Skip to main content
NCBI home page
International Journal of Molecular Sciences logoLink to International Journal of Molecular Sciences
. 2021 Nov 24;22(23):12723. doi: 10.3390/ijms222312723

Genetic Analysis of Hexaploid Wheat (Triticum aestivum L.) Using the Complete Sequencing of Chloroplast DNA and Haplotype Analysis of the Wknox1 Gene

Mari Gogniashvili 1,*, Yoshihiro Matsuoka 2, Tengiz Beridze 1
Editor: Sukhwinder Singh
PMCID: PMC8657936  PMID: 34884525

Abstract

The aim of the presented study is a genetic characterization of the hexaploid wheat Triticum aestivum L. Two approaches were used for the genealogical study of hexaploid wheats—the complete sequencing of chloroplast DNA and PCR-based haplotype analysis of the fourth intron of Wknox1d and of the fifth-to-sixth-exon region of Wknox1b. The complete chloroplast DNA sequences of 13 hexaploid wheat samples were determined: Free-threshing—T. aestivum subsp. aestivum, one sample; T. aestivum subsp. compactum, two samples; T. aestivum subsp. sphaerococcum, one sample; T. aestivum subsp. carthlicoides, four samples. Hulled—T. aestivum subsp. spelta, three samples; T. aestivum subsp. vavilovii jakubz., two samples. The comparative analysis of complete cpDNA sequences of 20 hexaploid wheat samples (13 samples in this article plus 7 samples sequenced in this laboratory in 2018) was carried out. PCR-based haplotype analysis of the fourth intron of Wknox1d and of the fifth-to-sixth exon region of Wknox1b of all 20 hexaploid wheat samples was carried out. The 20 hexaploid wheat samples (13 samples in this article plus 7 samples in 2018) can be divided into two groups—T. aestivum subsp. spelta, three samples and T. aestivum subsp. vavilovii collected in Armenia, and the remaining 16 samples, including T. aestivum subsp. vavilovii collected in Europe (Sweden). If we take the cpDNA of Chinese Spring as a reference, 25 SNPs can be identified. Furthermore, 13–14 SNPs can be identified in T. aestivum subsp. spelta and subsp. vavilovii (Vav1). In the other samples up to 11 SNPs were detected. 22 SNPs are found in the intergenic regions, 2 found in introns, and 10 SNPs were found in the genes, of which seven are synonymous. PCR-based haplotype analysis of the fourth intron of Wknox1d and the fifth-to-sixth-exon region of Wknox1b provides an opportunity to make an assumption that hexaploid wheats T. aestivum subsp. macha var. palaeocolchicum and var. letshckumicum differ from other macha samples by the absence of a 42 bp insertion in the fourth intron of Wknox1d. One possible explanation for this observation would be that two Aegilops tauschii Coss. (A) and (B) participated in the formation of hexaploids through the D genome: Ae. tauschii (A)—macha (1–5, 7, 8, 10–12), and Ae. tauschii (B)—macha M6, M9, T. aestivum subsp. aestivum cv. ‘Chinese Spring’ and cv. ‘Red Doly’.

Keywords: Triticum aestivum L., chloroplast DNA, sequencing, Illumina, SNP, Wknox1 gene

1. Introduction

Wheat is the leading grain crop in the world. It originated in the Fertile Crescent approximately 10,000 years ago and has since spread worldwide. There are two biological species of hexaploidy wheat—T. aestivum, genome BBAuAuDD and Triticum zhukovskyi Menabde & Ericz., GGAuAuAmAm. T. zhukovskyi and its predecessors (Triticum monococcum L. and Triticum timopheevii (Zhuk.) Zhuk.) form a separate lineage irrelevant to the evolution of the principal wheat lineage, which is formed by T. aestivum and its predecessors Aegilops tauschii Coss. And Triticum turgidum L. [1].

The T. aestivum lineage is divided into the domesticated, hulled lineage and the free-threshing lineage. The free-threshing lineage includes T. aestivum subsp. Aestivum, T. aestivum subsp. Compactum (Host) Mackey, T. aestivum subsp. Sphaerococcum (Percival) Mackey, and T. aestivum subsp. carthlicoides nom. nud. (Table 1 and Table 2).

Table 1.

List of hexaploid wheats.

Species Genome Plasmon
Hulled
T. zhukovskyi 		GGAuAuAmAm G
Hulled
T. aestivum
T. aestivum subsp. spelta Thell. BBAuAuDD B
T. aestivum subsp. macha (Dekapr. and Menabde) Mackey
T. aestivum subsp. vavilovii Jakubz.
Free-threshing
T. aestivum 		T. aestivum subsp. aestivum
T. aestivum subsp. compactum (Host) Mackey
T. aestivum subsp. sphaerococcum (Percival) Mackey
T. aestivum subsp. carthlicoides nom. nud.
Open in a new tab

Table 2.

Jacubciner’s classification system (1958) According to Yen a. Yang [2].

Congretio Species Distribution Areas Habits
Hexaploidea Cultivated hulled
2n = 42 T. zhukovskyi Men.et Er. Georgia Springness
T. macha Dek.et Men. Georgia Winterness
T. spelta L. Iran, south Germany, Spain Winterness, Springness
Cultivated naked grain
T. aestivum L. All over the world Springness, winterness, half winterness
T. compactum Host Transcaucasia, Kazakhstan, Asia Minor, Afghan, Chile Springness, winterness, half-winterness
T. vavilovii Jakubz. Armenia Winterness
T. sphaerococcum Perc. Pakistan, India Springness
Open in a new tab

Hexaploid wheat T. aestivum subsp. carthlicoides was found by Kuckuck [3] near the border of Turkey, Armenia and West Georgia. This hexaploid wheat showed the subsp. carthlicum-like spike morphology.

The hulled lineage includes spelt wheat T. aestivum subsp. spelta Thell., macha T. aestivum subsp. macha (Dekapr. and Menabde) Mackey and T. aestivum subsp. vavilovii Jakubz. In hulled wheats, glumes tenaciously enclose seeds, and strong mechanical force is needed to liberate seeds from glumes during threshing.

According to Dekaprelevich, Georgia is characterized by the largest number of cultivated wheat species in the world; altogether, 12 species of are found here. Only three narrowly endemic species, Triticum abyssinicum Vav., T. sphaerococcum and T. spelta, are absent [4].

South Caucasus (notably Georgia) and its earlier residents played an important role in wheat formation. In total, 17 domesticated species and subspecies of Triticum are known. Georgian endemic wheat species include one Triticum species and four subspecies [5,6,7]:

  1. Triticum turgidum subsp. palaeocolchicum (Menabde) A. Love

  2. Triticum turgidum subsp. carthlicum (Nevski) A. Love

  3. Triticum timopheevii subsp. zhukovskyi (Menabde & Ericzjan) L. B. Cai

  4. Triticum zhukovskyi Menabde & Ericzjan

  5. Triticum aestivum subsp. macha (Dekapr. & Menabde) McKey

All these cultivated species and subspecies have been found only in West Georgia, except subsp. carthlicum which has been distributed in East Georgia as well. All these species and subspecies grew in the territory of Georgia until the middle of the last century.

The “Wheat Enigma” was a term for the observation that wild predecessors of five Georgian endemic wheat subspecies are found in Fertile Crescent, quite far from the South Caucasus [8,9]. One possibility to explain the “Wheat Enigma” is that speakers of ProtoGeorgian language could have moved to Mesopotamia after migration from Africa to the Arabian Peninsula, where wheat was domesticated. Furthermore, they could have migrated to South Caucasus together with domesticated wheat subspecies [9,10].

The examination of genealogical data provides insights into the evolutionary history of a species. The wide application of gene genealogies for evolutional studies in plants involves identifying DNA sequences with levels of ordered variation within chloroplast, mitochondrial, or nuclear genomes [11]. Traditionally, extranuclear DNA, such as chloroplast DNA (cpDNA), has been considered as an effective tool for genealogic studies [12,13,14]. The sequences of wheat plasmons B and G (complete cpDNA sequences) of the genus Triticum were determined in our laboratory [8,15,16]. Plasmon B is detected in polyploid species—Triticum turgidum and T. aestivum. Plasmon of T. zhukovskyi belong to the G type.

Another effective tool for gene genealogy studies for Triticum species is the three homoeologous loci of wheat Wknox1 gene, functioning at shoot apical meristems (SAM) [17]. A comparative study of the three Wknox1 genomic sequences revealed accumulation of numerous mutations, particularly in the fourth intron and the 5′-upstream region. Later, Takumi a. Morimoto [18] reported the discovery of a new allele for the fifth-to-sixth exon region of the Wknox1b KNOTTED1-type homeobox gene in a common wheat subspecies (T. aestivum subsp. carthlicoides).

The purpose of the present investigation was to carry out the comparative analysis of complete cpDNA sequences of 20 hexaploid wheat accessions (T. aestivum subsp. aestivum, two samples; T. aestivum subsp. compactum, two samples; T. aestivum subsp. sphaerococcum, one sample; T. aestivum subsp. carthlikoides, four samples; T. aestivum subsp. spelta, three samples; T. aestivum subsp. macha, six samples; T. aestivum subsp. vavilovii, two samples.

The second aim of the present investigation was to carry out a PCR-based haplotype analysis of the fourth intron of Wknox1d and of the fifth-to-sixth exon region of Wknox1b of all 20 hexaploid wheat samples.

2. Results

2.1. Complete cpDNA Sequence of Hexaploid Wheats

For comparative analysis of chloroplast DNA of hexaploid wheats, 20 hexaploid wheat samples were selected. CpDNA sequences from 13 of them were sequenced in this study, and the remaining 7 were sequenced earlier [15] (Table 3).

Table 3.

Hexaploid wheat accessions used in the study.

Botanical Name GenBank Accession Number
Hulled
M1 Triticum aestivum L. subsp. macha (Dekapr. and Menabde) Mackey var. megrelicum (Menabde) LC372826 ISU
M2 Triticum aestivum L. subsp. macha (Dekapr. and Menabde) Mackey var. georgicum (Menabde) LC373211 ISU
M3 Triticum aestivum L. subsp. macha (Dekapr. and Menabde) Mackey var. colchicum (Dekapr. and Menabde) LC375536 ISU
M4 Triticum aestivum L. subsp. macha (Dekapr. and Menabde) Mackey var. scharaschidzei (Menabde) LC374397 ISU
M5 Triticum aestivum L. subsp. macha (Dekapr. and Menabde) Mackey var. palaeoimereticum (Dekapr. and Menabde) LC375773 ISU
M6 Triticum aestivum L. subsp. macha (Dekapr. and Menabde) Mackey var. palaeocolchicum (Dekapr. and Menabde) NC_025955 ISU
M7 Triticum aestivum L. subsp. macha (Dekapr. and Menabde) Mackey var. ericzjanae Menabde ISU
M8 Triticum aestivum L. subsp. macha (Dekapr. and Menabde) Mackey var. ibericum Dekapr. and Menabde ISU
M9 Triticum aestivum L. subsp. macha (Dekapr. and Menabde) Mackey var. letshchumicum Dekapr. and Menabde ISU
M10 Triticum aestivum L. subsp. macha (Dekapr. and Menabde) Mackey var. subcolchicum Dekapr. and Menabde ISU
M11 Triticum aestivum L. subsp. macha (Dekapr. and Menabde) Mackey var. submegrelicum Dekapr. and Menabde ISU
M12 Triticum aestivum L. subsp. macha (Dekapr. and Menabde) Mackey var. subletshchumicum Dekapr. and Menabde ISU
Splt2 Triticum aestivum L. subsp. spelta (L.) Thell. LC625352 PI 348000
Splt1 Triticum aestivum L. subsp. spelta (L.) Thell. LC625353 PI 348220
Splt3 Triticum aestivum L. subsp. spelta (L.) Thell. LC625866 PI 191393
Vav1 Triticum vavilovii Jakubz. LC621349 PI 326319
Vav2 Triticum vavilovii Jakubz. LC625865 PI 428342
Free-threshing
RD Triticum aestivum L. subsp. aestivum var. ferrugineum (Alef.) Mansf. cv. ‘Red Doly’ LC377169 ISU
CS Triticum aestivum L. subsp. aestivum cv. ‘Chinese Spring’ LC622404
Cc1 Triticum aestivum L. subsp. carthlicoides nom. nud. LC621350 PI 262678
Cc3 Triticum aestivum L. subsp. carthlicoides nom. nud. LC621195 SRCA
Cc2 Triticum aestivum L. subsp. carthlicoides nom. nud. LC622405 PI 532901
Cc4 Triticum aestivum L. subsp. carthlicoides nom. nud. LC621194 SRCA
Com2 Triticum aestivum L. subsp. compactum (Host) Mackey LC623766 KU-9873
Com1 Triticum aestivum L. subsp. compactum (Host) Mackey LC623764 ISU
Sph1 Triticum aestivum L. subsp. sphaerococcum (Percival) Mackey LC623765 Cltr17737
Open in a new tab

The samples were structured as follows: free-threshing—T. aestivum subsp. aestivum, two samples—Chinese Spring and Red Doly; T. aestivum subsp. compactum—two samples; T. aestivum subsp. sphaerococcum—one sample; T. aestivum subsp. carthlicoides—four samples; Hulled—T. aestivum subsp. spelta—three samples; T. aestivum subsp. vavilovii two samples; T. aestivum subsp. macha—six samples.

To illustrate the evolutionary relationship among the studied cultivars, a phylogenetic tree was constructed based on complete nucleotide sequences of cpDNA of 20 hexaploid wheat samples (Figure 1).

Figure 1.

Figure 1

Open in a new tab

Complete chloroplast genome phylogeny of hexaploid wheats.

If we take the cpDNA of Chinese Spring as a reference, 25 SNPs can be identified. Furthermore, 13–14 SNPs can be identified in T. aestivum subsp. Spelta and subsp. Vavilovii (Vav1) (collected in Armenia) (Table 4). In the other samples, up to 11 SNPs were detected. In total, 22 SNPs are found in the intergenic regions, 2 were found in introns, and 10 SNPs were found in the genes, of which seven are synonymous and do not alter the amino acids. Indels specific for 20 cpDNA are given in Table 5.

Table 4.

SNPs specific for chloroplast DNA of hexaploid wheats.

Nucleotide Position According to CS Locus CS M6 Vav1 Cc2 Cc1,
Cc3,
Cc4		 RD Sph1 M2,
M3,
M5		 M4 M1 Com1 Com2 Splt1 Splt2 Splt3 Vav2 Amino Acid Substitution
2903 Gene matK G C A–G
3400 Intergenic matK-trnK-UUU C A A A A
4918 Intron rps16 T C
13,015 Intergenic trnfM-CAT-trnT-GGT T C C C C
14,580 Intergenic trnfM-CAT-trnT-GGT C G
15,371 Intergenic trnY-GTA-trnD-GTC A G G G G
16,481 Intergenic trnD-GTC-psbM C T T T T
20,853 Gene rpoB C T T T T Syn
25,444 Gene rpoC2 C A A A A Syn
32,710 Intergenic atpH-atpF C T
44,509 Intergenic ycf3 trnS-GGA C A
45,856 Intergenic rps4-trnT-TGT A C C C C
46,434 Intergenic trnT-TGT trnF-GAA G T T T T
47,628 Intergenic trnT-TGT-trnF-GAA G A A G G G G
50,332 Intergenic ndhC-trnM-CAT G T T T T
50,716 Intergenic ndhC-trnM-CAT T C C C C
52,295 Gene atpB G T T T T Q–K
56,472 Intergenic rbcL-psaI A G G G G G
56,670 Intergenic rbcL-psaI C T T T T
63,289 Gene petG A T T T T Syn
64,318 Intergenic psaJ-rpl33 C T T T T
72,207 Intergenic petB-petD C T T T T
73,742 Intergenic petD-rpoA T C C C C
78,113 Intron rpl16 C T T T T
78,732 Intergenic rpl16-rps3 G T T T T
82,499 Intergenic rpl23-trnI-CAT T G
100,961 Gene rps15 T G Syn
102,561 Gene ndhF C T T T Syn
104,993 Intergenic rpl32-trnL-TAG A C C C C
105,477 Intergenic rpl32-trnL-TAG C A A A A
106,672 Gene ccsA C T T T T Syn
113,487 Gene ndhH T G Syn
114,943 Gene rps15 A C F–L
133,405 Intergenic trnI-CAT-rpl23 A C
Open in a new tab

Table 5.

Indels specific for chloroplast DNA of hexaploid wheats.

Nucleotide Position According to CS Locus CS M6 Vav1 Cc2 Cc1,
Cc3,
Cc4		 RD Sph1 M2,
M3,
M5		 M4 M1 Com2 Com1 Splt1 Splt2 Splt3 Vav2
4175 Intergenic matK-rps16 - AAAAT AAAAT AAAAT AAAAT
7422 Intergenic psbI-trnS-GCT 15T 18T 12T 12T 12T
8219 Intergenic trnS-GCT-psbD 10T 11T
8407 Intergenic trnS-GCT-psbD - TATTTCT ATTTCT ATTTCT ATTTCT ATTTCT
11,183 Intergenic psbC-trnS-TGA 14A 13A 13A 13A 13A
17,991 Intergenic petN-trnC-GCA 10A 11A 11A 11A 11A 11A 11A 11A
18,757 Intergenic trnC-GCA-rpoB 19C 9C 8C 8C
31,609 Intergenic atpI-atpH 12T 11T
32,442 Intergenic atpH-atpF +A +A +A +A
33,718 Intron atpH 14A 13A 13A 13A 13A 12A
42,920 I intron ycf3 10T 9T 9T 9T
42,931 I intron ycf3 3T 2T
45,993 Intergenic rps4-trnT-TGT 8A 9A 9A 9A 9A
47,788 Intergenic trnF-GAA-ndhJ 15A 14A 11A 11A 11A 10A
56,724 Intergenic rbcL-psaI 10T 9T
60,767 Intergenic petA psbJ +CATT +CATT +CATT +CATT
60,773 Intergenic petA-psbJ 17T 16T 16T 16T 16T 16T 16T 16T 16T 16T 15T 16T
62,041 Intergenic psbE-petL - +TA +TA +TA +TA
Duplication_70,856 Intron petB TATT TATT TATT TATT
71,219 Intron petB 6T 7T 7T 7T 7T
73,586 Intergenic petD-rpoA 5T 6T 6T 6T 6T
75,699 Intergenic rpl36-infA 10A 11A 11A 11A
76,051-62_duplication Intergenic infA-rps8 CTGTCATATTTT
76,599 Intergenic rps8-rpl14 10T 11T 11T 11T 9T 9T 9T
77,140 Intergenic rpl14-rpl16 10T 9T 9T 9T 9T 9T
86,581 Intron ndhB 5T 4T
104,113 Intergenic ndhF-rpl32 13A 11A 12A 14A
129,319 Intron ndhB 5A 4A
Open in a new tab

One 35bp insertion and three inversions (56bp, 58bp and 25bp in length) have been identified in Triticum aestivum subsp. spelta (Splt1, Splt2, Splt3) and T. aestivum subsp. vavilovii (Vav2) samples (Table 6). One 38bp inversion (TCGGCTCAATCTTTTTTTTCTAAAAAAGATTGAGCCGA) with a 4bp loop has been identified in T. aestivum subsp. vavilovii (Vav1) (collected in Armenia) in the position 56,120–56,157 (intergenic rbcL—psaI).

Table 6.

Inversions and a long insertion specific for chloroplast DNA of hexaploid wheats.

Nucleotide Position According to CS Locus Splt1, Splt2, Splt3, Vav2 Length
79,532 Gene rpl22 GATGGATCTAAAGGTTATTTAGATTTCTTTACTAT Insertion 35 bp
105,139–105,196 Intergenic rpl32—trnL-TAG ACTTTTCATAATTTTCATAATAGAATCCT
CATATTTTATTATGAAAATTATGAAAAGT		 Inversion with 14 bp loop 58 bp
106,795–106,819 Intergenic ccsA—ndhD AAAACCTTCATGAAATGAAGGTTTT Inversion with 3 bp loop 25 bp
135,896-52 Intergenic rps19—psbA AAAGACAGAAATACCCAATATCTTGCTA
GAACAAGATATTGGGTATTTCTGTCTTT		 Inversion with 6 bp loop 56 bp
Open in a new tab

This section may be divided into subheadings. It should provide a concise and precise description of the experimental results, their interpretation, as well as the experimental conclusions that can be drawn.

2.2. PCR Analysis of Three Homoeologous Loci of Wheat Wknox1 Gene

2.2.1. Wknox1d Fourth Intron Region

In the present investigation, the genomic sequences of the Wknox1d fourth intron regions were amplified by PCR using the primer pair of Takumi a. Morimoto [18] (Table 7). A common wheat, T. aestivum subsp. aestivum cv. ‘Chinese Spring’ (CS), and a durum wheat, T. turgidum subsp. durum cv. ‘Langdon’ (Ldn), were used for PCR as control and the amplified DNA fragments were visualized on an agarose gel. In the fourth intron of Wknox1d in common wheat, a 122-bp MITE insertion has been reported [17]. The MITE-containing band (411 bp) was missing in all tetraploid wheat accessions and was observed in all subspecies of common wheat. In the case of subsp. macha (11 samples) the 453 bp band was observed. In the case of two macha samples (M6 and M9) the MITE-containing band typical for other hexaploid subspecies (411 bp) were detected.

Table 7.

PCR-based haplotype analysis of the fourth intron of Wknox1d. A 122-bp MITE insertion specifically observed at the D-genome locus of Wknox1 generates the upper bands (411 bp) in hexaploid wheat accessions (except Triticum aestivum L. subsp. compactum) and 453 bp in macha accessions.

Sample PCR Product, bp
277, 284 375 400 411 453
Triticum aestivum subsp.aestivum cv. ‘Chinese Spring’ (CS) + + +
Triticum aestivum subsp. aestivum var. ferrugineum (Alef.) Mansf. cv. ‘Red Doly’ (RD) + + +
Triticum aestivum subsp. carthlicoides (Cc1, Cc2. Cc3. Cc4) + + +
Triticum aestivum subsp. compactum (Com2) +
Triticum aestivum subsp. compactum (Com1) + + +
Triticum aestivum subsp. sphaerococcum (Sph1) + + +
Triticum aestivum subsp. macha (M6, M9) + + +
Triticum aestivum subsp. macha (M1, M2, M3, M4, M5, M7, M8 M10, M11, M12) + + +
Triticum aestivum subsp. spelta (splt1, splt2, splt3) + + +
Triticum vavilovii (Arm) (Vav1) + + +
Triticum vavilovii (Eur) (Vav2) + + +
Triticum turgidum subsp. carthlicum var. rubiginosum +
Triticum turgidum subsp. durum cv. ‘Langdon’ (Ldn) +
Open in a new tab

In 2% agarose-gel, the PCR-amplified, fourth intron of the Wknox1d DNA region of hexaploid wheat gives four bands: N1 (280 bp), N2 (375 bp), N3 (411 bp), and N4 (453). Bands N3 and N4 were cut out and sequenced. In the case of band N4 (453), a 42 bp insertion was detected in the position 7009—AGTTTGCACACCTGAACATTTTGCATTATGTTCGGGAGCCTA (Figure 2).

Figure 2.

Figure 2

Open in a new tab

Image of 2% agarose gel electrophoresis of PCR-amplified fourth intron of Wknox1d DNA region of hexaploid wheat. Lanes: 2—T. turgidum subsp. carthlicum, 3—T. turgidum subsp. durum (Ldn), 4—T. aestivum subsp. aestivum (CS), 5—T. aestivum subsp. carthlicoides, 6—T. aestivum subsp. carthlicoides, 7—T. aestivum subsp. macha (M_6), 8—T. aestivum subsp. macha (M_9), 9—T. aestivum subsp. macha (M_1), 10—T. aestivum subsp. macha (M_2), 11—T. aestivum subsp. macha (M_3); Lanes 1, 12—100 bp DNA marker.

2.2.2. Fifth-to-Sixth Exon Region of Wknox1b

PCR-based haplotype analysis of the fifth-to-sixth exon region of Wknox1b showed that the 157-bp MITE inserted band (588 bp) is present in T. turgidum subsp. durum cv. ‘Langdon’; CS; Red Doly (Table 8). This band is absent in tetraploid T. turgidum subsp. carthlicum, T. aestivum L. subsp. carthlicoides, T. aestivum subsp. macha (M1–M13).

Table 8.

PCR-based haplotype analysis of the fifth-to-sixth exon region of Wknox1b.

Sample PCR Product, bp
410 429, 430 560 588
Triticum aestivum subsp.aestivum cv. ‘Chinese Spring’ (CS) + + +
Triticum aestivum subsp. aestivum var. ferrugineum cv. ‘Red Doly’ (RD) + + +
Triticum aestivum subsp. carthlicoides (Cc1, Cc2, Cc3, Cc4) +
Triticum aestivum subsp. compactum (Com2) + + +
Triticum aestivum subsp. compactum (Com1) +
Triticum aestivum subsp. sphaerococcum (Sph1) + + +
Triticum aestivum subsp. macha (M6, M9) +
Triticum aestivum subsp. macha (M1, M2, M3, M4, M5, M7, M 8, M10, M11, M12) +
Triticum aestivum subsp. spelta (splt1, splt2, splt3) + + +
Triticum vavilovii (Arm) (Vav1) + +
Triticum vavilovii (Eur) (Vav2) + + +
Triticum turgidum subsp. carthlicum var. rubiginosum +
Triticum turgidum subsp. durum cv. ‘Langdon’ (Ldn) + + +
Open in a new tab

Hexaploid wheats with matching values of the fourth intron of Wknox1d and the fifth-to-sixth-exon region of Wknox1b are given in Table 9.

Table 9.

Hexaploid wheats with matching values of fourth intron of Wknox1d and fifth-to-sixth exon region of Wknox1b.

Triticum aestivum subsp. carthlicoides (Cc1, Cc2, Cc3, Cc4)
Triticum aestivum subsp. compactum (Host) (Com1)
Triticum aestivum subsp. macha (M6, M9)
Triticum vavilovii (Arm) (Vav1)
Open in a new tab

3. Discussion

It is widely believed that the birthplace of T. aestivum is in a region between Transcaucasia and southwestern Caspian Iran [19]. The first step in the evolution of cultivated wheat was the formation in northern Mesopotamia of a tetraploid species with an AuAuBB genome [20]. Approximately 7000 years ago, the hexaploid bread wheat T. aestivum L. (BBAuAuDD) arose in southwestern Caspian Iran and Transcaucasia by allopolyploidization of the cultivated Emmer wheat Triticum dicoccum Schrank with the Caucasian Ae. tauschii [19,21,22,23,24].

It should be noted that Ae. tauschii was found in the western Caucasus as well [25,26]. According to authors “Ae. squarrosa (Ae. tauschii) grows in lowlands and mountain foothills, rarely in dry and humid silty areas up to the middle of the mountain, mainly in desert, semi-desert and field vegetation, as well as weeds in Abkhazia, Samegrelo, Imereti, Guria, Adjara, Kartli, in outer Kakheti, Gardabani” [25]. It can be assumed that two Ae. tauschii (A) and (B) participated in the formation of hexaploids through the D genome: Ae. tauschii (A)—macha (1–5, 7, 8, 10–12)—and Ae. tauschii (B)—macha M6, M9, CS, RD (Table 3 and Table 7).

T. aestivum subsp. catrhlicoides most likely originated in western Transcaucasia [3]; In 1967 Kuckuck had found populations with carthlicium and carthlicoides types near the border of East Turkey (Ardahan and Kars Provinces, Turkey) and West Georgia. This hexaploid wheat accession showed the subsp. carthlicum-like morphology. Subsp. carthlicum was proposed to have originated from spontaneous hybridization between subsp. carthlicoides and cultivated emmer wheat, T. turgidum subsp. dicoccon (Schrank) Thell. Subsp. carthlicoides should be considered as the original and elder genotype from which genes for this particular morphology of the ear were transferred together with the Q-factor to T. carthlicum [3,18]. According to Kuckuck, this region was distinguished by a tremendous genetic variation in wheat including T. dicoccum, T. carthlicum and T. aestivum subsp. macha [3]. It can be assumed that subsp. carthlicoides took part in the formation of the subsp. macha as an ancestor.

One of the four subspecies of wheat detected in Georgia is hexaploid, domesticated, hulled wheat T. aestivum subsp. macha [15]. This subspecies was detected in West Georgia in 1928 and described by Dekaprelevich and Menabde [27]. It is endemic to Georgia and is cultivated along with tetraploid West Georgian wheat (T. turgidum subsp. palaeocolchicum) [28].

It is proposed that macha and West Georgian wheats are sibling cultivars that arose in a hybrid swarm involving T. aestivum and wild emmer wheat [29]. It is accepted that spelt wheat is derived from free-threshing hexaploid wheat (T. aestivum subsp. aestivum) by hybridization with hulled emmer (T. turgidum). Experimental data suggest that European and Asian spelt may be polyphyletic. Free-threshing, hexaploid wheat seems to precede spelt. At least some European spelt originated from hybridization of club wheat (T. aestivum subsp. compactum) with emmer (domesticated hulled Triticum turgidum). Free-threshing hexaploid wheat was an ancestor of not only European spelt but also of some of the Asian forms of spelt, although the exact role free-threshing wheat has played is debatable [1].

The comparative analysis of complete nucleotide sequence 20 samples of hexaploid wheats offers the opportunity to draw several conclusions: 20 hexaploid wheat samples are divided into two groups—Triticum aestivum subsp. spelta three samples + T. aestivum subsp. vavilovii (Vav1) (collected in Armenia), and the remaining 16 samples including T. aestivum subsp. vavilovii (Vav2) (Collected in Sweden).

Hirosawa et al. [30] found two cpDNA SSR lineages in T. aestivum: Plastogroup I and II. Most subsp. aestivum, compactum, macha, and sphaerococcum accessions belonged to Plastogroup I. Subspecies spelta was split into Plastogroup I (70% of accessions examined) and Plastogroup II (30%). So, given the numbers of subsp. spelta accessions used (27 accessions in Hirosawa et al. and 3 in our work), the cpDNA trees (Hirosawa et al.’s and ours) appear quite consistent. Plastogroup I (and our major lineage) might represent a major lineage that was transmitted from cultivated T. turgidum via hybrid cross with Ae. tauschii and its subsequent allopolyploidization. Plastogroup II (and our minor lineage) might have resulted from introgression between hexaploid and tetraploid wheats, because subsp. spelta has the emmer wheat ancestry in Europe and Asia [1].

PCR-based haplotype analysis of the fourth intron of Wknox1d and the fifth-to-sixth-exon region of Wknox1b of all 20 hexaploid wheat samples was carried out. PCR-based haplotype analysis of the fourth intron of Wknox1d and the fifth-to-sixth-exon region of Wknox1b provides an opportunity to make an assumption that hexaploid wheats T. aestivum subsp. macha var. palaeocolchicum and var. letshckumicum differ from other macha samples by the absence of a 42 bp insertion in the fourth intron of Wknox1d. It can be assumed that two Ae. tauschii (A) and (B) participated in the formation of hexaploids through the D genome: Ae. tauschii (A)—macha (1–5, 7,8,10–12)—and Ae. tauschii (B)—macha M6, M9, T. aestivum subsp. aestivum cv. ‘Chinese Spring’ and cv. ‘Red Doly’. Another possible explanation would be that the insertion might have arisen during the diversification process of common wheat after polyploidization.

In recent years, wheat yields have not increased per hectare, which is important due to the growing world population. Transferring agronomically important genes from wild relatives to common wheat has been shown to be an effective genetic resource for hexaploid wheat improvement. Advances in new technologies have made the complete wheat reference genome available, which offers a promising future for the study of wheat improvement which is essential to meet global food demand [31].

4. Materials and Methods

4.1. Plant Material, DNA Isolation, PCR Analysis, Genomic DNA Library Preparation and Sequencing on an Illumina NovaSeq 6000 Platform

The seeds of hexaploid wheat samples were received from the seed bank of The Agricultural University of Georgia (the late Prof. P. Naskidashvili) and Institute of Botany (Ilia State University, Tbilisi, Georgia) (ISU); The U.S. National Plant Germplasm System (GRINGlobal); The National BioResource Project—WHEAT Centre (Graduate School of Agriculture, Kyoto University, Kyoto, Japan); The Scientific Research Center of Agriculture (SRCA) (Georgia) and Tel Aviv University (Israel). The seeds were germinated in water at room temperature. Total genomic DNA extraction from young leaves, the construction of genomic DNA libraries and assembly of cpDNA have been described earlier [15,31]. An automatic annotation of cpDNA was performed by CpGAVAS [32]. For detection of SNPs (single nucleotide polymorphism) and Indels (insertion/deletion) and phylogeny tree construction, computer programs Mafft and Blast were used [33,34].

4.2. Construction of Shotgun Genomic DNA Libraries

Construction of 13 shotgun genomic libraries and sequencing on the NovaSeq 6000 was carried out at the Roy J. Carver Biotechnology Center, University of Illinois at Urbana-Champaign (UIUC). The shotgun genomic DNA libraries were constructed from 50 ng of DNA after sonication with a Covaris ME220 (Covaris, MA, USA) to an average fragment size of 400 bp with the Hyper Library Preparation Kit from Kapa Biosystems (Roche, CA, USA). To prevent index switching, the libraries were constructed using unique dual-indexed adaptors from Illumina (San Diego, CA, USA). The individually barcoded libraries were amplified with 6 cycles of PCR and run on a Fragment Analyzer (Agilent, CA, USA) to confirm the absence of free primers and primer dimers and to confirm the presence of DNA of the expected size range. Libraries were pooled in equimolar concentration and the pool was further quantitated by qPCR on a BioRad CFX Connect Real-Time System (Bio-Rad Laboratories, Inc., Hercules, CA, USA).

4.3. Sequencing of Libraries in the NovaSeq

The pooled, barcoded, shotgun libraries were loaded on a NovaSeq SP lane for cluster formation and were sequenced for 150 cycles from each side of the DNA fragments. The fastq read files were generated and demultiplexed with the bcl2fastq v2.20 Conversion Software (Illumina, San Diego, CA, USA).

4.4. PCR Analysis of Three Homoeologous Wheat Wknox1 Gene

The genomic sequences of the Wknox1d 4th intron regions were amplified by PCR using the primer pair of Takumi a. Morimoto [18]: 5′-AAAAAAAAGGTTAAATGGAC-3′ and 5′-ACCTTATACATGATTGGGAA-3′. The Wknox1b 5th-to-6th exon region was amplified by PCR using the primer pair 5′-GCTGAAGCACCATCTCCTGA-3′ and 5′-CATGTAGAAGGCGGCGTTAG-3′. The DNA fragments (PCR products) were excised from the agarose gel. The DNA extraction and purification from the agarose gel was performed by the QIAquick Gel Extraction Kit (QIAGEN). PCR products were purified with GenElute PCR Clean-Up Kit (Sigma-Aldrich), dye labeled using a Big Dye Terminator Kit (Applied Biosystems), and sequenced on Applied Biosystems 3700 genetic analyzer (Laboratory Services Division of the University of Guelph, Guelph, ON, Canada).

5. Conclusions

Based on complete chloroplast DNA sequences, the 20 hexaploid wheat samples can be divided into two groups—T. aestivum subsp. spelta three samples + T. aestivum subsp. vavilovii collected in Armenia, and the remaining 16 samples, including T. aestivum subsp. vavilovii collected in Europe (Sweden).

Based on the fourth intron of Wknox1d and the fifth-to-sixth-exon region of Wknox1b hexaploid wheats, T. aestivum subsp. macha var. palaeocolchicum and var. letshckumicum were found to differ from other macha samples by the absence of a 42 bp insertion in the fourth intron of Wknox1d.

Two Aegilops tauschii Coss. (A) and (B) participated in the formation of hexaploids through the D genome: Ae. tauschii (A)—macha (1–5, 7, 8, 10–12)—and Ae. tauschii (B)—macha M6, M9, T. aestivum subsp. aestivum cv. ‘Chinese Spring’ and cv. ‘Red Doly’.

Author Contributions

Conceptualization, T.B. and Y.M.; Methodology, M.G.; Software, M.G.; Formal analysis, M.G. and T.B.; Investigation, T.B. and Y.M.; Data curation, M.G., T.B. and Y.M.; Writing—original draft preparation, T.B. and M.G.; Writing—review and editing, T.B. and Y.M.; Visualization, M.G. and T.B.; Supervision, T.B.; Project administration, M.G.; Funding acquisition, M.G. All authors have read and agreed to the published version of the manuscript.

Funding

This project was funded by a grant from the Shota Rustaveli National Science Foundation of Georgia (SRNSFG) (grant number: NFR-18-7262).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The complete chloroplast DNA sequence data supporting this study are openly available in GenBank at https://www.ncbi.nlm.nih.gov/nuccore/LC625352,LC625353,LC625866,LC621349,LC625865,LC377169,LC622404,LC623765,LC621350,LC623764,LC621194,LC622405,LC623766 (accessed on 8 April 2021).

Conflicts of Interest

The authors declare no conflict of interest.

Footnotes

Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

  • 1.Dvorak J., Deal K.R., Luo M.-C., You F.M., Von Borstel K., Denghani H. The Origin of Spelt and Free-Threshing Hexaploid Wheat. J. Hered. 2012;103:426–441. doi: 10.1093/jhered/esr152. [DOI] [PubMed] [Google Scholar]
  • 2.Yen C., Yang J. Biosystematics of Triticeae: Volume I. Triticum-Aegilops Complex. Springer Nature; Basingstoke, UK: 2020. [(accessed on 5 November 2021)]. Available online: https://link.springer.com/book/10.1007/978-981-13-9931-2. [Google Scholar]
  • 3.Kuckuck H. On the origin of Triticum carthlicum Nevski (Triticum persicum Vav.) Wheat Inf. Serv. 1979;50:1–5. [Google Scholar]
  • 4.Dekaprelevich L.L. The role of Georgia in the origin of wheat. Soobsch. Akad. Nauk Gruz. SSR. 1941;2:915–922. [Google Scholar]
  • 5.Menabde V.L. Wheats of Georgia. Edition of Academy of Science of Georgian SSR. Georgian Academy of Sciences Press; Tbilisi, Georgia: 1948. 272p. (In Russian) [Google Scholar]
  • 6.Menabde V.L. Cultivated flora of Georgia. In: Sakhokia M.F., editor. Botanical Excursions over Georgia. Publishing House of the Academy of Sciences of Georgian SSR; Tbilisi, Georgia: 1961. pp. 69–76. (In Russian) [Google Scholar]
  • 7.Hammer K., Filatenko A.A., Pistrick K. Taxonomic remarks on Triticum L. and ×Triticosecale Wittm. Genet. Resour. Crop Evol. 2011;58:3–10. doi: 10.1007/s10722-010-9590-4. [DOI] [Google Scholar]
  • 8.Gogniashvili M., Naskidashvili P., Bedoshvili D., Kotorashvili A., Kotaria N., Beridze T. Complete chloroplast DNA sequences of Zanduri wheat (Triticum spp.) Genet. Resour. Crop Evol. 2015;62:1269–1277. doi: 10.1007/s10722-015-0230-x. [DOI] [Google Scholar]
  • 9.Beridze T. The ‘Wheat Puzzle’ and Kartvelians route to the Caucasus. Genet. Resour. Crop Evol. 2019;66:921–927. doi: 10.1007/s10722-019-00759-9. [DOI] [Google Scholar]
  • 10.Pagel M., Atkinson Q.D., Calude A.S., Meade A. Ultraconserved words point to deep language ancestry across Eurasia. Proc. Natl. Acad. Sci. USA. 2013;110:8471–8476. doi: 10.1073/pnas.1218726110. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Schaal B.A., Olsen K.M. Gene genealogies and population variation in plants. Proc. Natl. Acad. Sci. USA. 2000;97:7024–7029. doi: 10.1073/pnas.97.13.7024. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Yamane K., Kawahara T. Intra- and interspecific phylogenetic relationships among diploid Triticum-Aegilops species (Poaceae) based on base-pair substitutions, indels, and microsatellites in chloroplast noncoding sequences. Am. J. Bot. 2005;92:1887–1898. doi: 10.3732/ajb.92.11.1887. [DOI] [PubMed] [Google Scholar]
  • 13.Matsuoka Y., Mori N., Kawahara T. Genealogical use of chloroplast DNA variation for intraspecific studies of Aegilops tauschii Coss. Theor. Appl. Genet. 2005;111:265–271. doi: 10.1007/s00122-005-2020-x. [DOI] [PubMed] [Google Scholar]
  • 14.Tabidze V., Baramidze G., Pipia I., Gogniashvili M., Ujmajuridze L., Beridze T., Hernandez A.G., Schaal B. The complete chloroplast DNA sequence of eleven grape cultivars. Simultaneous resequencing methodology. J. Int. Sci. Vigne Vin. 2014;48:99–109. doi: 10.20870/oeno-one.2014.48.2.1568. [DOI] [Google Scholar]
  • 15.Gogniashvili M., Maisaia I., Kotorashvili A., Kotaria N., Beridze T. Complete chloroplast DNA sequences of Georgian indigenous polyploid wheats and B plasmon evolution. Genet. Resour. Crop Evol. 2018;65:1995–2002. doi: 10.1007/s10722-018-0671-0. [DOI] [Google Scholar]
  • 16.Gogniashvili M., Jinjikhadze T., Maisaia I., Akhalkatsi M., Kotorashvili A., Kotaria N., Beridze T., Dudnikov A.Y. Complete chloroplast genomes of Aegilops tauschii Coss. and Ae.cylindrica Host sheds light on plasmon D evolution. Curr. Genet. 2016;62:791–798. doi: 10.1007/s00294-016-0583-5. [DOI] [PubMed] [Google Scholar]
  • 17.Morimoto R., Kosugi T., Nakamura C., Takumi S. Intragenic diversity and functional conservation of the three homoeologous loci of the KN1-type homeobox gene Wknox1 in common wheat. Plant Mol. Biol. 2005;57:907–924. doi: 10.1007/s11103-005-3247-2. [DOI] [PubMed] [Google Scholar]
  • 18.Takumi S., Morimoto R. Implications of an inverted duplication in the wheat KN1-type homeobox gene Wknox1 for the origin of Persian wheat. Genes Genet. Syst. 2015;90:115–120. doi: 10.1266/ggs.90.115. [DOI] [PubMed] [Google Scholar]
  • 19.Dvorak J., Luo M.C., Yang Z.L., Zhang H.B. The structure of the Aegilops tauschii genepool and the evolution of hexaploid wheat. Theor. Appl. Genet. 1998;97:657–670. doi: 10.1007/s001220050942. [DOI] [Google Scholar]
  • 20.Schneider A., Molnar I., Molnar-Lang M. Utilisation of Aegilops (goatgrass) species to widen the genetic diversity of cultivated wheat. Euphytica. 2008;163:1–19. doi: 10.1007/s10681-007-9624-y. [DOI] [Google Scholar]
  • 21.Dubcovsky J., Dvorak J. Genome plasticity a key factor in the success of polyploidy wheat under domestication. Science. 2007;316:1862–1866. doi: 10.1126/science.1143986. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Wang J., Luo M.-C., Chen Z., You F.M., Wei Y., Zheng Y., Dvorak J. Aegilops tauschii single nucleotide polymorphisms shed light on the origins of wheat D-genome genetic diversity and pinpoint the geographic origin of hexaploid wheat. New Phytol. 2013;198:925–937. doi: 10.1111/nph.12164. [DOI] [PubMed] [Google Scholar]
  • 23.Jorgensen C., Luo M.-C., Ramasamy R., Dawson M., Gill B.S., Korol A.B., Distelfeld A., Dvorak J. A high-density genetic map of wild emmer wheat from the Karaca Dağ region provides new evidence on the structure and evolution of wheat chromosomes. Front. Plant Sci. 2017;8:1798. doi: 10.3389/fpls.2017.01798. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Allaby R.G., Stevens C., Lucas L., Maeda O., Fuller D.Q. Geographic mosaics and changing rates of cereal domestication. Philos. Trans. R. Soc. B. 2017;372:20160429. doi: 10.1098/rstb.2016.0429. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Ketskhoveli N. Plant guide book of Georgia. Metsniereba Edition. Volume 2. Metsniereba; Tbilisi, Georgia: 1969. p. 481. [Google Scholar]
  • 26.Kolakovskii A. Flora of Abkhazia. Metsniereba Edition. Metsniereba; Tbilisi, Georgia: 1986. p. 164. [Google Scholar]
  • 27.Dekaprelevich L.L., Menabde V.L. Spelt wheats of Western Georgia (Western Transcaucasia) Bull. Appl. Bot. Leningrad. 1932;1:3–46. [Google Scholar]
  • 28.Dorofeev V.F., Filatenko A.A., Migushova E.F., Udaczin R.A., Jakubziner M.M. Wheat. In: Dorofeev V.F., Korovina O.N., editors. Flora of Cultivated Plants. Volume 1. Leningrad; St. Petersburg, Russia: 1979. p. 346. (In Russian) [Google Scholar]
  • 29.Tsunewaki K. Origin and phylogenetic differentiation of common wheat revealed by comparative gene analysis. In: Finlay K.W., Shepherd K.W., editors. Third International Wheat Genetics. Australian Academy of Science; Canberra, Australia: 1968. pp. 71–85. [Google Scholar]
  • 30.Hirosawa S., Takumi S., Ishii T., Kawahara T., Nakamura C., Mori N. Chloroplast and nuclear DNA variation in common wheat: Insight into the origin and evolution of common wheat. Genes Genet. Syst. 2004;79:271–282. doi: 10.1266/ggs.79.271. [DOI] [PubMed] [Google Scholar]
  • 31.Li A., Liu D., Yang W., Kishii M., Mao L. Synthetic Hexaploid Wheat: Yesterday, Today, and Tomorrow. Engineering. 2018;4:552–558. doi: 10.1016/j.eng.2018.07.001. [DOI] [Google Scholar]
  • 32.Liu C., Shi Y., Zhu Y., Chen H., Zhang J., Lin X., Guan X. CpGAVAS, an integrated web server for the annotation, visualization, analysis, and GenBank submission of completely sequenced chloroplast genome sequences. BMC Genom. 2012;13:715. doi: 10.1186/1471-2164-13-715. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Katoh K., Rozewicki J., Yamada K.D. MAFFT online service: Multiple sequence alignment, interactive sequence choice and visualization. Brief Bioinform. 2019;20:1160–1166. doi: 10.1093/bib/bbx108. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Altschul S.F., Gish W., Miller W., Myers E.W., Lipman D.J. Basic local alignment search tool. J. Mol. Biol. 1990;215:403–410. doi: 10.1016/S0022-2836(05)80360-2. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The complete chloroplast DNA sequence data supporting this study are openly available in GenBank at https://www.ncbi.nlm.nih.gov/nuccore/LC625352,LC625353,LC625866,LC621349,LC625865,LC377169,LC622404,LC623765,LC621350,LC623764,LC621194,LC622405,LC623766 (accessed on 8 April 2021).

Articles from International Journal of Molecular Sciences are provided here courtesy of Multidisciplinary Digital Publishing Institute (MDPI)

RESOURCES