Skip to main content
PLOS One logoLink to PLOS One
. 2021 Dec 13;16(12):e0250808. doi: 10.1371/journal.pone.0250808

Development and comparison of loop-mediated isothermal amplification with quantitative PCR for the specific detection of Saprolegnia spp.

Satyaki Ghosh 1,¤, David L Straus 2, Christopher Good 3, Vipaporn Phuntumart 1,*
Editor: Hideyuki Doi4
PMCID: PMC8668100  PMID: 34898622

Abstract

Saprolegniasis is an important disease in freshwater aquaculture, and is associated with oomycete pathogens in the genus Saprolegnia. Early detection of significant levels of Saprolegnia spp. pathogens would allow informed decisions for treatment which could significantly reduce losses. This study is the first to report the development of loop-mediated isothermal amplification (LAMP) for the detection of Saprolegnia spp. and compares it with quantitative PCR (qPCR). The developed protocols targeted the internal transcribed spacer (ITS) region of ribosomal DNA and the cytochrome C oxidase subunit 1 (CoxI) gene and was shown to be specific only to Saprolegnia genus. This LAMP method can detect as low as 10 fg of S. salmonis DNA while the qPCR method has a detection limit of 2 pg of S. salmonis DNA, indicating the superior sensitivity of LAMP compared to qPCR. When applied to detect the pathogen in water samples, both methods could detect the pathogen when only one zoospore of Saprolegnia was present. We propose LAMP as a quick (about 20–60 minutes) and sensitive molecular diagnostic tool for the detection of Saprolegnia spp. suitable for on-site applications.

Introduction

Oomycetes represent a diverse group of eukaryotic pathogens that can infect a wide range of hosts [13] Pathogens in the Saprolegnia genus can infect and kill crustaceans and fish in freshwater, especially in aquaculture where fish are raised at high densities [4]. The most widely studied members of this genus include S. diclina, S. ferax and S. parasitica [5].

Saprolegniasis has been reported in channel catfish (Ictalurus punctatus), rainbow trout (Oncorhynchus mykiss), redear sunfish (Lepomis microlophus), Indian major carps (including Labeo rohita, Catla catla, L. calbasu) and Atlantic salmon (Salmo salar) [68]. The majority saprolegniasis occurrence has been reported in temperate environments and commonly found associated with salmonid farming. Saprolegnia can infect all stages of the fish life cycle including the egg stage [911]. In the U.S., economic losses due to saprolegniasis in commercial aquaculture is estimated to be approximately 40 million dollars [12, 13]. Almost 50% of the commercial losses to farmed channel catfish is attributed to saprolegniasis [14]. It is estimated that 10% of all hatched salmon succumb to saprolegniasis, which represents a major financial loss given that this industry accounts for approximately 30% of the global fish production for consumption [4, 1416]. The incidence of saprolegniasis extends to Asian tropical aquaculture systems where over 80% of fish is produced through aquaculture [17]. Therefore, saprolegniasis is among the most impactful diseases in commercial aquaculture.

Conventional culture-based strategies coupled with conventional PCR-based approaches for pathogen identification usually take several days [18]. Currently, quantitative-PCR (qPCR) is one of the methods of choice for molecular detection and quantification of target organisms [19]. Detection of pathogens based on qPCR has been reported in several studies including Trypanosoma cruzi, Fusarium spp., Japanese encephalitis virus and bacteria such as Listeria monocytogenes, Francisella tularensis, and Mycobacterium avium [2023].

Loop-Mediated Isothermal Amplification (LAMP) has emerged as a novel tool for the sensitive and rapid detection of nucleic acids and is suitable for field applications. Since the first publication of LAMP [24], there has been a progressive increase in the number of publications based on this technique to diagnose and detect a variety of organisms including bacteria, viruses and eukaryotic pathogens indicating the success of LAMP as a reliable tool for detection [2527]. The present focuses on development of a LAMP and a qPCR method for specific detection of Saprolegnia species, and compared these two tests based on sensitivity and specificity. These two molecular approaches targeted the internal transcribed spacer (ITS) region of ribosomal DNA and the mitochondrial cytochrome c oxidase subunit I (C0xI) gene. We first report the standard protocols for specific detection of the pathogens, followed by testing our methods under various scenarios for detection of Saprolegnia species including water samples, infected fish tissue, mycelium and zoospores. Our results show that both of the methods are reliable, specific and sensitive to Saprolegnia, and have the potential to be applied for the detection of other pathogens.

Materials and methods

Isolation and maintenance of oomycete cultures

All Saprolegnia spp. cultures used in this study were grown and maintained on yeast peptone sucrose (YPS) agar (20 g/L D-glucose, 1 g/L KH2PO4, 0.5 mg/L MgSO4, and 1 g/L yeast extract) supplemented with 68 μg/ml chloramphenicol and 68 μg/ml streptomycin. The cultures were incubated at 24°C in the dark [28]. Unless otherwise noted, all laboratory grade chemicals used in this study were purchased from Sigma Aldrich, St. Louis, MO.

Saprolegnia spp. isolates used in this study (Table 1) were isolated from various sources including fish, eggs, and waters from commercial aquaculture ponds and from recirculating aquaculture systems (RASs). For isolation of Saprolegnia spp. from water, water samples from each source were collected and filtered through two layers of miracloth (Calbiochem, La Jolla, CA). One ml of the filtrate was spread aseptically onto YPS media and incubated in the dark at 24°C. The resultant mycelial growths were subcultured for several generations to ensure the purity of the culture.

Table 1. Saprolegnia spp. isolates used in the present study.

Organism/Sample ID Isolation Source
S. salmonis Sunshine bass eggs from Keo Fish Farm (Keo, AR).
3, 9, 6A, 11A, 1B Pond water from J.M. Malone and Sons fish farm (Lonoke, AR)
F1, F2, JMM Shad 3, JMM Shad 72 American Shad (A. sapidissima) from ponds at J. M. Malone and Son fish farm (Lonoke, AR)
RAS1, RAS2, RAS3, RAS4, RAS5 RAS water from The Freshwater Institute (Shepherdstown, WV)

For isolation of Saprolegnia spp. from infected tissues, adult infected American shad (Alosa sapidissima) with lengths ranging between 48.3cm to 49.5cm and exhibiting visible symptoms of saprolegniasis were used for isolation of Saprolegnia spp following previously published protocols [29]. Briefly, areas of the fish exhibiting visible symptoms were dissected using sterilized scalpels; individual pieces were surface sterilized by treatment with 2.5% bleach for 45 s, followed by submersion in distilled water for 1 min, then in 70% ethanol for 45 s, and finally in distilled water for 1 min. These pieces were then aseptically placed onto YPS agar plates and incubated in the dark at 24°C and observed daily.

DNA isolation

Mycelial mats (90–100 mg) from 4-day old Saprolegnia cultures were collected and were crushed using a mortar and pestle in liquid nitrogen. DNA was isolated using the method of Zelaya-Molina et al. [30] with some modifications. Briefly, the crushed mycelia were treated with lysis buffer (10 mM Tris, 50 mM EDTA, 0.5% SDS, 0.5% Tween-20, and 0.5% Triton X-100), 20 mg/ml Proteinase K and 100 mg/ml RNase A. The tubes were incubated at 37°C for 30 min in a shaking incubator at 150 rpm, vortexed for 30 s and then incubated at 55°C for 30 min with a gentle inversion at 10-min intervals. Next, an equal volume of 25:24:1 phenol-chloroform-isoamyl alcohol (VWR, Radnor, PA) was added and the tubes were vortexed for 30 s followed by centrifugation at 10,000g for 10 min. The supernatant was transferred into a new tube, an equal volume of 24:1 chloroform-isoamyl alcohol was added, vortexed for 30 s and centrifuged at 10,000g for 10 min. The supernatant was transferred into a new tube, DNA was precipitated by adding an equal volume of isopropanol (VWR, Radnor, PA) and incubated at -20°C for 15 min. The tubes were then centrifuged at 10,000g for 10 min and the supernatant was discarded. The resultant pellet was washed with 70% ethanol (Pharmco-AAPER, Shelbyville, KY), dried and resuspended in molecular grade water. The isolated DNA was quantified spectrophotometrically using a Nanodrop 2000c (Thermo Scientific, Wilmington, DE). Assessment of the quality of the isolated DNA was performed by electrophoresis on 0.8% agarose gels stained with SYBR Green I Nucleic Acid Gel stain (Invitrogen, Carlsbad, CA) and visualized using a UV transilluminator (Ultra-Lum Inc, Claremont, CA).

Sequence analysis and phylogenetic analysis

Identification of Saprolegnia spp. isolates was performed by PCR of the internal transcribed spacer (ITS) region and a portion of the ribosomal large subunit [16, 31, 32] and of cytochrome C oxidase subunit 1 (CoxI) gene [33]. Amplification products were analyzed by electrophoresis and were purified using the QIAquick PCR purification kit (Qiagen, Germantown, MD) according to the manufacturer’s protocol. The purified amplicons were sequenced at the University of Chicago Comprehensive Cancer Centre, DNA sequencing and Genotyping Facility (Chicago, IL). The resultant sequences were subjected to bioinformatic analysis via BLAST [34] and compared to sequences on both the NCBI [35] and the FungiDB [36] databases.

Multiple sequence alignments were generated using Clustal Omega [37]. The maximum-likelihood phylogenetic trees of CoxI and ITS markers were constructed using Mega7 software [38] based on the Tamura-Nei Model [39] with 1,000 bootstrap replicates and default parameters. Reference ITS and CoxI sequences were obtained from NCBI GenBank database; Phytophthora sojae voucher P6497 and Aphanomyces euteiches voucher BR694 were used as the outgroups for both the trees. Concatenated phylogenetic trees of ITS and CoxI regions were constructed using SequenceMatrix version 1.8 (http://www.ggvaidya.com/taxondna/) [40] with 1,000 bootstrap replicates and default parameters.

qPCR for specific detection of Saprolegnia spp.

Primers specific to the ITS region and the CoxI gene of the Saprolegnia genus were designed using Primer3 software with manual modifications (https://bioinfo.ut.ee/primer3-0.4.0/) [41]. Quantitative PCR reactions were carried out using the iTaq Universal SYBR® Green Supermix (Bio-Rad, Hercules, CA) according to the manufacturer’s instructions in a CFX Connect Real-Time PCR Detection system (Bio-Rad, Hercules, CA). To generate the standard-curve for absolute quantification, reactions were carried out using a 10-fold dilution series of S. salmonis DNA (ranging from 2 ng/μl to 20 ng/μl, measured spectrophotometrically). To assess the specificity of the developed qPCR, 20 ng/μl of DNA purified from all the Saprolegnia isolates described in Table 1 were used with both the ITS and CoxI primers. The reactions were carried out in triplicate.

LAMP for specific detection of Saprolegnia spp.

To design primers for LAMP against the conserved ITS region specific for Saprolegnia spp., the ITS sequences for S. parasitica CBS 223.65 (Accession No.—PRJNA280969), S. diclina VS20 (Accession No.—PRJNA255245), S. ferax (Accession No.—PRJNA12392), S. delica clone 130 (Accession No.—JX212906.1) and S. salmonis from Argentina (Accession No.—EU551153.1) were retrieved from the NCBI sequence database [35] and aligned using Clustal Omega [37]. Inner and outer primers were generated based on this alignment, using the Primer Explorer v5 (https://primerexplorer.jp/e/, Eiken Chemical Co. Ltd., Tokyo, Japan) tool, with default parameters.

To optimize the LAMP reaction, each LAMP reaction (25 μl) contained 20 ng/μl of S. salmonis gDNA, 1.4 mM dNTPs, 0.32 U/ μl Bst 3.0 (New England Biolabs, Ipswich, MA), 8 mM MgSO4, 1.6 μM inner primers, 0.2 μM outer primers, 0.4 μM loop primers and molecular grade water (Invitrogen, Carlsbad, CA). The reactions were incubated at 65°C for 60 min, followed by inactivation of the enzyme to terminate the reaction at 80°C for 5 min. No template controls (NTC) using molecular grade water served as negative controls. To each reaction, 1 μl of 1,000X SYBR Green I (AMRESCO Inc., Solon, OH) was added. Visually, a green color formation was indicative of a positive reaction whereas a golden-brown color indicated a negative reaction. The amplification products were also verified visually by 2% agarose gel electrophoresis.

Comparison of qPCR and LAMP

A sensitivity assay was performed using a 10-fold dilution of purified S. salmonis DNA at 100 ng, 10 ng, 1 ng, 100 pg, 10 pg, 1 pg, 100 fg, 10 fg and 1 fg. Protocols for qPCR and LAMP assay were as described above. For detection of zoospores, one and ten zoospores were used in each reaction for both LAMP and qPCR. The reactions were performed in triplicate and repeated three times.

Results

Pathogen identification and phylogenetic analysis

Fifteen cultures of the oomycete were isolated from water samples as well as from infected fish tissues (Table 1). To identify the isolates, PCR was performed using both the oomycete-specific CoxI primers and universal ITS primers. The PCR products were visualized on 0.8% agarose gel and were purified, sequenced, and analyzed by BLAST [34] with an E-value cutoff of 0. All of the isolates were identified as Saprolegnia. To further validate our results and to track their genetic diversity, phylogenetic trees were constructed. The maximum-likelihood tree of the ITS sequences showed that all the isolated species grouped within the Saprolegnia genus, in agreement with BLAST results (Fig 1). The S. salmonis isolate grouped closely with S. parasitica with a bootstrap value of 68%. For cultures isolated from the ponds of J.M. Malone and Sons fish farm (Lonoke, AR), isolates 6A and 11A were closest to S. diclina with a bootstrap value of 90%. Isolate 1B was grouped with S. parasitica with a bootstrap value of 98%. Isolate 9 grouped with S. ferax with 80% bootstrap support. Isolate 3 was taxonomically closest to S. diclina with a bootstrap value of 63%. For cultures isolated from infected fish (J.M. Malone and Sons fish farm, Lonoke, AR), isolates F1 and F2 grouped together with S. parasitica with 67% bootstrap support. The JMM Shad 3 and JMM Shad 72 also grouped together and appeared to have S. parasitica as the closest phylogenetic neighbor with 68% bootstrap support. Isolates RAS1, RAS2 and RAS3 grouped closest to S. parasitica, while RAS4 grouped closest to S. ferax with 80% bootstrap support; RAS5 had the closest phylogenetic relationship with S. monoica with 89% bootstrap support. A second maximum-likelihood tree based on the CoxI sequences showed the same phylogenetic groupings with the ITS based tree with slightly different bootstrap values (Fig 2). To increase discriminatory power and the robustness for identification of species within the genus, the sequences of both ITS and CoxI were used to constitute the concatenated phylogenetic tree. Fig 3 showed the same phylogenetic groupings with both the ITS- and CoxI-based trees with slightly different bootstrap values. Overall, the results of the three phylogenetic trees confirmed that the isolates in Table 1 belonged to the Saprolegnia genus.

Fig 1. Maximum-likelihood phylogenetic tree showing evolutionary relationships of 53 Saprolegnia isolates based on the ITS region.

Fig 1

Isolates examined in this study are shown in boldface. Bootstrap values ≥ 50% (1000 replicates) are given at the branchpoints. The scale bar indicates the number of substitutions per site. P. sojae voucher P6497 and A. euteiches BR694 were used as outgroups.

Fig 2. Maximum-likelihood phylogenetic tree showing evolutionary relationships of 53 Saprolegnia isolates based on the CoxI gene.

Fig 2

Isolates examined in this study are shown in boldface. Bootstrap values ≥ 50% (1000 replicates) are given at the branchpoints. The scale bar indicates the number of substitutions per site. P. sojae voucher P6497 and A. euteiches BR694 were used as outgroups.

Fig 3. Concatenation phylogenetic tree based on the sequences of ITS and CoxI.

Fig 3

Isolates examined in this study are shown in boldface. Bootstrap values ≥ 50% (1000 replicates) are given at the branchpoints. The scale bar indicates the number of substitutions per site. P. sojae voucher P6497 and A. euteiches BR694 were used as outgroups.

qPCR for specific detection

The qPCR reaction for CoXI gene using qCOX R1 (5’CTGAAGGACCWGAGTGHGCTTG 3’) and qCOX F1 (5’GGDGCTCCWGATAGGCTTTNCC 3’) was optimized by gradient qPCR. Results showed that annealing temperature at 59°C gave the best specificity and efficiency. We then generated a standard curve using a 10-fold dilution of purified gDNA from S. salmonis (20 ng/μl to 0.2 pg/μl) in triplicate. The Cq values of these standards were plotted against the logarithm of their concentrations. The assay efficiency was calculated to be at 91.4% using the equation y = (-3.546)x + 54.138 with the slope values of -3.546 and R2 values of 0.990 (Fig 4). The melt curve analysis gave rise to a single distinct peak indicating that the qPCR product was a pure, single amplicon and was specific to S. salmonis.

Fig 4. Standard curve of CoxI gene.

Fig 4

Ten-fold dilutions of S. salmonis DNA ranging from 1 fg to 100 ng were amplified in triplicate and the reactions were repeated three times. The iTaq Universal SYBR® Green Supermix and qCOXF1+R1 primers were used.

Development of LAMP

Primers for the specific detection of Saprolegnia genus were designed targeting a conserved 201 bp section of the ITS region (Fig 5A). The inner and outer primers were generated based on sequence alignment using Clustal Omega alignment followed by the Primer Explorer v5 (https://primerexplorer.jp/e/, Eiken Chemical Co. Ltd., Tokyo, Japan) tool. The outer and inner primer sets with the highest dG value for dimerization and with acceptable room for generating loop primers, were chosen to ensure that the free energies and the 5’ end of F1c and B1c, and the 3’ end of F2 and B2, were less than or equal to -4.0 kcal/mol (Fig 5B, Table 2).

Fig 5. Lamp primer design.

Fig 5

A. Schematic representation of the ITS region, showing the positioning of the LAMP primers used in the present study. Scale bar represents 100bp. FwdOut = Forward Outer Primer; RevOut = Backward Outer Primer; F2+F1c = Forward Inner Primer; B2c+B1 = Backward Inner Primer; LF = Loop Forward Primer; LB = Loop Backward Primer. B. Positioning and orientation of LAMP primers developed in the present study. Representative ITS sequences from Saprolegnia and non-Saprolegnia oomycetes were aligned and the LAMP primers were positioned on the alignment manually. The LAMP primers amplified the ITS1 regions of the target sequences.

Table 2. LAMP primers used in the present study.

Primer Abbreviation Sequence
Forward Inner Primer FIP 5’ CACTTACATGAGAAATCTCCGAA-TAGCCGAAGAACGCTTTGGAAGC 3’
Backward Inner Primer BIP 5’ AATTCAGTGAGTCATCTAAATA-AACATACTCCCAGGACTAACCCGC 3’
Forward Outer Primer FwdOut 5’ GGTAATGGTGTGGTTTTTTGTGG 3’
Backward Outer Primer RevOut 5’ TGAAAGAAGTTTGTGTTG 3’
Loop Forward Primer LF 5’ GCGACGGGAACACCGT 3’
Loop Backward Primer LB 5’ AGTGCAATATGCGTT 3’

For optimization of the LAMP reaction, the first factor that was considered was the Mg2+ concentration. We tested the reactions using 2 ng of DNA/reaction with eight different concentrations of Mg2+ ranging from 2 mM-10 mM Mg2+. The experiments were performed in triplicate and repeated three times. Our results showed that concentration of Mg2+ at and above 4 mM showed positive reactions. Interestingly, in no template controls, when concentrations of Mg2+ was at 5 mM and above, the colors of the reactions showed false positives (Fig 6). Therefore, to avoid false positive reaction, the optimal concentration of Mg2+ at 4mM was chosen. Optimization of the other factors including various temperatures, reaction times and primer ratios did not have any impact on the integrity of the reaction. Hence, the optimal condition for the LAMP reaction was selected as 4mM Mg2+, 1:8 outer to inner primer ratio and a reaction temperature of 65°C.

Fig 6. Optimization of Mg2+ concentration for LAMP.

Fig 6

The concentrations of Mg2+ ranging from 2 mm-10 mM were tested. Top panel represents positive controls using 2ng/μl S. salmonis gDNA. The bottom panel, No Template Control (NTC) represents negative controls. Color change to green indicates positive reaction, while golden brown indicates negative reaction. The experiments were performed in triplicate and repeated three times.

To establish the sensitivity of the LAMP reaction, the experiments were carried out with a 10-fold dilution series of purified S. salmomis DNA ranging from 1 fg to 100 ng, in triplicate. Results showed that LAMP successfully detected as low as 10 fg of S. salmomis DNA (Fig 7). This detection sensitivity was higher than that of qPCR which was at 2 pg (Fig 4). Further testing to determine whether our method can be used to directly detect zoospore from water samples without DNA purification, we subjected one or ten zoospores of S. salmonis to LAMP and qPCR methods. Ten ng of S. salmonis genomic DNA was used as the positive control and NTC was used as negative controls. Each sample was performed in triplicate and repeated three times. The results showed that both the qPCR and LAMP procedures successfully detected one zoospore in the water samples (Fig 8), indicating that our developed methods were highly specific and highly sensitive.

Fig 7. The sensitivity of LAMP.

Fig 7

Ten-fold dilution S. salmonis DNA ranging from 1 fg to 100 ng were used in the presence of 1000X SYBR Green I. Color changes from golden brown to green indicates a positive reaction. The concentrations of template DNA are indicated, NTC = no template control, represents a negative control. The reactions were performed in triplicate and were repeated three times.

Fig 8. Direct detection of zoospores.

Fig 8

A. qPCR and B. LAMP. One and ten zoospores were used in each reaction, S. salmonis DNA (10 ng/μl) was used as the positive control while no template control (NTC) was used as the negative control. Each sample was performed in triplicate and was repeated three times.

The specificity of the LAMP assay was tested using purified DNA from different isolates of Saprolegnia spp., infected fish tissues other non-Saprolegnia oomycetes (A. astaci and P. sojae), a fungus (Fusarium spp.), Daphnia magna and a bacterium (Escherichia coli). Each sample was tested in triplicate. Results showed that the LAMP reaction was specific only to the Saprolegnia genus (Table 3), demonstrating that our developed LAMP method was specific to pathogens in the genus Saprolegnia and is highly sensitive.

Table 3. Specificity of qPCR and LAMP.

Species Isolation Source qPCR result LAMP result
S. salmonis (+ control) Pond water from J.M. Malone and Sons fish farm (Lonoke, AR) + +
S. ferax Infected crayfish tissue (Bowling Green, OH) + +
S. parasitica RAS water from The Freshwater Institute (Shepherdstown, WV) + +
S. diclina Pond water from J.M. Malone and Sons fish farm (Lonoke, AR) + +
S. delica Pond water from J.M. Malone and Sons fish farm (Lonoke, AR) + +
A. astaci Infected crayfish tissue (Bowling Green, OH) - -
P. sojae Infected soybean (Bowling Green, OH) - -
Fusarium spp. Water from cichlid aquaria (Bowling Green, OH) - -
D. magna Water from BGSU Greenhouse reservoir (Bowling Green, OH) - -
E. coli TOP10 (Invitrogen, CA) - -

Discussion

The pathogens in the genus Saprolegnia cause significant economic losses in aquaculture; therefore, accurate identification and early detection of pathologically relevant levels is critical. Morphological identification is challenging and less reliable compared to molecular studies. To ensure reliable identification of oomycetes, a combination of molecular markers based on ITS regions along with CoxI and/or CoxII are recommended [33]. The present study develops a standard protocol for identification of pathogens in the genus Saprolegnia using both ITS and CoxI. To determine genetic relationships among Saprolegnia spp. used in this study, phylogenetic trees with a single locus of ITS or CoxI marker as well as a concatenated phylogeny were constructed. These three phylogenetic trees confirmed that the isolates were related and belonged to the Saprolegnia genus. Due to low bootstrap values at some nodes, additional markers are required to conclusively determine the phylogenetic positioning of the isolates within the Saprolegnia genus. For instance, in all three phylogenetic trees, S. salmonis clustered with S. parasitica but bootstrap values were below 68%. Multilocus phylogenetic analysis should, in theory, increase phylogenetic resolution and improve the analysis. Such multi-gene analyses has been conducted by Göker et al. [42] using ꞵ-tubulin, NADH1 and LSU rDNA sequences for several oomycetes. Phylogenetic resolution of the Phytophthora genus was accomplished in this manner by Martin et al. [43]. Richter and Rósselló-Mora [44] suggested that measurement of average nucleotide identity between two genomes could yield more accurate results of species resolution. Finally, it has been suggested that sampling more individuals per species can help resolve incongruences amongst single gene trees [45]. An interesting observation in our phylogenetic studies was that the variation at the species level for the Saprolegnia isolates from RAS, even though the water samples from these systems was collected from the same tank at the same time. However, similar species level spatio-temporal variations have been reported for Phytophthora, Pythium and Phytopythium species in nursery irrigation systems [46].

In this study, we were able to isolate and purify Saprolegnia from environmental sources (water samples and infected tissues), using a similar method for the isolation of Saprolegnia spp. from infected rainbow trout [8], infected crayfish [47], salmon hatcheries [11] and amphibians [48]. Current protocols for detecting and identifying Saprolegnia from environmental sources involve lab culture-based approaches followed by PCR-based molecular identification. Another method of oomycete detection which has been used with some success is baiting [49] using rice seeds [50], hemp seeds [28] and sesame seeds [51], followed by PCR for accurate identification. Finally, immunological detection of Saprolegnia spp. using monoclonal antibodies has also been reported [15].

This study is the first to develop a rapid and sensitive molecular technique for the detection of Saprolegnia spp. using the novel LAMP technique. Previously, LAMP has been employed for the detection of other oomycetes such as Plasmopara viticola [52], P. sojae [53] and Pythium spp. [54]. As an on-site detection tool, LAMP has several advantages compared to conventional PCR and qPCR. It has been applied successfully for on-site detections of the bacteria responsible for foot rot in sheep [55].

A major advantage of LAMP is that it is highly sensitive and does not require major equipment. Our developed LAMP assay successfully detected all 15 isolates in the present study and offered positive results with as low as 10 fg DNA and with only one zoospore of S. salmonis. It is noteworthy that our method can directly detect an organism from a sample without DNA purification, which refers to a one-step LAMP. This method has been reported in several studies such as detection of E. coli, Mycobacterium smegmatis [56] and Mycoplasma ovipneumoniae [57]. Similarly, detection by LAMP at femtogram level has been reported in numerous studies such as acute viral necrobiotic virus in scallop [58], classical swine flu virus [59] and Enterococcus hirae [60]. When our developed LAMP assay from this study was tested on several members of the oomycetes, it was found to be specific for all 15 Saprolegnia isolates used in this study. The sensitivity and specificity of LAMP makes it a suitable candidate for the detection of target organisms from environmental samples, especially when present in extremely low amounts. Although false positives are one of the major drawbacks associated with LAMP, much of the false positive amplification can be eliminated by using six primers and careful optimization of the reaction [61]. We did not experience any false positives in our experiments.

While both LAMP and qPCR have their own advantages and drawbacks depending on the circumstance, they can both be used to specifically detect the members of the genus Saprolegnia. The LAMP method is inexpensive and more rapid and sensitive compared to qPCR; therefore, we propose the use of LAMP for sensitive detection of pathologically relevant levels of Saprolegnia for on-site applications. However, to quantify Saprolegnia loads, qPCR is more useful, especially when the epidemic threshold of the disease is known. Incorporation of the LAMP method and qPCR into real-time LAMP would provide the best outcome for detection and quantification. This would enable monitoring the dynamics of Saprolegnia spp. in the water, and at what points their level becomes an issue. Real-time LAMP has been reported for the detection and quantification of Enterocytozoon hepatopenaei [62] and Ustilago maydis [63] and future research should investigate its development use for to detect Saprolegnia and other oomycete pathogens.

Acknowledgments

We thank Gayathri Beligala for her contribution to the experiments. We thank Dr. Paul F. Morris for his technical suggestions regarding experimental design and for his comments on the manuscript. Mention of trade names or commercial products in this article is solely for the purpose of providing specific information and does not imply recommendation or endorsement by Bowling Green State University, The Conservation Fund’s Freshwater Institute or the U.S. Department of Agriculture. USDA is an equal opportunity provider and employer.

Data Availability

All DNA sequences are available from the NCBI database: BankIt2510419 N9 OK872234 BankIt2510427 S.salmonis OK872235 BankIt2510436 F1 OK872236 BankIt2510443 F2 OK872237 BankIt2510448 JMM_Shad_3 OK872238 BankIt2510453 1B OK872239 BankIt2510454 6A OK872240 BankIt2510456 11A OK872241 BankIt2510457 RAS_1 OK872242 BankIt2510459 RAS_2 OK872243 BankIt2510461 RAS_3 OK872244 BankIt2510463 RAS_4 OK872245 BankIt2510466 RAS_5 OK872246 BankIt2511910 N3 OK872247 BankIt2510450 JMM_Shad_72 OK872248.

Funding Statement

SG-Ohio Sea Grant (60063782), https://ohioseagrant.osu.edu/ VP-Ohio Sea Grant (60063782), https://ohioseagrant.osu.edu/ The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1.Densmore CL, Green DE. Diseases of amphibians. ILAR Journal. 2007;48(3):235–54. doi: 10.1093/ilar.48.3.235 [DOI] [PubMed] [Google Scholar]
  • 2.Ruthig GR. Water molds of the genera Saprolegnia and Leptolegnia are pathogenic to the North American frogs Rana catesbeiana and Pseudacris crucifer, respectively. Diseases of Aquatic Organisms. 2009;84(3):173–8. doi: 10.3354/dao02042 [DOI] [PubMed] [Google Scholar]
  • 3.Banfield MJ, Kamoun S. Hooked and Cooked: A Fish Killer Genome Exposed. PLOS Genetics. 2013;9(6):e1003590. doi: 10.1371/journal.pgen.1003590 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.van West P. Saprolegnia parasitica, an oomycete pathogen with a fishy appetite: new challenges for an old problem. Mycologist. 2006;20(3):99–104. 10.1016/j.mycol.2006.06.004. [DOI] [Google Scholar]
  • 5.Diéguez-Uribeondo J, Cerenius L, Söderhäll K. Repeated zoospore emergence in Saprolegnia parasitica. 1994;98(7):810–5. doi: 10.1016/s0953-7562(09)81060-5 [DOI] [Google Scholar]
  • 6.Bly JE, Lawson LA, Szalai AJ, Clem LW. Environmental factors affecting outbreaks of winter saprolegniosis in channel catfish, Ictalurus punctatus (Rafinesque). Journal of Fish Diseases. 1993;16(6):541–9. doi: 10.1111/j.1365-2761.1993.tb00890.x [DOI] [Google Scholar]
  • 7.Das SK, Murmu K, Das A, Shakuntala I, Das RK, Ngachan SV, et al. Studies on the identification and control of pathogen Saprolegnia in selected Indian major carp fingerlings at mid hill altitude. J Environ Biol. 2012;33(3):545–9. Epub 2012/10/04. . [PubMed] [Google Scholar]
  • 8.Shin S, Kulatunga DCM, Dananjaya SHS, Nikapitiya C, Lee J, De Zoysa M. Saprolegnia parasitica isolated from rainbow trout in Korea: Characterization, anti-Saprolegnia activity and host pathogen interaction in zebrafish disease model. Mycobiology. 2017;45(4):297–311. Epub 2017/12/31. doi: 10.5941/MYCO.2017.45.4.297 . [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Straus DL, Mitchell AJ, Carter RR, Steeby JA. Optimizing copper sulfate treatments for fungus control on channel catfish eggs. Journal of Aquatic Animal Health. 2009;21(2):91–7. doi: 10.1577/H07-057.1 [DOI] [PubMed] [Google Scholar]
  • 10.Straus DL, Farmer BD, Ledbetter CK, Beck BH, Williams RS, Clark ML, et al. Use of copper sulfate to control egg saprolegniasis at a commercial sunshine bass hatchery. North American Journal of Aquaculture. 2016;78(3):243–50. doi: 10.1080/15222055.2016.1146183 [DOI] [Google Scholar]
  • 11.Thoen E, Evensen Ø, Skaar I. Factors influencing Saprolegnia spp. spore numbers in Norwegian salmon hatcheries. Journal of Fish Diseases. 2016;39(6):657–65. doi: 10.1111/jfd.12392 [DOI] [PubMed] [Google Scholar]
  • 12.Torto-Alalibo T, Tian M, Gajendran K, Waugh ME, van West P, Kamoun S. Expressed sequence tags from the oomycete fish pathogen Saprolegnia parasitica reveal putative virulence factors. BMC Microbiol. 2005;5:46-. doi: 10.1186/1471-2180-5-46 . [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.van den Berg AH, McLaggan D, Diéguez-Uribeondo J, van West P. The impact of the water moulds Saprolegnia diclina and Saprolegnia parasitica on natural ecosystems and the aquaculture industry. Fungal Biology Reviews. 2013;27(2):33–42. 10.1016/j.fbr.2013.05.001. [DOI] [Google Scholar]
  • 14.Phillips AJ, Anderson VL, Robertson EJ, Secombes CJ, van West P. New insights into animal pathogenic oomycetes. Trends in Microbiology. 2008;16(1):13–9. 10.1016/j.tim.2007.10.013 [DOI] [PubMed] [Google Scholar]
  • 15.Fregeneda-Grandes JM, Rodríguez-Cadenas F, Aller-Gancedo JM. Fungi isolated from cultured eggs, alevins and broodfish of brown trout in a hatchery affected by saprolegniosis. Journal of Fish Biology. 2007;71(2):510–8. doi: 10.1111/j.1095-8649.2007.01510.x [DOI] [Google Scholar]
  • 16.Sandoval-Sierra JV, Martín MP, Diéguez-Uribeondo J. Species identification in the genus Saprolegnia (Oomycetes): Defining DNA-based molecular operational taxonomic units. Fungal Biology. 2014;118(7):559–78. 10.1016/j.funbio.2013.10.005 [DOI] [PubMed] [Google Scholar]
  • 17.Karunasagar I, Karunasagar I, Otta SK. disease problems affecting fish in tropical environments. Journal of Applied Aquaculture. 2003;13(3–4):231–49. doi: 10.1300/J028v13n03_03 [DOI] [Google Scholar]
  • 18.Leung MH, Bryson K, Freystatter K, Pichon B, Edwards G, Charalambous BM, et al. Sequetyping: serotyping Streptococcus pneumoniae by a single PCR sequencing strategy. J Clin Microbiol. 2012;50(7):2419–27. Epub 2012/05/02. doi: 10.1128/JCM.06384-11 . [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Kralik P, Ricchi M. A Basic Guide to Real Time PCR in Microbial Diagnostics: Definitions, parameters, and everything. Front Microbiol. 2017;8:108-. doi: 10.3389/fmicb.2017.00108 . [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.de Souza Godoi PA, Piechnik CA, de Oliveira AC, Sfeir MZ, de Souza EM, Rogez H, et al. qPCR for the detection of foodborne Trypanosoma cruzi. Parasitology International. 2017;66(5):563–6. 10.1016/j.parint.2017.06.001 [DOI] [PubMed] [Google Scholar]
  • 21.Zitnick-Anderson K, Simons K, Pasche JS. Detection and qPCR quantification of seven Fusarium species associated with the root rot complex in field pea. Canadian Journal of Plant Pathology. 2018;40(2):261–71. doi: 10.1080/07060661.2018.1429494 [DOI] [Google Scholar]
  • 22.Bharucha T, Sengvilaipaseuth O, Vongsouvath M, Vongsouvath M, Davong V, Panyanouvong P, et al. Development of an improved RT-qPCR Assay for detection of Japanese encephalitis virus (JEV) RNA including a systematic review and comprehensive comparison with published methods. PloS one. 2018;13(3):e0194412–e. doi: 10.1371/journal.pone.0194412 . [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Ricchi M, Bertasio C, Boniotti MB, Vicari N, Russo S, Tilola M, et al. Comparison among the quantification of bacterial pathogens by qPCR, dPCR, and cultural methods. Front Microbiol. 2017;8:1174. Epub 2017/07/14. doi: 10.3389/fmicb.2017.01174 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Notomi T, Okayama H, Masubuchi H, Yonekawa T, Watanabe K, Amino N, et al. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 2000;28(12):E63–E. doi: 10.1093/nar/28.12.e63 . [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Seki M, Kilgore PE, Kim EJ, Ohnishi M, Hayakawa S, Kim DW. Loop-mediated isothermal amplification methods for diagnosis of bacterial meningitis. Front Pediatr. 2018;6:57-. doi: 10.3389/fped.2018.00057 . [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Niihara H, Kohno K, Tobita R, Ishikawa N, Morita E. Rapid diagnosis of herpes zoster by loop-mediated isothermal amplification in a pregnant woman showing folliculitis-like eruption without vesicles. The Journal of Dermatology. 2017;44(7):e174–e5. doi: 10.1111/1346-8138.13861 [DOI] [PubMed] [Google Scholar]
  • 27.Nakayama T, Yamazaki T, Yo A, Tone K, Mahdi Alshahni M, Fujisaki R, et al. Detection of fungi from an indoor environment using loop-mediated isothermal amplification (LAMP) method. Biocontrol Science. 2017;22(2):97–104. doi: 10.4265/bio.22.97 [DOI] [PubMed] [Google Scholar]
  • 28.Stueland S, Hatai K, Skaar I. Morphological and physiological characteristics of Saprolegnia spp. strains pathogenic to Atlantic salmon, Salmo salar L. Journal of Fish Diseases. 2005;28(8):445–53. doi: 10.1111/j.1365-2761.2005.00635.x [DOI] [PubMed] [Google Scholar]
  • 29.Wolf K, Quimby MC. 5 Fish cell and tissue culture. In: Hoar WS, Randall DJ, editors. Fish Physiology. 3: Academic Press; 1969. p. 253–305. [Google Scholar]
  • 30.Zelaya-Molina LX, Ortega MA, Dorrance AE. Easy and efficient protocol for oomycete DNA extraction suitable for population genetic analysis. Biotechnol Lett. 2011;33(4):715–20. Epub 2010/11/24. doi: 10.1007/s10529-010-0478-3 . [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Bakkeren G, Kronstad JW, Lévesque CA. Comparison of AFLP fingerprints and ITS sequences as phylogenetic markers in Ustilaginomycetes. Mycologia. 2000;92(3):510–21. doi: 10.1080/00275514.2000.12061187 [DOI] [Google Scholar]
  • 32.Bala K, Robideau GP, Désaulniers N, de Cock AWAM, Lévesque CA. Taxonomy, DNA barcoding and phylogeny of three new species of Pythium from Canada. Persoonia. 2010;25:22–31. Epub 2010/07/30. doi: 10.3767/003158510X524754 . [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Robideau GP, De Cock AWAM, Coffey MD, Voglmayr H, Brouwer H, Bala K, et al. DNA barcoding of oomycetes with cytochrome c oxidase subunit I and internal transcribed spacer. Molecular Ecology Resources. 2011;11(6):1002–11. doi: 10.1111/j.1755-0998.2011.03041.x [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. Basic local alignment search tool. Journal of Molecular Biology. 1990;215(3):403–10. 10.1016/S0022-2836(05)80360-2 [DOI] [PubMed] [Google Scholar]
  • 35.NCBI Resource Coordinators. Database resources of the National Center for Biotechnology Information. Nucleic Acids Res. 2016. Jan 4;44(D1):D7–19. doi: 10.1093/nar/gkv1290 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Basenko EY, Pulman JA, Shanmugasundram A, Harb OS, Crouch K, Starns D, et al. FungiDB: An integrated bioinformatic resource for fungi and oomycetes. J Fungi (Basel). 2018;4(1):39. doi: 10.3390/jof4010039 . [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Madeira F, Park Ym, Lee J, Buso N, Gur T, Madhusoodanan N, et al. The EMBL-EBI search and sequence analysis tools APIs in 2019. Nucleic Acids Res. 2019;47(W1):W636–W41. doi: 10.1093/nar/gkz268 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Kumar S, Stecher G, Tamura K. MEGA7: Molecular evolutionary genetics analysis Version 7.0 for Bigger Datasets. Molecular Biology and Evolution. 2016;33(7):1870–4. doi: 10.1093/molbev/msw054 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Tamura K, Nei M. Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. Molecular Biology and Evolution. 1993;10(3):512–26. doi: 10.1093/oxfordjournals.molbev.a040023 [DOI] [PubMed] [Google Scholar]
  • 40.Vaidya G, Lohman DJ, Meier R. SequenceMatrix: concatenation software for the fast assembly of multi-gene datasets with character set and codon information. Cladistics. 2011;27(2):171–80. doi: 10.1111/j.1096-0031.2010.00329.x [DOI] [PubMed] [Google Scholar]
  • 41.Rozen S, Skaletsky H. Primer3 on the WWW for general users and for biologist programmers. In: Misener S, Krawetz SA, editors. Bioinformatics Methods and Protocols. Totowa, NJ: Humana Press; 1999. p. 365–86. [DOI] [PubMed] [Google Scholar]
  • 42.Göker M, Voglmayr H, Riethmüller A, Oberwinkler F. How do obligate parasites evolve? A multi-gene phylogenetic analysis of downy mildews. Fungal Genetics and Biology. 2007;44(2):105–22. doi: 10.1016/j.fgb.2006.07.005 [DOI] [PubMed] [Google Scholar]
  • 43.Martin FN, Abad ZG, Balci Y, Ivors K. Identification and detection of Phytophthora: reviewing our progress, identifying our needs. Plant Disease. 2012;96(8):1080–103. doi: 10.1094/PDIS-12-11-1036-FE . [DOI] [PubMed] [Google Scholar]
  • 44.Richter M, Rosselló-Móra R. Shifting the genomic gold standard for the prokaryotic species definition. Proc Natl Acad Sci U S A. 2009;106(45):19126–31. Epub 2009/10/23. doi: 10.1073/pnas.0906412106 . [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Maddison WP, Knowles LL. Inferring phylogeny despite incomplete lineage sorting. Systematic Biology. 2006;55(1):21–30. doi: 10.1080/10635150500354928 [DOI] [PubMed] [Google Scholar]
  • 46.Redekar NR, Eberhart JL, Parke JL. Diversity of Phytophthora, Pythium, and Phytopythium Species in Recycled Irrigation Water in a Container Nursery. Phytobiomes Journal. 2019;3(1):31–45. doi: 10.1094/pbiomes-10-18-0043-r [DOI] [Google Scholar]
  • 47.Söderhäll K, Dick MW, Clark G, Fürst M, Constantinescu O. Isolation of Saprolegnia parasitica from the crayfish Astacus leptodactylus. Aquaculture. 1991;92:121–5. doi: 10.1016/0044-8486(91)90014-X [DOI] [Google Scholar]
  • 48.Fernández-Benéitez MJ, Ortiz-Santaliestra ME, Lizana M, Diéguez-Uribeondo J. Saprolegnia diclina: another species responsible for the emergent disease ‘Saprolegnia infections’ in amphibians. FEMS Microbiology Letters. 2008;279(1):23–9. doi: 10.1111/j.1574-6968.2007.01002.x [DOI] [PubMed] [Google Scholar]
  • 49.Nechwatal J, Wielgoss A, Mendgen K. Diversity, host, and habitat specificity of oomycete communities in declining reed stands (Phragmites australis) of a large freshwater lake. Mycological Research. 2008;112(6):689–96. doi: 10.1016/j.mycres.2007.11.015 [DOI] [PubMed] [Google Scholar]
  • 50.Sandoval-Sierra JV, Diéguez-Uribeondo J. A Comprehensive Protocol for Improving the Description of Saprolegniales (Oomycota): Two Practical Examples (Saprolegnia aenigmatica sp. nov. and Saprolegnia racemosa sp. nov.). PloS ONE. 2015;10(7):e0132999. doi: 10.1371/journal.pone.0132999 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Ali SE, Thoen E, Vrålstad T, Kristensen R, Evensen Ø, Skaar I. Development and reproduction of Saprolegnia species in biofilms. Veterinary Microbiology. 2013;163(1):133–41. doi: 10.1016/j.vetmic.2012.12.012 [DOI] [PubMed] [Google Scholar]
  • 52.Kong X, Qin W, Huang X, Kong F, Schoen CD, Feng J, et al. Development and application of loop-mediated isothermal amplification (LAMP) for detection of Plasmopara viticola. Scientific reports. 2016;6:28935-. doi: 10.1038/srep28935 . [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Dai T-T, Lu C-C, Lu J, Dong S, Ye W, Wang Y, et al. Development of a loop-mediated isothermal amplification assay for detection of Phytophthora sojae. FEMS Microbiology Letters. 2012;334(1):27–34. doi: 10.1111/j.1574-6968.2012.02619.x [DOI] [PubMed] [Google Scholar]
  • 54.Feng W, Hieno A, Kusunoki M, Suga H, Kageyama K. LAMP Detection of four plant-pathogenic oomycetes and its application in lettuce fields. Plant Disease. 2019;103(2):298–307. doi: 10.1094/PDIS-05-18-0858-RE . [DOI] [PubMed] [Google Scholar]
  • 55.Best N, Rawlin G, Suter R, Rodoni B, Beddoe T. Optimization of a loop-mediated isothermal amplification (LAMP) assay for in-field detection of Dichelobacter nodosus with aprV2 (VDN LAMP) in Victorian sheep flocks. Frontiers in Veterinary Science. 2019;6(67). doi: 10.3389/fvets.2019.00067 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Naik P, Jaitpal S, Shetty P, Paul D. An integrated one-step assay combining thermal lysis and loop-mediated isothermal DNA amplification (LAMP) in 30 min from E. coli and M. smegmatis cells on a paper substrate. bioRxiv. 2019:594374. doi: 10.1101/594374 [DOI] [Google Scholar]
  • 57.Zhang J, Cao J, Zhu M, Xu M, Shi F. Loop-mediated isothermal amplification-lateral-flow dipstick (LAMP-LFD) to detect Mycoplasma ovipneumoniae. World J Microbiol Biotechnol. 2019;35(2):31-. doi: 10.1007/s11274-019-2601-5 . [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Zhang H, Zeng L, Fan Y, Zhou Y, Xu J, Ma J. A loop-mediated isothermal amplification assay for rapid detection of cyprinid herpesvirus 2 in Gibel carp (Carassius auratus gibelio). ScientificWorld Journal. 2014;2014:716413-. doi: 10.1155/2014/716413 . [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Parida M, Shukla J, Sharma S, Ranghia Santhosh S, Ravi V, Mani R, et al. Development and evaluation of reverse transcription loop-mediated isothermal amplification assay for rapid and real-time detection of the swine-origin influenza A H1N1 virus. J Mol Diagn. 2011;13(1):100–7. Epub 2011/01/14. doi: 10.1016/j.jmoldx.2010.11.003 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Dolka B, Cisek AA, Szeleszczuk P. The application of the loop-mediated isothermal amplification (LAMP) method for diagnosing Enterococcus hirae-associated endocarditis outbreaks in chickens. BMC Microbiol. 2019;19(1):48-. doi: 10.1186/s12866-019-1420-z . [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Hardinge P, Murray JAH. Reduced false positives and improved reporting of loop-mediated isothermal amplification using quenched fluorescent primers. Scientific Reports. 2019;9(1):7400. doi: 10.1038/s41598-019-43817-z [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Cai S-X, Kong F-D, Xu S-F, Yao C-L. Real-time loop-mediated isothermal amplification for rapid detection of Enterocytozoon hepatopenaei. PeerJ. 2018;6:e5993–e. doi: 10.7717/peerj.5993 . [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63.Cao Y, Wang L, Duan L, Li J, Ma J, Xie S, et al. Development of a real-time fluorescence loop-mediated isothermal amplification assay for rapid and quantitative detection of Ustilago maydis. Scientific reports. 2017;7(1):13394-. doi: 10.1038/s41598-017-13881-4 . [DOI] [PMC free article] [PubMed] [Google Scholar]

Decision Letter 0

Hideyuki Doi

6 Aug 2021

PONE-D-21-11810

Development and comparison of Loop-Mediated Isothermal Amplification with Quantitative PCR for the specific detection of Saprolegnia spp.

PLOS ONE

Dear Dr. Phuntumart,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

==============================

I got the recommendations and comments from an expert reviewer on the field. The both reviewer agree that the manuscript is technically sound and the data support the conclusions.However, lack of the real time data, such as no of technical and biological replicates..That is only one one reservation and I totally share their comments. Therefore, I can invite you to submit a revised version of the manuscript that addresses the major point raised by the reviewers.

==============================

Please submit your revised manuscript by Sep 20 2021 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

  • A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

  • A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

  • An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Hideyuki Doi

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. Thank you for stating the following in the Acknowledgments Section of your manuscript:

“This research was funded by Ohio Sea Grant (10000960) and Bowling Green State University.  We thank Gayathri Beligala for her contribution to the experiments. “

We note that you have provided additional information within the Acknowledgements Section that is not currently declared in your Funding Statement. Please note that funding information should not appear in the Acknowledgments section or other areas of your manuscript. We will only publish funding information present in the Funding Statement section of the online submission form.

Please remove any funding-related text from the manuscript and let us know how you would like to update your Funding Statement. Currently, your Funding Statement reads as follows:

“SG-Ohio Sea Grant (10000960), https://ohioseagrant.osu.edu/

VP-Ohio Sea Grant (10000960),

https://ohioseagrant.osu.edu/

The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.”

Please include your amended statements within your cover letter; we will change the online submission form on your behalf.

Additional Editor Comments (if provided):

I got the recommendations and comments from an expert reviewer on the field. The both reviewer agree that the manuscript is technically sound and the data support the conclusions.However, lack of the real time data, such as no of technical and biological replicates..That is only one one reservation and I totally share their comments. Therefore, I can invite you to submit a revised version of the manuscript that addresses the major point raised by the reviewers.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: N/A

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: The work is indeed important for all aquaculture pathogen surveliance projects.

Good work..Indeed a good manuscipt to be publsihed.

the real time data maybe should be made more clearer, such as no of technical and biological replicates..That is only one one reservation

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: Yes: Subha Bhassu

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

PLoS One. 2021 Dec 13;16(12):e0250808. doi: 10.1371/journal.pone.0250808.r002

Author response to Decision Letter 0


3 Nov 2021

We thank the reviewers for their helpful comments and supportive message.

Regarding technical and biological replications in our qPCR experiment, we followed the guiding principles from Blainey, P., Krzywinski, M. & Altman, N. Replication. Nat Methods 11, 879–880 (2014). https://doi.org/10.1038/nmeth.309

We agree with the reviewers that having both technical and biological replication is of a great value. In our case, the qPCR data of Saprolegnia salmonis was relevant to assess the robustness and to quantify other Saprolegnia spp. isolates for future experiments. Additionally, Saprolegnia salmonis has been used as our major biological sample in optimization of the reactions. It was later used as a positive control in all our experiments. We hope you agree that data in Table 3 represents both technical and biological replicates for our experiments. We added this information in each of our experiments where appropriated. Thank you.

Attachment

Submitted filename: Response to Reviewers.docx

Decision Letter 1

Hideyuki Doi

8 Nov 2021

Development and comparison of Loop-Mediated Isothermal Amplification with Quantitative PCR for the specific detection of Saprolegnia spp.

PONE-D-21-11810R1

Dear Dr. Phuntumart,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Hideyuki Doi

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

I carefully checked the revised manuscript as well as the response letter. I agree the revisions according to the reviewers’ comments and now can recommend to publish the paper in this journal.

Reviewers' comments:

Acceptance letter

Hideyuki Doi

3 Dec 2021

PONE-D-21-11810R1

­­­­­­­­Development and comparison of loop-mediated isothermal amplification with quantitative PCR for the specific detection of Saprolegnia spp.

Dear Dr. Phuntumart:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Hideyuki Doi

Academic Editor

PLOS ONE

Associated Data

    This section collects any data citations, data availability statements, or supplementary materials included in this article.

    Supplementary Materials

    Attachment

    Submitted filename: Response to Reviewers.docx

    Data Availability Statement

    All DNA sequences are available from the NCBI database: BankIt2510419 N9 OK872234 BankIt2510427 S.salmonis OK872235 BankIt2510436 F1 OK872236 BankIt2510443 F2 OK872237 BankIt2510448 JMM_Shad_3 OK872238 BankIt2510453 1B OK872239 BankIt2510454 6A OK872240 BankIt2510456 11A OK872241 BankIt2510457 RAS_1 OK872242 BankIt2510459 RAS_2 OK872243 BankIt2510461 RAS_3 OK872244 BankIt2510463 RAS_4 OK872245 BankIt2510466 RAS_5 OK872246 BankIt2511910 N3 OK872247 BankIt2510450 JMM_Shad_72 OK872248.


    Articles from PLoS ONE are provided here courtesy of PLOS

    RESOURCES