Skip to main content
Molecular and Cellular Biology logoLink to Molecular and Cellular Biology
. 2001 Feb;21(3):765–770. doi: 10.1128/MCB.21.3.765-770.2001

Molecular Cloning and Functional Analysis of Mouse C-Terminal Kinesin Motor KifC3

Zhaohuai Yang 1, Chun-hong Xia 1, Elizabeth A Roberts 1, Kevin Bush 2, Sanjay K Nigam 2, Lawrence S B Goldstein 1,*
PMCID: PMC86668  PMID: 11154264

Abstract

Proteins of the kinesin superfamily define a class of microtubule-dependent motors that play crucial roles in cell division and intracellular transport. To study the molecular mechanism of intracellular transport involving microtubule-dependent motors, a cDNA encoding a new kinesin-like protein called KifC3 was cloned from a mouse brain cDNA library. Sequence and secondary structure analysis revealed that KifC3 is a member of the C-terminal motor family. In contrast to other mouse C-terminal motors, KifC3 is apparently ubiquitous and may have a general role in intracellular transport. To understand the in vivo function of the KifC3 gene, we used homologous recombination in embryonic stem cells to construct knockout mouse strains for the KifC3 gene. Homozygous mutants of the KifC3 gene are viable, reproduce normally, and apparently develop normally. These results suggest that KifC3 is dispensable for normal development and reproduction in the mouse.


Microtubule-dependent motors of the kinesin superfamily have undergone structural and functional diversification during evolution and play crucial roles in cell division and intracellular transport (5, 7). Members of this superfamily use the energy of ATP hydrolysis to translocate cargoes along microtubules or to carry out other cellular activities and share extensive sequence similarity within a motor domain containing the microtubule and ATP binding sites (24). As a group, kinesins can be categorized by their motility as either plus-end- or minus-end-directed motors. While most kinesins such as true kinesin (conventional kinesins or kinesin I) are plus-end-directed motors, so far all tested members of the C-terminal kinesins are minus-end-directed motors (2). One distinct feature of the C-terminal kinesins is that they share the same “reverse” structural organization in which the motor domain is located at the C terminus of the polypeptide chain. Most C-terminal kinesins have been suggested to play roles in cell division. Examples from this family include (but are not limited to) three fungal C-terminal kinesins, KAR3 (14) in Saccharomyces cerevisiae, klpA (18) in Aspergillus nidulans, and pkl1 (19) in Schizosaccharomyces pombe; ncd (13, 26) in Drosophila melanogaster; XCTK2 (25) in Xenopus laevis; HSET (1) in humans; KifC1 (22), KifC4 (29), and KifC5 (17) in mice; and CHO2 (12) in Chinese hamster ovary cells. Each of these may play a role in mitotic and/or meiotic spindle assembly or in driving or maintaining spindle pole separation.

Recently, isolation of several new genes encoding C-terminal kinesins identified from different species expanded the variety of suggested functions and structures of the C-terminal kinesin motors. In mouse, the C-terminal motor KifC2 was specifically expressed in neural tissues such as brain, spinal cord, and sciatic nerve (6, 22). The cellular location of the KifC2 proteins was found mainly in neural cell bodies and dendrites as well as axons, which suggests that KifC2 may play roles in dendrite and axonal transport. Interestingly, a new class of C-terminal kinesins called kinesin-like calmodulin-binding proteins (KCBP) was isolated first in plants (20, 27) and then in sea urchin eggs (21). One distinguishing feature of KCBP is a calmodulin-binding domain adjacent to its motor domain, which has the ability to bind calmodulin in the presence of Ca2+. KCBP in Arabidopsis was localized to mitotic microtubule arrays, suggesting a role for KCBP in establishing mitotic microtubule arrays mediated by Ca2+-calmodulin (11, 16).

In this paper, we report our results of a functional analysis of the mouse kinesin motor KifC3. Sequence and secondary structure analysis revealed that KifC3 is a member of the C-terminal motor family. In contrast to other mouse C-terminal motors KifC1 (22), KifC4 (29), and KifC5 (17), which are primarily expressed in proliferative tissues and cell lines, and KifC2 (6, 22), which is specifically expressed in neural tissues, KifC3 is apparently ubiquitous. The expression pattern of KifC3 suggests that it has a general role in intracellular transport. To understand the in vivo function, we developed knockout mouse strains for the KifC3 gene. Surprisingly, homozygous mutants of the KifC3 gene are viable, reproduce normally, and apparently develop normally. These results suggest that KifC3 is dispensable for normal development and reproduction in the mouse.

MATERIALS AND METHODS

Cloning and sequence analysis of KifC3.

A PCR fragment encoding the KifC3 partial motor domain was used for isolating a KifC3 cDNA clone from a BALB/c neonatal mouse brain cDNA library as previously described (29). A 3.0-kb, apparently full-length KifC3 cDNA was completely sequenced on both strands. DNA sequence analysis was performed with the University of Wisconsin Genetics Computer Group (UWGCG) Sequence Analysis software package (4).

Northern blot analysis.

Total RNA was prepared from mouse tissues by guanidinium isothiocyanate extraction as previously described (3) and analyzed in 1% formaldehyde agarose gels by standard methods (23). RNA was transferred to GeneScreen Plus membrane (NEN) in 10× SSC (1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate). Prehybridization and hybridization were performed in 6× SSC, 5× Denhardt's solution, 1% sodium dodecyl sulfate, and 100 μg of single-stranded DNA per ml at 65°C. Final washes were carried out at 65°C in 0.2× SSC and 0.1% sodium dodecyl sulfate.

Generation of targeting vector and ES cells.

We made a targeting vector starting with one 12.5-kb DNA SalI/NheI fragment (see Fig. 3A) isolated from a 129/SvJ genomic library (a gift from the laboratory of Jamey Marth) by using the full-length KifC3 cDNA. One 6.5-kb DNA fragment between the first ClaI and BglII (see Fig. 3A) encoding amino acid residues from 197 to 507 of the KifC3 protein was replaced by an SA-IRES-βgeo cassette (15). This cassette contains an en-2 splice acceptor (SA), an internal ribosome entry site (IRES), and a fusion of genes lacZ and neo (βgeo). The targeting vector was linearized with SalI (see Fig. 3A) and introduced into R1 embryonic stem (ES) cells by electroporation as previously described (10). The targeted KifC3 allele was detected by Southern blotting of ES cell genomic DNA using a 1.0-kb SalI/EcoRV DNA fragment (see Fig. 3A). The targeted KifC3 allele was confirmed by Southern blotting with different restriction enzymes and probes.

FIG. 3.

FIG. 3

Generation and analysis of KifC3 mutants in ES cells. (A) Strategy for generating KifC3 knockout mice. One 6.5-kb DNA fragment between ClaI and BglII was replaced with an SA-IRES-βgeo cassette. This cassette contains an en-2 SA, an IRES, and a fusion of lacZ and neo genes (βgeo). The targeting vector was linearized with SalI. (B) Southern analysis of ES cells. The wild-type (WT) and targeted KifC3 (Mut) alleles were detected as 10- and 8-kb bands, respectively, in Southern blot analysis of ES cell genomic DNA cut with EcoRI (RI) and probed with a 1.0-kb SalI/RcoRV fragment. RV, RcoRV; Bam, BamHI.

Generation and genotypes of KifC3 knockout mice.

Chimeric mice (129/SvJ-derived ES cells in blastocysts of C57BL/6J mice) were generated as previously described (10). Heterozygous mice were used for interbreeding to produce knockout (KifC3−/−) and wild-type (KifC3+/+) mice. A set of four primers was used for genotyping the mice. Two primers based on KifC3 sequences (forward, TGCAGCGGCAGGTGCTGAAG; reverse, AGGTTCTCGTGTACTGCCTT) were used for PCR to amplify a 800-bp DNA fragment which is missed in the KifC3 mutant locus. Another two primers (a forward primer based on the lacZ sequence, GATGGATTGCACGCAGGTTCT; a reverse primer based on the gene neo, AGGTAGCCGGATCAAGCGTAT) were used for amplifying a 450-bp DNA fragment which is missed in the wild-type KifC3 locus. The genotypes of the KifC3 mice as determined by PCR were confirmed by Southern blotting.

Analysis of KifC3 knockout mice.

Gross and histopathological analysis employed standard techniques. Littermate KifC3+/+ and KifC3−/− mice were examined for appearance, posture, circadian activity, home cage assessment, rotarod task performance, balance, and fear conditioning. These behavioral tests were carried out using standard protocols.

Nucleotide sequence accession number.

Sequence data for KifC3 were submitted to EMBL and GenBank under accession no. AF013118.

RESULTS

Cloning and sequence analysis of the KifC3 cDNA.

As described (29), several cDNAs encoding new kinesin-like motors were identified and cloned from a mouse brain cDNA library. One of those clones was designated KifC3 because its motor domain is located at the C terminus of the protein. This clone has a total length of 3,000 bp and contains a single open reading frame that predicts a 710-amino-acid polypeptide (90 kDa) with the conserved motor domain at its C terminus (Fig. 1).

FIG. 1.

FIG. 1

Sequence analysis of KifC3. Predicted amino acid sequence alignment of KifC3 with KifC1, KifC2, hKifC3, and fKif2. Identical amino acids and conserved, but not identical, amino acids in the five polypeptides are shown in black and shaded boxes, respectively. The alignment was performed with the UWGCG software package (4) and boxed with the program BOXSHADE 3.21 (http://www.ch.embnet.org/software/BOX_form.html). These sequence data are available from EMBL and GenBank under the following accession numbers: KifC1, D49544; KifC2, U92949; KifC3, AF013118; hKifC3, AF004426; and fKifC2, U64819.

Comparison of the sequence of KifC3 to other members of the kinesin superfamily using the UWGCG program PILEUP (4) indicated that KifC3 is a member of the C-terminal kinesin family, which contains the conserved motor domain at the C-terminal end of the proteins. To date, all tested members of the C-terminal family have minus-end-directed microtubule motor activity. Thus, it is conceivable that KifC3 is a motor protein which has minus-end-directed microtubule motor activity. Except for human KifC3 (hKifC3) (8) and fish Kif2 (fKif2) (9), the conserved region between KifC3 and other C-terminal motors is primarily limited to the conserved C-terminal motor domain (Fig. 1). However, KifC3 is very similar to hKifC3 (95.9% amino acid identity in the whole protein) and fKif2 (69.4% amino acid identity in the whole protein). In contrast, KifC3 is only 55.3% identical to KifC1 in the whole protein, even though both KifC1 and KifC3 are C-terminal motors in mice. These results suggest that mouse KifC3 is a homologue of hKifC3 and fKif2.

KifC3 expression patterns.

To probe the biological role of KifC3, Northern analysis was used to examine its expression patterns in various mouse tissues and cell lines (Fig. 2). KifC3 carries two transcripts of 3.3 and 2.3 kb (Fig. 2A). While the transcript of 2.3 kb is only present in testis, the other transcript is apparently ubiquitous in mouse tissues and cell lines, even though KifC3 expression is more abundant in kidney and testis. By comparison, KifC4, a C-terminal motor in mouse cells which has been suggested to play roles in cell division (29), is present only in highly proliferative cells such as ES cells and testis cells (Fig. 2B), and Kif3C, an N-terminal motor in mouse which has been suggested to play its role in axonal transport (28, 29), is present only in brain (Fig. 2C). The expression pattern may suggest that KifC3 has a general role in intracellular transport.

FIG. 2.

FIG. 2

Analysis of expression of KifC3 in mouse tissues and cell lines. A set of duplicate Northern blots was probed with KifC3 (A) (two transcripts of 3.3 and 2.3 kb were detected in most mouse tissues and cell lines), KifC4 (B) (one transcript of 2.3 kb was detected only in ES cells and testis), and KifC3 (C) (two transcripts of 7.2 and 4.3 kb were detected only in brain).

Deletion of KifC3 gene in mice.

To explore the in vivo function of the KifC3 gene, we generated a mouse strain lacking a 6.5-kb DNA fragment in the KifC3 gene. The strategy for targeting the KifC3 gene in ES cells is shown in Fig. 3A. The 6.5-kb DNA fragment encodes amino acid residues 197 to 507 of the KifC3 protein, and the deleted region contains half of its α-coiled-coil domain and half of its motor domain. The deleted motor domain contains functional ATP binding and ATPase activity sites. The targeting vector was introduced into R1 ES cells, and G418-resistant clones were selected and analyzed by Southern analysis. Several independent clones with a deletion in the KifC3 gene were obtained (Fig. 3B). In Southern blot analysis, when the ES cell genomic DNA was cut with EcoRI and probed with a 1.0-kb SalI/EcoRV DNA fragment, the wild-type and targeted KifC3 alleles were detected as 10- and 8-kb bands, respectively (Fig. 3B). The deletion in ES cells was confirmed with different restriction enzymes and probes in Southern analysis.

When the 129/SvJ-derived ES cells with a deletion in the KifC3 gene were injected into the blastocysts of C57BL/6J mice, several chimeras were generated. When the chimeras were backcrossed to C57BL/6J mice, heterozygous mice were obtained. The heterozygous mice were used for interbreeding to produce knockout (KifC3−/−) and wild-type (KifC3+/+) mice. The deletion was confirmed first by PCR and Southern blot analysis (Fig. 4A) and then by Northern blot analysis (Fig. 4B). In genomic PCR analysis of the KifC3 mice, an 800-bp DNA fragment, which represents the KifC3 wild-type allele, is found in both the wild-type (+/+) and heterozygous (+/−) mice but not in the homozygous mutants (−/−). In contrast, a 450-bp DNA fragment, which represents the KifC3 mutated allele, is found in both the heterozygous (+/−) and homozygous (−/−) mutants, but not in the wild type (+/+). The results from PCR analysis were confirmed by Southern blot analysis using the same enzyme and probe as described in the legend to Fig. 3B (Fig. 4A). In Northern blot analysis of total RNA obtained from kidney and testis tissue of the knockout mice and wild-type littermates, no KifC3-specific mRNA was observed in KifC3 homozygous mutants with the cDNA corresponding to the deleted region of the KifC3 gene (Fig. 4B). The same results were obtained using a cDNA probe corresponding to the 3′ nondeleted region.

FIG. 4.

FIG. 4

Analysis of KifC3 knockout mice. (A) PCR and Southern analysis of the KifC3 knockout mice. The primers for PCR and probe for Southern analysis are described in Materials and Methods. (B) Northern analysis of KifC3 knockout mice. Total RNA was isolated from the kidney and testis of KifC3 mice (+/+, +/−, and −/−), and the Northern blot was probed with a cDNA fragment, which corresponds to the deleted region of the KifC3 gene.

Analysis of KifC3 knockout mice.

Mice that carried one copy of the deleted gene were interbred to generate litters that were +/+, +/−, and −/− for KifC3 as determined by genomic PCR and Southern blot analysis. Of 169 offspring from heterozygous parents, there were 48 wild-type (+/+), 79 heterozygous (+/−), and 42 homozygous (−/−) animals. The ratios of +/+, +/−, and −/− mice from the heterozygous parents yielded the predicted Mendelian ratios of 1:2:1 (0.75 > P [χ2 = 1.14] > 0.50) as expected for nonlethal alleles. Thus, the KifC3 knockout pups were no less viable than their wild-type and heterozygous littermates. Mice heterozygous or homozygous for the KifC3 deletion appeared healthy, developed normally, and did not display any impairment of reproductive capacity and neonatal survival. The breeding pairs with either heterozygous × heterozygous or homozygous × homozygous animals produced litters similar in size to those produced by wild-type breeding pairs, demonstrating that the absence of the KifC3 protein does not hinder the fertility of male or female mice.

At a gross phenotypic level, the absence of KifC3 had no discernible impact. KifC3−/− mice were indistinguishable from their wild-type littermates with respect to body weight, body length, head length, and tail length. In addition, they exhibited no macroscopic or microscopic alterations in all organs examined (spleen, kidney, brain, testis, retina, and heart). Figure 5 shows the morphology of kidney tissue from wild-type (Fig. 5A, C, and E) and KifC3 knockout (Fig. 5B, D, and F) mice. We found no differences in white or red blood cell counts or in levels of hemoglobin between wild-type and knockout mice, nor were alterations in embryonic development observed. Biochemical analysis of serum samples (potassium, chloride, glucose, blood urea nitrogen, creatinine, total protein, albumin, total bilirubin, aspartate transaminase, alanine transaminase, alkaline phosphatase, gamma glutamyltransferase, calcium, phosphorus, cholesterol, triglycerides, and globulin) and urine samples (color, clarity, glucose, ketones, occult blood, protein, nitrite, bilirubin, specific gravity, pH, urobilinogen, leukocyte esterase, epithelial cells, casts, mucus, white blood cells, red blood cells, and crystals) did not show any difference between wild-type and knockout mice. These results suggest that KifC3 is dispensable for normal development and reproduction in mice.

FIG. 5.

FIG. 5

Morphology of kidney tissue from wild-type (A, C, and E) and knockout (B, D, and F) mice. Kidneys from adult animals were isolated, fixed in paraformaldehyde, and embedded in paraffin. Sections were stained with hematoxylin and eosin. Bar = 100 μm (A to D) and 50 μm (E and F).

DISCUSSION

Our analysis of a new mouse kinesin motor, KifC3, adds to the variety of known structures and functions of the kinesin C-terminal motors. We explored the functions of this new kinesin motor gene by using molecular biological and mouse genetic approaches.

The ubiquitous expression of the KifC3 gene in mouse tissue may suggest that KifC3 has a wide biological function. As shown by Northern blot analysis, KifC3 is apparently expressed more abundantly in retina and kidney, which indicates that KifC3 may have a function related to retina and kidney function. However, when the KifC3 gene was disrupted the kidneys and retinas apparently function normally in homozygous mutant mice. When serum and urine samples from the mutated mice were subjected to a variety of chemical analyses, the results did not show any difference between the mutants and their littermates, which suggests that kidneys in the mutant mice function normally. When a variety of histological analyses were used to examine the kidney tissue section, no difference was found between the KifC3 mutants and their wild-type littermates. It was reported that in both fish and human retinas, antibodies against fKif2, which may be a homologue of mouse KifC3 and hKifC3, strongly labeled photoreceptor terminals in the outer plexiform layer. The data suggested that KifC3 may play some role in the photoreceptor synapse (9). However, when retinal tissue was subjected to a variety of histological and immunofluorescence analyses, no difference was observed between the KifC3 mutant mice and their littermates. Thus, the function of the KifC3 protein will have to be explored further. Results of the studies carried out with mice we report in this paper may facilitate exploration of the function of the KifC3 gene in the future.

REFERENCES

  • 1.Ando A, Kikuti Y Y, Kawata H, Okamoto N, Imai T, Eki T, Yokoyama K, Soeda E, Ikemura T, Abe K, et al. Cloning of a new kinesin-related gene located at the centromeric end of the human MHC region. Immunogenetics. 1994;39:194–200. doi: 10.1007/BF00241260. [DOI] [PubMed] [Google Scholar]
  • 2.Bloom G S, Endow S A. Motor proteins 1: kinesins. Protein Profile. 1995;2:1105–1171. [PubMed] [Google Scholar]
  • 3.Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem. 1987;162:156–159. doi: 10.1006/abio.1987.9999. [DOI] [PubMed] [Google Scholar]
  • 4.Devereux J, Haeberli P, Smithies O. A comprehensive set of sequence analysis programs for the VAX. Nucleic Acids Res. 1984;12:387–395. doi: 10.1093/nar/12.1part1.387. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Goldstein L S, Philp A V. The road less traveled: emerging principles of kinesin motor utilization. Annu Rev Cell Dev Biol. 1999;15:141–183. doi: 10.1146/annurev.cellbio.15.1.141. [DOI] [PubMed] [Google Scholar]
  • 6.Hanlon D W, Yang Z, Goldstein L S. Characterization of KIFC2, a neuronal kinesin superfamily member in mouse. Neuron. 1997;18:439–451. doi: 10.1016/s0896-6273(00)81244-1. [DOI] [PubMed] [Google Scholar]
  • 7.Hirokawa N. Kinesin and dynein superfamily proteins and the mechanism of organelle transport. Science. 1998;279:519–526. doi: 10.1126/science.279.5350.519. [DOI] [PubMed] [Google Scholar]
  • 8.Hoang E, Bost-Usinger L, Burnside B. Characterization of a novel C-kinesin (KIFC3) abundantly expressed in vertebrate retina and RPE. Exp Eye Res. 1999;69:57–68. doi: 10.1006/exer.1999.0671. [DOI] [PubMed] [Google Scholar]
  • 9.Hoang E H, Whitehead J L, Dosé A C, Burnside B. Cloning of a novel C-terminal kinesin (KIFC3) that maps to human chromosome 16q13–q21 and thus is a candidate gene for Bardet-Biedl syndrome. Genomics. 1998;52:219–222. doi: 10.1006/geno.1998.5431. [DOI] [PubMed] [Google Scholar]
  • 10.Joyner A L. Gene targeting: a practical approach. Oxford, United Kingdom: IRL Press at Oxford University Press; 1993. [Google Scholar]
  • 11.Kao Y L, Deavours B E, Phelps K K, Walker R A, Reddy A S. Bundling of microtubules by motor and tail domains of a kinesin-like calmodulin-binding protein from Arabidopsis: regulation by Ca(2+)/calmodulin. Biochem Biophys Res Commun. 2000;267:201–207. doi: 10.1006/bbrc.1999.1896. [DOI] [PubMed] [Google Scholar]
  • 12.Kuriyama R, Kofron M, Essner R, Kato T, Dragas-Granoic S, Omoto C K, Khodjakov A. Characterization of a minus end-directed kinesin-like motor protein from cultured mammalian cells. J Cell Biol. 1995;129:1049–1059. doi: 10.1083/jcb.129.4.1049. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.McDonald H B, Stewart R J, Goldstein L S. The kinesin-like ncd protein of Drosophila is a minus end-directed microtubule motor. Cell. 1990;63:1159–1165. doi: 10.1016/0092-8674(90)90412-8. [DOI] [PubMed] [Google Scholar]
  • 14.Meluh P B, Rose M D. KAR3, a kinesin-related gene required for yeast nuclear fusion. Cell. 1990;60:1029–1041. doi: 10.1016/0092-8674(90)90351-e. . (Erratum, 61:548.) [DOI] [PubMed] [Google Scholar]
  • 15.Mountford P, Zevnik B, Düwel A, Nichols J, Li M, Dani C, Robertson M, Chambers I, Smith A. Dicistronic targeting constructs: reporters and modifiers of mammalian gene expression. Proc Natl Acad Sci USA. 1994;91:4303–4307. doi: 10.1073/pnas.91.10.4303. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Narasimhulu S B, Kao Y L, Reddy A S. Interaction of Arabidopsis kinesin-like calmodulin-binding protein with tubulin subunits: modulation by Ca(2+)-calmodulin. Plant J. 1997;12:1139–1149. doi: 10.1046/j.1365-313x.1997.12051139.x. [DOI] [PubMed] [Google Scholar]
  • 17.Navolanic P M, Sperry A O. Identification of isoforms of a mitotic motor in mammalian spermatogenesis. Biol Reprod. 2000;62:1360–1369. doi: 10.1095/biolreprod62.5.1360. [DOI] [PubMed] [Google Scholar]
  • 18.O'Connell M J, Meluh P B, Rose M D, Morris N R. Suppression of the bimC4 mitotic spindle defect by deletion of klpA, a gene encoding a KAR3-related kinesin-like protein in Aspergillus nidulans. J Cell Biol. 1993;120:153–162. doi: 10.1083/jcb.120.1.153. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Pidoux A L, LeDizet M, Cande W Z. Fission yeast pkl1 is a kinesin-related protein involved in mitotic spindle function. Mol Biol Cell. 1996;7:1639–1655. doi: 10.1091/mbc.7.10.1639. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Reddy A S, Safadi F, Narasimhulu S B, Golovkin M, Hu X. A novel plant calmodulin-binding protein with a kinesin heavy chain motor domain. J Biol Chem. 1996;271:7052–7060. doi: 10.1074/jbc.271.12.7052. [DOI] [PubMed] [Google Scholar]
  • 21.Rogers G C, Hart C L, Wedaman K P, Scholey J M. Identification of kinesin-C, a calmodulin-binding carboxy-terminal kinesin in animal (Strongylocentrotus purpuratus) cells. J Mol Biol. 1999;294:1–8. doi: 10.1006/jmbi.1999.3249. [DOI] [PubMed] [Google Scholar]
  • 22.Saito N, Okada Y, Noda Y, Kinoshita Y, Kondo S, Hirokawa N. KIFC2 is a novel neuron-specific C-terminal type kinesin superfamily motor for dendritic transport of multivesicular body-like organelles. Neuron. 1997;18:425–438. doi: 10.1016/s0896-6273(00)81243-x. [DOI] [PubMed] [Google Scholar]
  • 23.Sambrook J, Fritsch E F, Maniatis T. Molecular cloning: a laboratory manual. 2nd ed. Cold Spring Harbor, N.Y: Cold Spring Harbor Laboratory Press; 1989. [Google Scholar]
  • 24.Vale R D, Fletterick R J. The design plan of kinesin motors. Annu Rev Cell Dev Biol. 1997;13:745–777. doi: 10.1146/annurev.cellbio.13.1.745. [DOI] [PubMed] [Google Scholar]
  • 25.Walczak C E, Verma S, Mitchison T J. XCTK2: a kinesin-related protein that promotes mitotic spindle assembly in Xenopus laevis egg extracts. J Cell Biol. 1997;136:859–870. doi: 10.1083/jcb.136.4.859. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Walker R A, Salmon E D, Endow S A. The Drosophila claret segregation protein is a minus-end directed motor molecule. Nature. 1990;347:780–782. doi: 10.1038/347780a0. [DOI] [PubMed] [Google Scholar]
  • 27.Wang W, Takezawa D, Narasimhulu S B, Reddy A S, Poovaiah B W. A novel kinesin-like protein with a calmodulin-binding domain. Plant Mol Biol. 1996;31:87–100. doi: 10.1007/BF00020609. [DOI] [PubMed] [Google Scholar]
  • 28.Yang Z, Goldstein L S. Characterization of the KIF3C neural kinesin-like motor from mouse. Mol Biol Cell. 1998;9:249–261. doi: 10.1091/mbc.9.2.249. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Yang Z, Hanlon D W, Marszalek J R, Goldstein L S. Identification, partial characterization, and genetic mapping of kinesin-like protein genes in mouse. Genomics. 1997;45:123–131. doi: 10.1006/geno.1997.4901. [DOI] [PubMed] [Google Scholar]

Articles from Molecular and Cellular Biology are provided here courtesy of Taylor & Francis

RESOURCES