data Availability Statement
This article contains all the research data and materials of this research. Our data are readily available upon reasonable request.