Skip to main content
NCBI home page
Journal of Assisted Reproduction and Genetics logoLink to Journal of Assisted Reproduction and Genetics
. 2021 Nov 24;38(12):3113–3124. doi: 10.1007/s10815-021-02357-0

The integrity of cfDNA in follicular fluid and spent medium from embryo culture is associated with embryo grade in patients undergoing in vitro fertilization

Min Pan 1, Huajuan Shi 2, Zhiyu Liu 2, Juan Dong 3, Lingbo Cai 3,✉, Qinyu Ge 2,✉
PMCID: PMC8666408  PMID: 34820723

Abstract

Purpose

This study was conducted to verify if the cfDNA integrity (cfDI) in follicular fluid and subsequent spent embryo medium (SEM) could serve as potential non-invasive biomarker for high-grade embryo selection during IVF/ICSI.

Methods

Thirty-two follicular fluids, 32 subsequent corresponding cleavage embryo SEM, and 23 subsequent blastocyst SEM were collected from 11 patients undergoing IVF/ICSI. CfDI was measured by ALU gene amplicons with different sizes by qPCR, as the ratio of long to short fragments.

Results

CfDI in follicular fluid corresponding to subsequent high-grade cleavage embryos and blastocysts was significantly lower than that related to low-grade embryos (p = 0.018). Conversely, cfDI in SEM was significantly and positively correlated with high-grade embryos at both stages (p = 0.009). ROC curves of the analysis of cfDI in follicular fluid showed great potential in predicting subsequent embryogenesis and embryo grade (AUC > 0.927). Regardless of the cleavage embryo grade by morphology, cfDI in day 3 SEM could predict if the cleavage embryo could develop to a high-grade blastocyst (AUC = 0.820). A concordant shift pattern of cfDI from follicular fluid to subsequent day 3 SEM and day 5 SEM was found in 81.82% participants featured by various clinical characteristics.

Conclusion

CfDI in follicular fluid and SEM was significantly correlated with embryogenesis and embryo grade and could serve as a potential non-invasive biomarker in high-grade embryo selection. Direct qPCR was proved as a labor-saving and sensitive method for the analysis of cfDI in low volume of SEM.

Supplementary Information

The online version contains supplementary material available at 10.1007/s10815-021-02357-0.

Keywords: Cell-free DNA, Integrity, Spent embryo medium, Embryo grade, Follicular fluid

Introduction

The rate of infertility increases to 12.5–15% lately in China, attributed to environmental pollution, stresses, and delayed childbearing. As an effective assistant productive technology, in vitro fertilization (IVF) has been widely applied clinically to achieve pregnancy. Criteria for top quality embryo selection are the key process during IVF. Selecting the embryos with the best quality, and implantation potential mainly relies on subjective observation of morphological criteria [1, 2]. Transferring euploid blastocysts based on preimplantation genetic testing (PGT) significantly improves implantation rates. However, blastocyst formation rate is quite low for women over 40 years old and patients with severely diminished ovarian reserve [3]. New methods based on time-lapse imaging and embryo culture metabonomics have been intensively investigated; however, the evidence of improving the clinical pregnancy rate and live birth rate remains unclear [4, 5]. As an invasive PGT of external trophoblastic cells in blastocyst, false positive and false negative results due to mosaic might happen, and the risk of implantation and developmental potential is still inconclusive. Therefore, the accuracy and safety of PGT remains controversial [1, 6–8]. Circulating free DNA (cfDNA) has presented as a potential biomarker in IVF [9]. The application of cfDNA in blastocoelic fluid in screening aneuploid embryos provides less invasive approach, but research findings vary considerably in the consistency with PGT results [10–12]. As a non-invasive approach, the identification of novel and accurate biomarkers in the microenvironment of the oocyte and embryo has brought hope for improving the accuracy of embryo selection and the rate of implantation and live birth (Fig. 1A) [2, 13–15]. However, the results of cfDNA in microenvironment and embryo biopsy vary enormously [16]. Therefore, an accurate non-invasive biomarker reflecting the embryo quality is urgently needed [17].

Fig. 1.

Fig. 1.

Open in a new tab

A Non-invasive PGT for abnormal embryos based on fragmentation pattern of cfDNA in SEM. The modules in red dashed box show the strategy of non-invasive screening of embryos based on cfDNA fragment integrity analysis. B Size and fragmentation patterns of maternal and fetus-derived cfDNA in maternal plasma. Maternal cfDNA includes fragments wrapping the nucleosome core unit and linker DNA, which is cut at linker DNA region, and fetal cfDNA only includes fragments wrapping the nucleosome core unit.

CfDNA in plasma of pregnant women was firstly reported by Lo et al. in 1997 [18]. Maternal cfDNA is found to be longer than fetus-derived cfDNA [19]. Maternal cfDNA includes fragments wrapping the nucleosome core unit and linker DNA, which is cut at linker DNA region, while fetal cfDNA only includes fragments wrapping the nucleosome core unit [20–22] (Fig. 1B). Such size discrepancy results in characteristic cfDNA fragment integrity and lays the foundation for the development of molecular diagnostic technology [23–25]. Recent research reported a decreased cfDNA integrity in plasma from pregnant women with triploid fetus, which provides evidence for non-invasive screening of aneuploidy pregnancies [26]. Follicular fluid has similar origination and components with serum. CfDNA level in human follicular fluid and spent embryo medium (SEM) is detectable and shows significant association with embryo quality [15, 27–30]. In recent research, Sialakouma et al. reported the usefulness of cfDNA in blastocyst culture medium in PGT-A [31]. Franco et al. demonstrated cfDNA in blastocyst medium could be used in the selection of blastocysts with higher implantation potential [32]. Moreover, lower cfDNA integrity in follicular fluid and SEM was found in high-grade embryos both at cleavage and blastocyst stages [15, 27]. A high median percentage of maternal cfDNA of over 90% could lead to discordant results in chromosomal diagnosis [33], and accurate biomarker is still not validated due to limited sample size. In addition, sequencing remains a costly approach. Consequently, deciphering the size features of embryonic and maternal cfDNA in SEM is necessary before the application of cfDNA in high-grade embryo selection and non-invasive PGT (Fig. 1A). However, multiple fundamental biological characteristics such as the fragmentation pattern of cfDNA in follicular fluid and SEM and the correlation between cfDNA integrity and embryo quality remain largely unknown. In addition, there is evidence of neither the cfDNA fragmentation pattern during early embryo development nor if there is any association between such pattern and clinical conditions.

In the present study, we aimed at revealing whether cfDNA integrity (cfDI) in follicular fluid and SEM could be potential innovative prognostic biomarkers for embryo quality. We explored the potential of cfDI in follicular fluid and SEM in predicting subsequent embryo quality and embryogenesis. Furthermore, for the first time, we investigated the fragmentation pattern of cfDNA during early embryo development, by tracking cfDI from in follicular fluid, to the subsequent corresponding cleavage embryo SEM, to subsequent blastocyst SEM, respectively. These results suggested that cfDI is a promising non-invasive biomarker to predict and evaluate embryo grade in IVF procedures. In addition, the characteristic shift pattern of cfDI during early in vitro embryo development indicated a featured fragmentation mechanism.

Materials and methods

Patients’ clinical characteristics

This study collected samples from 11 patients undergoing IVF (n = 9) or ICSI (n = 2) cycles at the Clinical Center of Reproductive Medicine in the First Affiliated Hospital, Nanjing, China. This study was approved by the Ethics Committee of the Ethics Committee of the First Affiliated Hospital of Nanjing Medical University (2021-SRFA-390). The clinical characteristics of the participants in the study are reported in Table 1. The patients’ ages ranged from 26 to 38 (mean ± SD, 31 ± 3.70 years), and their body mass index (BMI) ranged from 18 to 27.4 kg/m2 (mean ± SD, 24 ± 3.15 kg/m2). The ovarian reserve (based on the anti-Müllerian hormone level and antral follicle count) was normal in 81.8% of patients, except for two patients with ovarian insufficiency. The AMH was between 1.8 and 13.75 (mean ± SD, 3.18 ± 3.68). The baseline hormonal profile was evaluated on day 3 of the menstrual cycle, including FSH, LH, and 17β estradiol (E2).

Table 1.

Patients’ characteristics of the study population (n = 11)

Variable Mean n (%) Min-max SD
Age (years) 31.55 - 26–38 3.70
< 36 years - 9 (81.82) - -
≥ 36 years - 2 (18.18) - -
Infertility causes
Pelvic oviduct reasons - 3 (27.27) - -
Ovarian functions - 3 (27.27) - -
Myoma of uterus - 2 (18.18) - -
RSA* - 1 (9.09) - -
Unexplained infertility - 4 (36.36) - -
IVF - 9 (81.82) - -
ICSI - 2 (18.18) - -
BMI (kg/m2) 24 - 18–27.4 3.15
FSH (pmol/L) 7.65 - 2.23–10.43 2.44
LH (pmol/L) 3.77 - 1.26–7.82 2.16
17β estradiol (E2; pmol/L) 114.3 - 23–297.27 69.53
AMH* (ng/ml) 3.18 - 1.8–13.75 3.68
Antral follicle count 15 - 4–22 5.99
Normal ovarian reserve (%) - 9 (81.82) - -
Ovarian insufficiency (%) - 2 (18.18) - -
Peak E2 level* (pmol/L) 13013.1 - 4237.8–18392.7 5468.2
Open in a new tab

*RSA, recurrent spontaneous abortion

AMH, anti-Müllerian hormone

Peak E2 level, E2 level measured at the time of the injection of hCG

In vitro fertilization

A total of thirty-two follicular fluid samples were collected from individual follicle from11 patients on oocyte collection day (mean of 2.4 ± 1.1 follicular fluid samples from each patient). The ovarian response was monitored by measuring transvaginal ultrasound evaluation of follicular growth and serum 17β-estradiol (E2) concentration. Injection of human chorionic gonadotrophin (hCG) was administered to trigger ovulation, once there were at least three follicles reaching a diameter of 18 mm or more. Follicles with diameter larger than 10 mm were aspirated by ultrasound-guided aspiration 36 h after the injection individually. Follicles greater than 18 mm in diameter were dominant follicles, while those of 10–18 mm were small follicles. To minimize maternal contamination, careful denudation of surrounding cumulus cells was conducted before microinjection in ICSI cycles or at the moment when we checked fertilization in IVF cycles. Embryos were cultured according to the standard conditions of IVF laboratory using the 2-step culture systems employing culture media from COOK medial (USA). Embryo culture was conducted in a controlled atmosphere containing 6% CO2 and 5% O2 incubator (ASTEC, Astec, Minamizato, Japan). After ICSI and IVF, embryos were washed and moved to an individual 10 μl cleavage medium drop individually. Three days after oocyte retrieval, embryos were graded from I to IV, according to the following morphological criteria: (i) number of blastomeres, (ii) fragmentation rate, and (iii) blastomere regularity (Table 2). An embryo was scored as high-grade (grade I and II) if 7–10 blastomeres of even size with fragmentation rate were lower than 15% and were considered as low-grade (Grade III) if less than 7 or more than 10 blastomeres of uneven size with fragmentation rate were higher than 15% on day 3. Grade IV embryos were featured by less than 6 or more than 8 blastomeres of uneven size with fragmentation rate higher than 20%. Grade I, II, and III embryos were further cultured to day 5 or day 6, while grade IV embryos were discarded for their extremely low developmental potential. Then the embryos were transferred into the blastocyst culture medium. Formed blastocysts on day 5 or day 6 were scored according to the system of Gardner and Schoolcraft [34]. Blastocysts graded as 4AA, 4AB, 5BB, and 4BB were considered as high-grade blastocysts (n = 8) and those 4BC, 4CB, and 4CC as low-grade blastocysts (n = 9), and 6 cleavage embryos failed to form blastocysts in this study.

Table 2.

Embryo quality grade at day 3 (n = 32). Embryos were graded from I to IV (I and II, high-grade embryos; III, low-grade embryos; IV, nonimplantable embryos) based on the following morphological criteria: (i) number of blastomeres, (ii) fragmentation rate, and (iii) blastomere regularity

Morphology criteria Grade Grade Grade Grade
I II III IV
Number of blastomeres 8–10 7–10 ≤ 6 or > 10 < 6 or > 8
Fragmentation rate (%) < 10 10–15 > 15; < 20 ≥ 20
Blastomere regularity Regular Regular Irregular Irregular
Number 7 11 8 6
Open in a new tab

Follicular fluid collection and cfDNA isolation

Only clear follicular fluid samples were included; bloodstained and cloudy follicular fluid samples were excluded to avoid contamination. Follicular fluids were centrifuged at 3000×g for 10 min to eliminate cell debris and then stored immediately at −80 °C until further experiment. CfDNA was extracted from 200 μL follicular fluid using a Serum/Plasma Circulating DNA Kit (TIANGEN) and was then dissolved into 100 μL distilled deionized water. CfDNA was stored at −80°C until further experiment.

Spent embryo culture medium collection

The SEM samples for high and low-grade embryos were moved to PCR tubes on day 3. Embryos at cleavage stage that were not transferred for the cycle were cultivated to culture blastocysts. The culture medium samples were collected in PCR tubes when the embryos reached a fully expanded blastocyst stage, generally between day 5 and day 6. Ten μL SEM were collected from each embryo on day 3 and day 5/6. The diameter of pipettes used was smaller than 50 μm to minimize oil contamination. The SEM samples were stored at −80 °C until further experiment.

Quantification of follicular fluid cfDNA by qPCR

ALU-qPCR was applied in the measurement of cfDNA in serum [35], which is attributed to the reliable and sensitive quantification of cfDNA and is easy to perform. Therefore, to determine cfDI in follicular fluid, real-time qPCR was used to amplify different-sized amplicons targeting the ALU repeats. CfDNA was quantified for ALU repeats using two primer sets that generates a 115bp amplicon (ALU-short) and a 247bp amplicon (ALU-long), respectively. For each ALU-qPCR, 2μL cfDNA was added to a mixture of 10 μL SYBR Green PCR Master (Applied Biosystems Life Technologies), 0.4 μL ROX Reference Dye II, 1 μL of both forward and reverse primer (10 μM), and 5.6 μL nuclease-free water to create a total reaction volume of 20 μL. QPCR was carried out by Applied Biosystem 7500 Real-time PCR. CfDNA concentrations were calculated based on a standard curve prepared with successive dilutions of genomic DNA. A negative control (with no template) was added in each qPCR plate. All measures were performed in triplicate.

Direct qPCR for SEM

A comparison of the amplification of lysed SEM and non-lysed SEM from the same samples was analyzed. Ten SEM samples were lysed using Single Cell Lysis Kit (Invitrogen). Various direct qPCR conditions were analyzed by amplifying GAPDH using a primer set that generates a 115 bp amplicon in SEM plasma. Different volumes of 0.1 μL, 0.2 μL, 0.5 μL, 1 μL, 2 μL, and 5 μL SEM were carried out to optimize the efficiency of direct qPCR. SEM was added to a mixture of 10 μL 2 × TB Green® Premix Ex Taq™, 0.5 μL of both forward and reverse primers (10 μM), 1.5 μL MgCl2 (25 mM), 0.5 μL EDTA (50 mM), and nuclease-free water to supplement a final reaction volume of 20 μL. CfDNA concentrations were calculated based on a standard curve prepared with successive dilutions of genomic DNA. A negative control (with no template) was added in each qPCR plate. All measures were performed in triplicate.

Quantification of cfDNA in SEM using direct qPCR

CfDNA in 32 cleavage embryo SEM and 23 blastocyst SEM was directly amplified using ALU-long and ALU-short primer sets. CfDNA concentrations were calculated based on a standard curve prepared with successive dilutions of genomic DNA. A negative control (with no template) was added in each direct qPCR plate. All measures were performed in triplicate. The sequences of the primers and the corresponding amplicon sizes used in this study are listed in Table 3.

Table 3.

Primers applied in the study

Genes Primer sequences Amplicon size (bp) Tm (°C)
ALU-short F 5′CCTGAGGTCAGGAGTTCGAG 115 64
R 5′CCCGAGTAGCTGGGATTACA
ALU-long F 5′GTGGCTCACGCCTGTAATC 247 64
R 5′CAGGCTGGAGTGCAGTGG
GAPDH F 5′CCCTTCATTGACCTCAACTACATG 115 62
R 5′TGGGATTTCCATTGATGACAAGC
Open in a new tab

CfDNA integrity

Relative quantification of ΔΔCT was applied in calculating relative concentration of short and long cfDNA fragments [36]. CfDI was calculated as the ratio of QALU-long/QALU-short, and QALU-long corresponds to the cfDNA level obtained using ALU 247bp primers and QALU-short to that with ALU 115bp primers. Thus, cfDI represents the cfDNA fragment integrity in follicular fluid and SEM.

Statistical analysis

Univariate analysis was performed for each variable, and continuous parametric data were presented as mean ± SD. For two-way comparisons, if the Gaussian distribution was satisfied, unpaired t tests with Welch’s correction were performed, else the Mann–Whitney test was used. For ≥ 3-way comparisons, Welch’s ANOVA and post hoc Dunnett’s test were applied. Statistics were performed using GraphPad Prism. Results were considered significant when p ≤ 0.05.

Results

The association between cfDI in follicular fluid and subsequent embryo grade

We measured the cfDNA concentration in follicular fluid from dominant follicles and small follicles and found a relatively higher level in small follicles (0.582 ± 0.293 ng/μl) than in dominant oocytes (0.368 ± 0.187 ng/μl) (mean ± SD). To explore the association between cfDNA integrity in follicular fluid and the subsequent embryo grade, we divided the day 3 embryos into different test groups according to the embryogenesis, fragmentation rate, and embryo grade. We first found a significant and negative correlation between cfDI in follicular fluid and cleavage embryogenesis and the grade of cleavage embryos (Fig. 2). Specifically, the mean cfDI increased from 0.649 ± 0.107 in follicular fluid for oocytes that developed day 3 embryos to 1.392 ± 0.310 (mean ± SD) in those that failed to cleave or fertilize (p = 0.012) (Fig. 2A). CfDI greater than 1 indicated that there is higher proportion of longer than shorter DNA fragments. This result suggested oocytes with poor potential in cleavage embryogenesis release higher proportion of longer DNA to follicular fluid attributed to necrosis. Significant difference was also found between the embryos with low fragmentation rate (≤ 15%) and high fragmentation rate (> 15%) (1.053 ± 0.161 versus 2.183 ± 0.331, respectively, p = 0.005) (Fig. 2B). And there was a mild increase of cfDI in low-grade embryo group compared to high-grade group (1.636 ± 0.222 versus 1.297 ± 0.225, respectively, p > 0.05) (Fig. 2C). These results indicated more necrotic events occurred in follicles which contain oocytes with poor potency to develop top quality cleavage embryos.

Fig. 2.

Fig. 2.

Open in a new tab

The correlation between cfDI in follicular fluid and embryo grade at cleavage stage. A Follicular fluid cfDI correlated with cleavage embryogenesis. *p < 0.05. Formation (n26), no formation (n = 6). B Follicular fluid cfDI correlated with day 3 embryos with fragmentation rate. **p < 0.01. Fragmentation rate ≤ 15% (n = 26), > 15% (n = 6). C Follicular fluid cfDI correlated with day 3 embryo grade. High-grade (n = 18), low-grade (n = 8).

Likewise, cfDI in follicular fluid was significantly and negatively correlated with blastocyst grade (Fig. 3). There was a weak and significant increase from 1.123 ± 0.370 in the follicular fluid for oocytes that formed blastocysts to 2.512 ± 0.357 in those failed to develop blastocysts (p = 0.036) (Fig. 3A). Specifically, a significant and negative correlation was found both between cfDI in follicular fluid containing oocytes that formed high-grade blastocysts and those failed to form blastocysts (1.413 ± 0.125 versus 2.839 ± 0.446, respectively, p = 0.006) and between low-grade blastocyst and no blastocyst formation groups (1.157 ± 0.143 versus 2.839 ± 0.446, respectively, p = 0.0002); no significant change of cfDI was found between high-grade and low-grade blastocysts (p > 0.05) (Fig. 3B). The results showed that the development of blastocysts was delayed from the oocytes that matured in a higher cfDI environment. Therefore, cfDI in the microenvironment of oocytes showed its potential in predicting the potential of embryogenesis at both cleavage and blastocyst stages. But comprehensively, follicular fluid cfDI presented better performance in predicting high-grade day 3 embryos than in high-grade blastocysts.

Fig. 3.

Fig. 3

Open in a new tab

The correlation between cfDI in follicular fluid and blastocyst grade. A Follicular fluid cfDI correlated with the blastocyst embryogenesis. *p < 0.05. Formation (n = 17), no formation (n = 15). B Follicular fluid cfDI correlated with blastocyst grade. **p < 0.01. High-grade blastocysts (n = 8), low-grade blastocysts (n = 9), and those oocytes that failed to develop a blastocyst on day 5/6 (n = 15).

The association between SEM cfDI and embryo grade

There was a surprising inversion of the correlation between cfDI in SEM and embryo quality on both day 3 and day 5/6. We observed an increased cfDI in SEM for cleavage embryos with higher grade, in terms of blastomere number and fragmentation rate. There was a significant increase of cfDI in cleavage embryos with 7–10 blastomeres compared with those with fewer blastomeres (< 7) or more blastomeres (> 10) (2.124 ± 0.156 versus 1.398 ± 0.126, respectively) (p = 0.002) (Fig. 4A), suggesting there was a higher proportion of shorter embryonic cfDNA in top grade embryos. Similarly, the inversion was also found in day 3 embryo grade in terms of fragmentation rate. It increased from 1.265 ± 0.212 in cleavage embryos with fragmentation rate higher than 15% to 2.127 ± 0.231 in those lower than 15% (p = 0.034) (Fig. 4B). Assuming such cfDI inversion could be attributed to increasing shorter embryonic cfDNA contribution, cfDI in blastocyst SEM should present similar inversion pattern. We found a gradual decrease of cfDI in SEM from high-grade blastocysts (2.267 ± 0.339) to low-grade blastocysts (1.818 ± 0.154) and to those failed to develop blastocysts on day 5 and day 5/6 (1.388 ± 0.169), and a significant and positive correlation was found between high-grade group and no blastocysts group (p = 0.031) (Fig. 4C). Moreover, cfDI in day 3 SEM was significantly and positively correlated to blastocyst grade, specifically, 1.810 ± 0.098 in high-grade blastocysts versus 1.327 ± 0.0938 in the other blastocysts (p = 0.009) (Fig. 4D). Thus, cfDI in embryo SEM at both cleavage and blastocyst stages could be potential alternative embryo grading index, apart from the morphological criteria. Moreover, cfDI in day 3 SEM could be a potential biomarker in predicting subsequent high-grade blastocysts.

Fig. 4.

Fig. 4

Open in a new tab

The correlation between cfDI in SEM and embryo grade. A CfDI in SEM for day 3 cleavage embryos with the number of blastomeres of 7–10 (n = 18) and either less than 7 or more than 10 (n = 14). **p < 0.01. B CfDI in SEM for day 3 cleavage embryos with fragmentation rate ≤ 15% (n = 18) or > 15% (n = 14). **p < 0.01. C CfDI in SEM for day 5/6 blastocysts with high-grade (n = 8), low-grade (n = 9), and those failed to form a blastocyst (n = 6) on day 5/6. *p < 0.05. D The correlation between cfDI in day 3 SEM and blastocyst grade at day 5/6. **p < 0.01. High-grade (n = 8), others (n = 24).

CfDI as a biomarker in earlier microenvironment predicting subsequent embryo grade

In order to evaluate the feasibility of cfDI in microenvironment of earlier stages as a predictor for subsequent embryo grade, we analyzed the sensitivity and specificity of cfDI. First, follicular fluid cfDI showed high specificity and sensitivity in differentiating cleavage embryos with multiple grade assessment criteria. Specifically, ROC curve showed a great potential in predicting the cleavage embryogenesis (AUC = 0.984) and blastocyst embryogenesis (AUC = 0.958) and in differentiating day 3 embryos with fragmentation rate either higher or lower than 15% (AUC = 0.927) (Fig. 5A). Consistent with our result that cfDI in follicular fluid was less sensitive in differentiating day 3 embryo grade (Fig. 2C), ROC curve of that in differentiating day 3 embryo grade showed an AUC of only 0.650 (Fig. 5A). In addition, cfDI in day 3 SEM also presented potency in evaluating day 3 embryo grade, independently of the morphological basis. The AUC of ROC curve for the analysis of day 3 embryo blastomere number was 0.781 and 0.809 for the day 3 embryo fragmentation rate. Surprisingly, regardless of day 3 embryo grade by morphology, cfDI in day 3 SEM could serve as a potential biomarker in predicting if the cleavage embryos could develop a high-grade blastocyst (AUC = 0.820) (Fig. 5B). These results suggested cfDI in SEM could not only be an alternative index in evaluating the quality of the current embryos, but also could serve as an innovative biomarker in predicting subsequent embryo quality.

Fig. 5.

Fig. 5

Open in a new tab

Multiparametric ROC analysis using variables of embryo grade and cfDI calculated from ALU targets. A ROC curves showed the analysis of cfDI in follicular fluid in differentiating multiple variables of subsequent cleavage and blastocyst embryo grades. Specifically, navy curve represented follicular fluid cfDI predicting cleavage embryo grade, green curve showed cleavage embryo fragmentation rate, red curve represented cleavage embryogenesis, and purple curve showed blastocyst embryogenesis. Yellow line represented reference line. B ROC curves showed the analysis cfDI in day 3 SEM in differentiating multiple variables of cleavage and subsequent blastocyst grade. Specifically, navy curve represented day 3 SEM cfDI predicting the blastomere number of the cleavage embryos, green curve showed cleavage embryo fragmentation rate, and red curve showed subsequent high-grade blastocyst formation. Purple line represented reference line. AUC values for each analysis were labeled in the corresponding figures.

The cfDI shift pattern during early in vitro embryo development

To reveal the characteristics of cfDI pattern during early development of embryos, from oocytes to blastocysts, we tracked the cfDI pattern from each individual follicular fluid to the subsequent cleavage embryo SEM and to subsequent blastocyst SEM, respectively. There was a concordant shifting pattern of cfDI, in which cfDI reached the peak in cleavage embryo SEM and decreased again in blastocyst SEM (Fig. 6). Such shifting pattern was found in 81.82% patients in this study, except for patients No. 3822 and No. 3825, whose day 3 SEM samples had been frozen for a week before experiment. CfDNA released either from the oocytes or subsequent embryos with different grades were not randomly fragmented, even from patients characterized by various clinical conditions. Further investigation into the cutting ends preferences would provide further evidences of the cfDNA fragmentation mechanisms.

Fig. 6.

Fig. 6

Open in a new tab

The integrity patterns of cfDNA in follicular fluid, day 3 SEM, and day 5/6 SEM from each individual oocyte from 11 patients. Blank bars showed follicular fluid, light gray bars showed day 3 SEM, and dark gray bars showed day 5/6 SEM. The horizontal numbers showed the ID numbers of IVF/ICSI participants. Nine out of 11 participants showed consistent shifting pattern during the three developmental stages, except for participants No. 3822 and No. 3825.

Direct qPCR for SEM

The currently applied volume of culture medium system is 10 μL for both day 3 and day 5/6 embryo culture, which is now an obstacle for the extraction of cfDNA in the samples. To test the effect of low volume of SEM to the efficiency of direct qPCR, different volumes of 0.1 μL, 0.2 μL, 0.5 μL, 1 μL, 2 μL, and 5 μL SEM were tested to optimize the efficiency. CT values indicated there was no effect of the sample volumes between 0.1 and 2 μL on the amplification curve, while 5 μL SEM significantly decreased the amplification efficiency (data not shown). Thus, 2 μL SEM was added in the further direct qPCR amplification assay in this study. The efficiency of direct qPCR was compared in SEM with and without lysis, and no significant difference of cfDI was found (Fig. 7). No significant difference between cfDI in follicular fluid by direct qPCR and cfDNA extracted from the same volume of samples by common qPCR proved direct qPCR has as good amplification efficiency as common qPCR and could serve as a novel approach to measure cfDI in low volume of samples (Fig. 7). Moreover, cfDI were lower in dominant follicles than in small follicles (p = 0.048) (Fig. 7), suggesting shorter cfDNA released by apoptosis is more common in dominant follicles, which was consistent with a previous finding [15].

Fig. 7.

Fig. 7

Open in a new tab

CfDI analyzed by direct qPCR in biological samples with and without lysis. FF were follicular fluid, blank bars were follicular fluid from dominant follicles (n = 24), and blank bars with dots were those from small follicles (n = 8). The contiguous two bars with the same pattern represented cfDI analyzed by direct qPCR (left) and common qPCR (right), respectively. CF_B with purple bars were SEM for blastocysts (n = 6). LCF_B with green bars were lysed SEM for blastocysts (n = 6). CF_C with pink bars were SEM for cleavage embryos (n = 6). LCF_C with orange bars were lysed SEM for cleavage embryos (n = 6).

Storage time affects cfDI

In this study, we analyzed the effect of storage time on the fragmentation of cfDNA in follicular fluid and SEM. Direct qPCR result showed the average cfDI in fresh follicular fluid was significantly higher than that in follicular fluid which had been frozen for a week before experiment (1.937 ± 0.252 versus 0.724 ± 0.065, p < 0.0001), and similar difference was also found in SEM samples (1.688 ± 0.163 versus 0.626 ± 0.064, respectively, p < 0.0001) (Fig. 8). This discrepancy might be attributed to the fragmentation of cfDNA molecules either by time or the irritation of freeze thawing process. Such result indicated storage time of body fluid samples could be a biomarker to calibrate cfDI in future research.

Fig. 8.

Fig. 8

Open in a new tab

CfDI in fresh and frozen follicular fluid and blastocyst SEM. Gray bars were follicular fluid, and blank bars were blastocyst SEM. ***p < 0.0001. Fresh follicular fluid (n = 27), frozen follicular fluid (n = 5), fresh blastocyst SEM (n = 18), and frozen blastocyst SEM (n = 5).

Discussion

This study evaluated the correlation between fragmentation pattern of cfDNA in follicular fluid and SEM and the grade of subsequent corresponding embryos from patients undergoing IVF/ICSI and, for the first time, demonstrated the potential of follicular fluid and SEM cfDI in predicting subsequent embryo grade. Our data showed that cfDI in follicular fluid was significantly and negatively correlated with the grade of both cleavage embryos and blastocysts (p = 0.018), while cfDI in day 3 and day 5/6 SEM was significantly and positively correlated with embryo grade of both stages (p = 0.009). Moreover, the ROC curves of the analysis of cfDI in follicular fluid and day 3 SEM showed great potency in predicting subsequent embryo grade, from multiple factors evaluating embryo grade morphologically (AUC > 0.78). Thus, these findings indicated that cfDI in earlier microenvironment of oocytes or embryos could be used as a potential non-invasive biomarker to predict subsequent embryo quality, as an alternative or supplemental method of the currently applied morphological criteria.

ALU is the most abundant interspersed repeated sequence in human genome. Therefore, the use of repetitive DNA elements that are distributed throughout the genomic DNA ensured the generation of cfDNA with low concentration in both follicular fluid and SEM samples. ALU-qPCR was applied in the analysis of the level of cfDNA in follicular fluid and cfDI in follicular fluid and SEM, where ALU-long primers amplified longer cfDNA fragments and ALU-short primers amplified shorter cfDNA. Thus, the integrity of cfDNA represented the proportion of cfDNA released by necrosis to those released by apoptosis. Higher cfDI in small follicles was consistent with previous report [15], which can be associated with necrotic events in less well-developed oocytes. In our study, the negative correlation between cfDI in follicular fluid and embryo grade was in agreement with previous report that lower cfDI in follicular fluid and SEM was found in higher quality embryo both at cleavage and blastocyst stages [15, 27]. This could be explained by two hypotheses, (i) poor quality cleavage embryos and blastocysts or even no formation of embryos could be associated with necrotic events in follicles, either oocytes or granulosa cells, and (ii) decreased apoptosis of granulose cells that cannot support the normal development or establish the dialog with the oocyte could be the cause of the development of poor quality embryos [37]. However, the positive correlation between cfDI in SEM and embryo grade which indicated increasing proportion of cfDNA released by embryos instead of maternal cells represents robust development of the embryos, while less contribution of embryonic cfDNA might be attributed to poorer or slower early development of the embryos. Moreover, follicular fluid and SEM are by-product during IVF, which facilitates the non-invasive selection.

In order to explore the correlation between cfDI and IVF outcome, we analyzed the cfDI in a SEM for a grade III cleavage embryo from a 37-year-old patient who failed to achieve pregnancy in the IVF-ET cycle and a SEM for a grade I cleavage embryo form a 26-year-old patient who achieved pregnancy in that cycle. Notably, there was a significant lower cfDI of 0.5866 in the former sample, compared to 3.7629 in the latter one. This was in agreement with the result of the correlation between cfDI and subsequent embryo grade (Fig. 4). Though larger number of samples is needed, this discrepancy already showed the possibility of cfDI in predicting IVF outcome. A larger study cohort is needed to investigate the correlation between cfDI in follicular fluid and SEM, and the implantation rate, pregnancy rate, and live birth rate, independently of morphology criteria.

Tracking the development of an individual embryo, from oocyte, to subsequent cleavage embryo, to blastocyst, a common shift pattern of cfDI was found in 81.82% of participants. This result indicated there could be common cfDNA fragmentation mechanisms during early in vitro embryo development. And such common mechanisms are not affected by different maternal clinical characteristics, infertility causes, basal hormone levels, or formation of embryos with different qualities. Further investigation into the cutting end preferences of the cfDNA fragments would provide evidences of the cfDNA fragmentation mechanisms. In addition, we found a significant and positive correlation between cfDI in follicular fluid and baseline FSH measured on day 3 of the IVF cycle (r = 0.9301, p < 0.0001) (Fig. S1A). It can be explained by either increasing necrotic events in oocytes or granulosa cells or decreased apoptosis of granulose cells in cycle with less robust ovarian function during the IVF cycle [38]. The average peak E2 per follicle at the time of hCG trigger also showed a weakly significant and positive correlation with cfDI (r = 0.6274, p = 0.039) (Fig. S1B). This result was inconsistent with a previous finding that reducing E2 might be associated with the role of TNFα in the regulation of steroidogenesis in follicles [39, 40]. It might be attributed to the reason that the calculation of average E2 in serum was not representative for the accurate E2 level in the selected follicles in the study; further study should measure the E2 level in each individual follicular fluid sample. Therefore, baseline FSH measured on day 3 of the cycle could be more informative in predicting embryogenesis and embryo quality in the IVF cycle.

Though SEM showed as potential testing material in non-invasive preimplantation screening, low volume of SEM samples limits the application because of the difficulty in the extraction of cfDNA. Circumventing the extraction step, direct PCR has opened up new opportunities for forensic science. In this study, the feasibility of direct qPCR in analyzing the fragmentation of cfDNA in SEM was evaluated for the first time. Two μL SEM showed the best amplification efficiency. Direct qPCR showed as good performance as common qPCR for extracted cfDNA from the same volume of follicular fluid, which verified the feasibility of direct qPCR in analyzing cfDI in low volume of samples. This preliminary attempt suggested cfDI in low volume of SEM analyzed by quick and labor-saving direct qPCR might be a potential non-invasive top quality embryo selection method. Moreover, strong and significant decrease of cfDI in frozen samples indicated that storage time of samples could be a biomarker to calibrate cfDI.

Conclusion

This is the first study demonstrating the potential of cfDI in follicular fluid and cleavage embryo SEM in predicting subsequent embryogenesis and embryo quality. Moreover, a concordant shift pattern of cfDI during early embryo development indicated a common fragmentation mechanism despite of clinical conditions and embryo grade. In addition, optimized direct qPCR was proved as a labor-saving and sensitive method for the analysis of cfDI in low volume of samples. In conclusion, though biological characteristics of cfDNA in SEM is not fully elucidated, with further improvement, analysis of cfDI by direct qPCR remains a promising method for non-invasive top quality embryo selection in IVF. CfDNA in SEM is not currently optimized for aneuploidy embryo screening, but with future study combining cfDI and the end sequence preference of cfDNA in distinguishing aneuploidy embryos, it remains a promising tool for non-invasive PGT-A.

Supplementary Information

Below is the link to the electronic supplementary material.

Supplementary file1 (DOCX 81.0 kb) (81.1KB, docx)

Acknowledgements

We would like to thank the doctors in the Clinical Center of Reproductive Medicine, State Key Laboratory of Reproductive Medicine in the First Affiliated Hospital involved in the sample and data collection for their support in this study.

Author contribution

Min Pan and Qinyu Ge led the conception and design of the study. Lingbo Cai collected the follicular fluid and SEM samples and clinical data. Min Pan and Huajuan Shi carried out the evaluation of cfDI in samples. Zhiyu Liu carried out the direct qPCR experiments. Min Pan and Qinyu Ge conducted the data analysis, construction of tables and figures, and article revision. Lingbo Cai was involved in study conception and critical revision of the article. All authors approved the final article.

Funding

This study was supported by the National Natural Science Foundation of China (61801108) and the Natural Science Foundation of Jiangsu Province (BK20211166, BK20201148).

Declarations

Ethics approval

Ethics approval was obtained from the Clinical Center of Reproductive Medicine, First Affiliated Hospital, Nanjing in 2020.

Conflict of interest

The authors declare competing interests.

Footnotes

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Contributor Information

Lingbo Cai, Email: lingbo-cai@njmu.edu.cn.

Qinyu Ge, Email: geqinyu@seu.edu.cn.

References

  • 1.Guerif F, Le Gouge A, Giraudeau B, Poindron J, Bidault R, Gasnier O, Royere D. Limited value of morphological assessment at days 1 and 2 to predict blastocyst development potential: a prospective study based on 4042 embryos. Hum Reprod. 2007;22(7):1973–1981. doi: 10.1093/humrep/dem100. [DOI] [PubMed] [Google Scholar]
  • 2.Canick JA, Palomaki GE, Kloza EM, Lambert-Messerlian GM, Haddow JE. The impact of maternal plasma DNA fetal fraction on next generation sequencing tests for common fetal aneuploidies. Prenat Diagn. 2013;33(7):667–674. doi: 10.1002/pd.4126. [DOI] [PubMed] [Google Scholar]
  • 3.Galeva S, Gil MM, Konstantinidou L, Akolekar R, Nicolaides KH. First-trimester screening for trisomies by cfDNA testing of maternal blood in singleton and twin pregnancies: factors affecting test failure. Ultrasound in Obstetrics & Gynecology : the Official Journal of the International Society of Ultrasound in Obstetrics and Gynecology. 2019;53(6):804–809. doi: 10.1002/uog.20290. [DOI] [PubMed] [Google Scholar]
  • 4.Chan KC, Leung SF, Yeung SW, Chan AT, Lo YM. Persistent aberrations in circulating DNA integrity after radiotherapy are associated with poor prognosis in nasopharyngeal carcinoma patients. Clinical Cancer Research : an Official Journal of the American Association for Cancer Research. 2008;14(13):4141–4145. doi: 10.1158/1078-0432.CCR-08-0182. [DOI] [PubMed] [Google Scholar]
  • 5.Vergouw CG, Botros LL, Roos P, Lens JW, Schats R, Hompes PG, Burns DH, Lambalk CB. Metabolomic profiling by near-infrared spectroscopy as a tool to assess embryo viability: a novel, non-invasive method for embryo selection. Hum Reprod. 2008;23(7):1499–1504. doi: 10.1093/humrep/den111. [DOI] [PubMed] [Google Scholar]
  • 6.Paulson RJ. Preimplantation genetic screening: what is the clinical efficiency? Fertil Steril. 2017;108(2):228–230. doi: 10.1016/j.fertnstert.2017.06.023. [DOI] [PubMed] [Google Scholar]
  • 7.Barad DH, Darmon SK, Kushnir VA, Albertini DF, Gleicher N. Impact of preimplantation genetic screening on donor oocyte-recipient cycles in the United States. Am J Obstet Gynecol. 2017;217(5):576 e571–576 e578. doi: 10.1016/j.ajog.2017.07.023. [DOI] [PubMed] [Google Scholar]
  • 8.Kang HJ, Melnick AP, Stewart JD, Xu K, Rosenwaks Z. Preimplantation genetic screening: who benefits? Fertil Steril. 2016;106(3):597–602. doi: 10.1016/j.fertnstert.2016.04.027. [DOI] [PubMed] [Google Scholar]
  • 9.Qasemi M, Mahdian R, Amidi F. Cell-free DNA discoveries in human reproductive medicine: providing a new tool for biomarker and genetic assays in ART. J Assist Reprod Genet. 2021;38(2):277–288. doi: 10.1007/s10815-020-02038-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Magli MC, Albanese C, Crippa A, Tabanelli C, Ferraretti AP, Gianaroli L: Deoxyribonucleic acid detection in blastocoelic fluid: a new predictor of embryo ploidy and viable pregnancy. Fertil Steril 2019, 111(1):77-85. [DOI] [PubMed]
  • 11.Magli MC, Pomante A, Cafueri G, Valerio M, Crippa A, Ferraretti AP, Gianaroli L. Preimplantation genetic testing: polar bodies, blastomeres, trophectoderm cells, or blastocoelic fluid? Fertil Steril. 2016;105(3):676–683. doi: 10.1016/j.fertnstert.2015.11.018. [DOI] [PubMed] [Google Scholar]
  • 12.Tobler KJ, Zhao Y, Ross R, Benner AT, Xu X, Du L, Broman K, Thrift K, Brezina PR, Kearns WG. Blastocoel fluid from differentiated blastocysts harbors embryonic genomic material capable of a whole-genome deoxyribonucleic acid amplification and comprehensive chromosome microarray analysis. Fertil Steril. 2015;104(2):418–425. doi: 10.1016/j.fertnstert.2015.04.028. [DOI] [PubMed] [Google Scholar]
  • 13.Uyar A, Torrealday S, Seli E. Cumulus and granulosa cell markers of oocyte and embryo quality. Fertil Steril. 2013;99(4):979–997. doi: 10.1016/j.fertnstert.2013.01.129. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Pearson H. Safer embryo tests could boost IVF pregnancy rates. Nature. 2006;444(7115):12–13. doi: 10.1038/444012b. [DOI] [PubMed] [Google Scholar]
  • 15.Scalici E, Traver S, Molinari N, Mullet T, Monforte M, Vintejoux E, Hamamah S. Cell-free DNA in human follicular fluid as a biomarker of embryo quality. Hum Reprod. 2014;29(12):2661–2669. doi: 10.1093/humrep/deu238. [DOI] [PubMed] [Google Scholar]
  • 16.Xu J, Fang R, Chen L, Chen D, Xiao JP, Yang W, Wang H, Song X, Ma T, Bo S, et al. Noninvasive chromosome screening of human embryos by genome sequencing of embryo culture medium for in vitro fertilization. Proc Natl Acad Sci U S A. 2016;113(42):11907–11912. doi: 10.1073/pnas.1613294113. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Belandres D, Shamonki M, Arrach N. Current status of spent embryo media research for preimplantation genetic testing. J Assist Reprod Genet. 2019;36(5):819–826. doi: 10.1007/s10815-019-01437-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Lo YM, Corbetta N, Chamberlain PF, Rai V, Sargent IL, Redman CW, Wainscoat JS. Presence of fetal DNA in maternal plasma and serum. Lancet. 1997;350(9076):485–487. doi: 10.1016/S0140-6736(97)02174-0. [DOI] [PubMed] [Google Scholar]
  • 19.Chan KC, Zhang J, Hui AB, Wong N, Lau TK, Leung TN, Lo KW, Huang DW, Lo YM. Size distributions of maternal and fetal DNA in maternal plasma. Clin Chem. 2004;50(1):88–92. doi: 10.1373/clinchem.2003.024893. [DOI] [PubMed] [Google Scholar]
  • 20.Jiang P, Lo YM. The long and short of circulating cell-free DNA and the ins and outs of molecular diagnostics. Trends in Genetics : TIG. 2016;32(6):360–371. doi: 10.1016/j.tig.2016.03.009. [DOI] [PubMed] [Google Scholar]
  • 21.Yu SC, Lee SW, Jiang P, Leung TY, Chan KC, Chiu RW, Lo YM. High-resolution profiling of fetal DNA clearance from maternal plasma by massively parallel sequencing. Clin Chem. 2013;59(8):1228–1237. doi: 10.1373/clinchem.2013.203679. [DOI] [PubMed] [Google Scholar]
  • 22.Fan HC, Blumenfeld YJ, Chitkara U, Hudgins L, Quake SR. Noninvasive diagnosis of fetal aneuploidy by shotgun sequencing DNA from maternal blood. Proc Natl Acad Sci U S A. 2008;105(42):16266–16271. doi: 10.1073/pnas.0808319105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Shi J, Zhang R, Li J. Size profile of cell-free DNA: a beacon guiding the practice and innovation of clinical testing. Theranostics. 2020;10(11):4737–4748. doi: 10.7150/thno.42565. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Yu SC, Chan KC, Zheng YW, Jiang P, Liao GJ, Sun H, Akolekar R, Leung TY, Go AT, van Vugt JM, et al. Size-based molecular diagnostics using plasma DNA for noninvasive prenatal testing. Proc Natl Acad Sci U S A. 2014;111(23):8583–8588. doi: 10.1073/pnas.1406103111. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Pan M, Chen P, Lu J, Liu Z, Jia E, Ge Q. The fragmentation patterns of maternal plasma cell-free DNA and its applications in non-invasive prenatal testing. Prenat Diagn. 2020;40(8):911–917. doi: 10.1002/pd.5680. [DOI] [PubMed] [Google Scholar]
  • 26.Qiao L, Yu B, Liang Y, Zhang C, Wu X, Xue Y, Shen C, He Q, Lu J, Xiang J, et al. Sequencing shorter cfDNA fragments improves the fetal DNA fraction in noninvasive prenatal testing. Am J Obstet Gynecol. 2019;221(4):345 e341–345 e311. doi: 10.1016/j.ajog.2019.05.023. [DOI] [PubMed] [Google Scholar]
  • 27.Konstantinos S, Petroula T, Evangelos M, Polina G, Argyro G, Sokratis G, Anna R, Andrianos N, Agni P, Michael K, et al. Assessing the practice of LuPOR for poor responders: a prospective study evaluating follicular fluid cfDNA levels during natural IVF cycles. J Assist Reprod Genet. 2020;37(5):1183–1194. doi: 10.1007/s10815-020-01743-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Latif Khan H, Bhatti S, Latif Khan Y, Abbas S, Munir Z. Rahman Khan Sherwani IA, Suhail S, Hassan Z, Aydin HH: Cell-free nucleic acids and melatonin levels in human follicular fluid predict embryo quality in patients undergoing in-vitro fertilization treatment. J Gynecol Obstet Hum Reprod. 2020;49(1):101624. doi: 10.1016/j.jogoh.2019.08.007. [DOI] [PubMed] [Google Scholar]
  • 29.Ho JR, Arrach N, Rhodes-Long K, Ahmady A, Ingles S, Chung K, Bendikson KA, Paulson RJ, McGinnis LK. Pushing the limits of detection: investigation of cell-free DNA for aneuploidy screening in embryos. Fertil Steril. 2018;110(3):467–475. doi: 10.1016/j.fertnstert.2018.03.036. [DOI] [PubMed] [Google Scholar]
  • 30.Liu Y, Shen Q, Zhao X, Zou M, Shao S, Li J, Ren X, Zhang L. Cell-free mitochondrial DNA in human follicular fluid: a promising bio-marker of blastocyst developmental potential in women undergoing assisted reproductive technology. Reproductive Biology and Endocrinology : RB&E. 2019;17(1):54. doi: 10.1186/s12958-019-0495-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Sialakouma A, Karakasiliotis I, Ntala V, Nikolettos N, Asimakopoulos B. Embryonic cell-free DNA (cfDNA) in spent culture medium for aneuploidy screening and its concordance with trophoectoderm biopsy in PGT-A cycles. Hum Reprod. 2021;36(Supplement_1):i377. doi: 10.1093/humrep/deab130.526. [DOI] [Google Scholar]
  • 32.Franco J, Carrill D, Alborno Riaza E, Vill Milla A, Ga Fernande-Vegue R, Soto Borras F, Vega Carrill D, Albornoz A, Martine Acera A, Buen Olalla B, Iniest Perez S, Fullana E, et al. Comparative analysis of non-invasive preimplantation genetic testing of aneuploidies (niPGT-A), PGT-A and IVF cycles without aneuploidy testing: preliminary results. Hum Reprod. 2021;36(Supplement_1):i392. doi: 10.1093/humrep/deab130.559. [DOI] [Google Scholar]
  • 33.Vera-Rodriguez M, Diez-Juan A, Jimenez-Almazan J, Martinez S, Navarro R, Peinado V, Mercader A, Meseguer M, Blesa D, Moreno I, et al. Origin and composition of cell-free DNA in spent medium from human embryo culture during preimplantation development. Hum Reprod. 2018;33(4):745–756. doi: 10.1093/humrep/dey028. [DOI] [PubMed] [Google Scholar]
  • 34.Behr B, Pool TB, Milki AA, Moore D, Gebhardt J, Dasig D. Preliminary clinical experience with human blastocyst development in vitro without co-culture. Hum Reprod. 1999;14(2):454–457. doi: 10.1093/humrep/14.2.454. [DOI] [PubMed] [Google Scholar]
  • 35.Umetani N, Kim J, Hiramatsu S, Reber HA, Hines OJ, Bilchik AJ, Hoon DS. Increased integrity of free circulating DNA in sera of patients with colorectal or periampullary cancer: direct quantitative PCR for ALU repeats. Clin Chem. 2006;52(6):1062–1069. doi: 10.1373/clinchem.2006.068577. [DOI] [PubMed] [Google Scholar]
  • 36.Schmittgen TD, Livak KJ. Analyzing real-time PCR data by the comparative C(T) method. Nat Protoc. 2008;3(6):1101–1108. doi: 10.1038/nprot.2008.73. [DOI] [PubMed] [Google Scholar]
  • 37.Regan SLP, Knight PG, Yovich JL, Leung Y, Arfuso F, Dharmarajan A. Granulosa cell apoptosis in the ovarian follicle-a changing view. Front Endocrinol. 2018;9:61. doi: 10.3389/fendo.2018.00061. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Lin P, Rui R. Effects of follicular size and FSH on granulosa cell apoptosis and atresia in porcine antral follicles. Mol Reprod Dev. 2010;77(8):670–678. doi: 10.1002/mrd.21202. [DOI] [PubMed] [Google Scholar]
  • 39.Best CL, Pudney J, Anderson DJ, Hill JA. Modulation of human granulosa cell steroid production in vitro by tumor necrosis factor alpha: implications of white blood cells in culture. Obstet Gynecol. 1994;84(1):121–127. [PubMed] [Google Scholar]
  • 40.Montgomery Rice V, Limback SD, Roby KF, Terranova PF. Differential responses of granulosa cells from small and large follicles to follicle stimulating hormone (FSH) during the menstrual cycle and acyclicity: effects of tumour necrosis factor-alpha. Hum Reprod. 1998;13(5):1285–1291. doi: 10.1093/humrep/13.5.1285. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary file1 (DOCX 81.0 kb) (81.1KB, docx)

Articles from Journal of Assisted Reproduction and Genetics are provided here courtesy of Springer Science+Business Media, LLC

RESOURCES