Assembly of Long Adapter Single Strands Oligonucleotide (LASSO) probes for massive parallel capture of kilobase size DNA targets

Abstract

Genome DNA sequencing has become an affordable commodity to resolve the genetic background of life. However, the biologic functions of DNA encoded sequences are still relatively unknown. A highly scalable and cost-effective cloning method for selecting natural DNA targets from genomic templates is, therefore, of urgent need to rapidly understand biological products of genomes.

LASSO probes are long ssDNA oligonucleotides that are designed with a universal adapter that is linked between two sequences that are complementary to a genomic target of interest. Through a pooled assembly method, LASSOs can be made for multiplex DNA capture. Herein, we describe a robust and efficient method for the assembly of LASSO probes libraries using a Cre-recombinase-mediated reaction as well as a protocol for multiplex genome target capture. The starting components are a pre-LASSO probe library that are short DNA oligo pools designed in silico and an E. coli plasmid (pLASSO) that incorporates the pre-LASSO library. Through internal recombination of pLASSO with its inserts, a mature LASSO library in final configuration can be made with high purity. Assembly of a LASSO probe library takes four days and target capture can be performed in a single day. With an exponentially growing list of new genomes, this method can enable the rapid production of ORFeome libraries for high-throughput screening to identify biological functions as a complimentary approach to understand genome functional biology.

Graphical Abstract

INTRODUCTION

In the present “post-genome era” the extensive availability of entire genome sequences for human and thousands other organisms can now help answer questions about DNA functions at the level of genes, RNA, and protein, bringing about a paradigm shift in the approach to genetics, healthcare, and drug discovery. To date, genome-wide functional screenings have been successfully performed by using CRISPR-Cas9 gene editing technology coupled with pooled libraries of single guide RNAs (sgRNAs), in systematic “loss-of-function” studies in Human (Shalem, O. et al 2014, Hsu, P. D et al 2014, Gasperini et al., 2019), plants and yeasts (Bao, Z. et al, 2018). Although CRISPR-Cas9 gene editing in bacteria is successful for some model strains, it remains limited and ineffective in most bacterial species (Vento JM, et al. 2019). Moreover, massive parallel screening approaches based on functional cloning by which a cDNA library obtained from a certain organism may be cloned and screened for function in a different cell line are still limited by the availability of cDNA or ORFeome libraries especially for non-model organisms and a myriad of industrially important bacterial strains. In this regard, genome-wide preparation of clones for production of proteins in either a native or a fusion form, which are conventionally called ORFeome clones, would play a crucial role in realizing an integrative genomics goal of large scale protein function discovery (Barsch et al., 2004). In recent advances protein-protein interaction studies like ribosome display, phage display, yeast display, bacterial display, and mRNA display are being scaled up and their throughput increased to encompass whole-cell proteomic analyses (Oikonomou et al., 2020 Mohan et al. 2018). The up scaling of such techniques require the availability of ORFeome or cDNA libraries (Zhu et al., 2013). There remains an unmet need for methods that enable the rapid and inexpensive cloning of target genetic elements in a massive parallel manner.

Long Adapter Single-Stranded Oligonucleotide (LASSO) probes were developed to capture long stretches of DNA for use in ORFeome library preparation subsequent to high-throughput expression screening (Shukor et al., 2019, Liu et al., 2019, Tosi et al., 2017). LASSO probes are long single stranded DNA sequences that have arms at each ends that are complementary to beginning and the end of various targets of interest. These targets are captured by gap filling with a polymerase and circularized with a ligase. Differently from PCR where each target needs to be amplified separately to prevent aspecific primer – template and primer – primer interaction, LASSO probes allow highly multiplexed amplification of thousands of kilobase sized DNA targets in the same reaction volume. In this protocol, we describe the production of a large cloned E. coli ORFeome library by using LASSO probe capturing technology. In a recent work, we assessed the performance of the LASSO probes capture by analyzing the NGS data resulting from the capture of an E.coli orfeome and observed that the targeted ORFs were enriched at least 30 times in comparison with untargeted ORFs (Tosi et al., 2021).

In this protocol, we describe the assembly of a LASSO probe library starting from the custom plasmid pLASSO and a pre-LASSO probe ssDNA oligo pool. Then, we describe how to use the LASSO probe library for massive parallel capture of kilobase size genomic regions. Last, we shuttled these captured genomic regions into pDONR221 vectors. The same approach can thus be used to make ORFeome libraries from different prokaryotic and eukaryotic organisms. Because the ORFeome library captured through LASSO probes maintain their original start, stop codons of ORFs and their reading frames, they can be used for functional biomedical screening applications. By modifying the design of LASSO probes, we can also target different protein domains, promoters, enhancers, lncRNAs, and untranslated regions of mRNAs, in parallel to be used in high throughput studies of gene expression.

STRATEGIC PLANNING

Most steps involved in this protocol can be easily performed by a researcher with a thorough knowledge in molecular biology. Before the start of the protocol the precursors of the mature LASSO probes: that are the pLASSO plasmid and the preLASSO probes have to be prepared. The pLASSO have to be obtained according to the protocol described in SUPPORT PROTOCOL 1 and the pre-LASSO need to be designed according to the section below “The pre-LASSO probe design”, bought and prepared as described in SUPPORT PROTOCOL 2. The pre-LASSO probe or a very large pool of pre-LASSO probes can combine with pLASSO and be converted to mature ssDNA LASSO probes by using a multistep process subject of this protocol.

At the end of the assembly process subject of this protocol, we obtain mature LASSO probes that are 600bp single stranded DNA that contain the ligation and extension arms linked by the backbone from the pLASSO vector.

pLASSO is a ~ 3.3 kb E.coli plasmid (Fig.1) that can be produced “in house” starting from the LoxP2+ linear plasmid available from NEB (New England Biolabs) and the Backbone that is a synthetic DNA fragment (NEB gBlock).

Figure 1.

LASSO probe precursors and mature LASSO probe. Shown are schematics of the pre-LASSO probe, pLASSO vector, and mature ssDNA LASSO probe structures. The primer annealing sites in the pre-LASSO probe are identical to sequences a and b in the pLASSO vector and are introduced into pLASSO during PCR linearization with Selector primers. The loxP sites in pLASSO are required for Cre recombination. SalI and BamHI, restriction enzyme sites; Nt.BbvCI, nicking endonuclease site; AmpR, ampicillin-resistance gene.

The pre-LASSO probe design

The pre-LASSO probe Fig.1 is a ~160–180 bp synthetic oligonucleotide and is composed by six different parts: primer-annealing site, ligation arm, conserved region, extension arm, primer-annealing site. The ligation and extension arms of the pre-LASSO probes represent the arms of the mature LASSO probe and are designed with the same 5’−3’ orientation of the sequence of the target DNA. For example, if 5’ATGCCAnnnnnnnTGATTGnnnnnn 3’ is the sequence of a specific ORF we would like to capture from the start (ATG) to the stop (TGA) codon, the ligation arm and the extension arms should start by 5’ ATGCCAnnn and 5’TGATTGnnnnnn respectively and they are prolonged until the desired melting temperatures are reached with the following stringent considerations: (1) the ligation arms terminate in correspondence of a C or G residue; (2) the Tm of the extension arms range 60°C– 70°C, with 65°C being optimal; the Tm of the ligation arms range 65°C–75°C, with 70°C being optimal; the length of the extension and the ligation are limited according to the maximum length of the oligo pool supplier. To design a large number of pre-LASSO probes we developed a pre-LASSO probe arm design algorithm for E. coli ORF capture (supplementary files) which generates thousands of pre-LASSO probe sequences based on the E. coli genomic sequence. We specifically designed this algorithm for targeting the ORFeome of E. coli and would therefore need to be modified if more complex genomes were to be used as template.

The workflow is organized into seven different steps (Fig. 2): a. the design of pre-LASSO probes by processing the genomic or metagenomics DNA sequences of interest through the algorithm, b. The third-party manufacture of the pre-LASSO probe library that is a synthetic ssDNA short oligo pool (~160bp), c. The assembly of the mature LASSO probe library. This process starts with the cloning of the pre-LASSO library into pLASSO vector. d. The cloned pre-LASSO library undergoes internal DNA recombination by using two loxP sites located in pLASSO. The resulting DNA minicircles contain the arms of the pre-LASSO library that are now connected with a DNA backbone. The remaining of pLASSO are selectively destroyed. e. The library in DNA minicircles is subjected to inverse PCR so that the annealing arms are made to flank the backbone sequence in the final configuration. The external primer sites are next removed and the final single stranded DNA (ssDNA) LASSO probe library is produced by exonuclease digestion, f. The mature LASSO library is used for massively parallel DNA target capture by 5’−3’ gap filling after annealing to target sequences that flank the desired DNA fragments, g. The massively parallel capture of kilobase-sized fragments can now be used for downstream sequencing or expression experiments.

Figure 2.

Overall LASSO workflow. (A) Design of pre-LASSO probes. (B) Third-party manufacture of the pre-LASSO probe library by oligonucleotide synthesis. (C) LASSO probe library cloning and transformation in E. coli. (D) Recombination of E. coli cloned library. (E) Maturation. (F) The mature LASSO library is used for massively parallel DNA target capture. (G) The massively parallel capture of kilobase-sized fragments can now be used for NGS sequencing or downstream expression experiments.

As opposed to a conventional, “one-by-one” PCR-based approach to construct ORFeomes or DNA library collections, our LASSO capture approach produces pooled DNA target libraries. If the scope of the capture is not limited to the NGS analysis of the targets, but includes downstream functional analysis of the captured targets, an appropriate highly multiple phenotypic screening strategy needs to be taken into consideration.

BASIC PROTOCOL 1: LASSO probe assembly

This protocol describes the assembly of a LASSO probe library starting with the cloning of a pre-LASSO library into pLASSO vector, DNA recombination, inverse PCR, single stranded DNA (ssDNA) LASSO probe library production

Cloning

For cloning, the linearized pLASSO from SUPPORT PROTOCOL 1, is mixed with the pre-LASSO library and NEBbuilder (NEB) enzyme mix is added to it. The pre-LASSO probes annealing sites link with the selector sequences of the linear pLASSO generating a circular pLASSO vector containing the pre-LASSO probe (Fig. 3). The NEBuilder assembly solution is used directly for E. coli transformation.

Figure 3.

Cloning of the pre-LASSO library into pLASSO vector. The native supercoiled plasmids obtained by colony miniprep are converted in the relaxed form by nicking with endonuclease Nt.BspQI (BspQI), which uses a recognition site located in the primer annealing site of the inserted pre-LASSO probe. Cre recombination of the loxP sites produces a DNA minicircle containing the pre-LASSO and a circular 2.7-kb DNA circle, the remaining portion of pLASSO. After recombination, the 2.7-kb DNA circle, together with the unreacted plasmids and larger DNA circles generated by inter-plasmid recombination (not shown in the drawing), are eliminated by restriction followed by exonuclease digestion.

The pLASSO library is obtained by scraping the E. coli colonies from selective agar plates and extracting it through plasmid miniprep. The presence of the pre-LASSO probes in pLASSO can be verified by performing BamHI and SalI double digestion and running an agarose gel electrophoresis as shown in the protocol section of this manuscript.

Nicking

The pLASSO library is then subjected to a nicking endonuclease digestion that cleaves one of the DNA strands by using a recognition site located in the backbone region. We found that the relaxed form of the pLASSO library is a better substrate for the subsequent DNA recombination than not the native supercoiled form.

Recombination

Upon the addition of Cre-recombinase, the loxP sites in pLASSO recombine, the reaction reaches an equilibrium where DNA minicircles containing the pre-LASSO, the remaining part of pLASSO, the unreacted pLASSO library and concatemers generated by inter-plasmid recombination are simultaneously present. The minicircles containing single pre-LASSO probes are purified from the other species by selective cutting and exonuclease digestion (Fig. 3).

Maturation

Finally, the minicircles are subjected to inverse PCR so that the annealing arms are made to flank the backbone sequence in the final configuration. One of the primers used for reverse PCR contains two special moieties: a 3’ uracil residue and a final 5’ nnn bonds to prevent subsequent exonuclease treatment and a 3’-terminal uracil base for subsequent primer removal using Uracil-DNA Glycosylase (USER enzyme). The other primer include a BspQI site for primer removal via BspQI enzyme digestion. The LASSO probe is now at the final maturation stage and ready to be used for the capture.

Materials:

• 5-alpha chemically competent E. coli cells (New England BioLabs, cat. no. C2987I)

• pLASSO plasmid (see how to generate it in the SUPPORT PROTOCOL 1)

• pre-LASSO library (Twist Bioscience; see Table 1 for the design of the pre-LASSO probes and see supplementary files for the list of E. coli ORFs pre LASSO probes)

• pre-LASSO M13 (the positive control for capture experiments; find the DNA sequence in Table 1)

• KAPA HiFi HotStart PCR Kit (Catalog #KK2502)

• Omni Klentaq LA (DNA Polymerase Technology cat. 350)

• Recombinant Bacteriophage P1 Cre recombinase protein (ABCAM cat. no. ab134845)

• Deoxynucleotide (dNTPs) solution Mix (New England BioLabs, cat. no. M0210S)

• CutSmart buffer (B7204S)

• Cre Recombinase Reaction Buffer (New England BioLabs, cat. no. M0298S NEB, only available with Cre recombinase)

• SalI (New England BioLabs, cat. no. R0138S)

• BamHI (New England BioLabs, cat. no. R0136S)

• SwaI (New England BioLabs, cat. no. R0604)

• BspQI (New England BioLabs, cat. no. R0712S)

• Nt.BbvCI nicking endonuclease (New England BioLabs, cat. no. R0632S)

• Lambda Exonuclease (New England BioLabs, cat. no. M0262S)

• Exonuclease V (RecBCD) (New England BioLabs, cat. no. M0345S)

• USER enzyme (New England BioLabs, cat. no. M5505S)

• Adenosine 5’-Triphosphate (ATP) 10mM (New England BioLabs, cat. no. P0756S)

• UltraPure Ethidium Bromide, 10 mg/mL (Thermo Fischer Scientific, cat. no. 15585011)

• SOC outgrowth medium (New England BioLabs, cat. no. B9020S)

• PureLink Quick Plasmid Miniprep Kit (thermos Scientific, cat. no. K210010)

• Difco, LB Broth Miller (Luria-Bertani), 500 g (Sigma Aldrich L3522)

• M13mp18 Single-stranded DNA (New England BioLabs, cat. no. N4040S)

• Low molecular weight DNA ladder (New England BioLabs, cat. no. N3233S)

• Quick load Purple 1Kb Plus DNA ladder (New England BioLabs, cat. no. N0550S)

• TAE (Tris-acetate-EDTA) buffer 10X (Thermofisher, cat no 15558042)

• Agarose (Invitrogen, cat no 16500500)

• Ethanol

• Pipettes (Eppendorf, cat no. 2231302001)

• Tips for pipettes (Eppendorf cat no 022491873)

• Eppendorf Flex-Tube 1.5-mL microcentrifuge tubes (Eppendorf, cat. no. 022364111)

• Accuris myGel™ Mini Agarose Gel Electrophoresis Apparatus (Accuris Instruments, cat. no. E1101)

• Accuris UV Transilluminator (Accuris Instruments, cat. no. E3000) !CAUTION Always wear UV-light-protective safety glasses/face shield.

• Accuris SmartDoc 2.0 Imaging Enclosure (Accuris Instruments, cat. no. E5001-SD)

• SmartDoc band pass filter, 590nm, for imaging EtBR on UV

• Petri dishes (polystyrene, sterile; Corning, BP94A-01)

• Falcon centrifuge tubes (polypropylene, sterile cat no 352095)

• Thermal cycler T100 (Bio-Rad, cat no 1861096)

• Shaker (Innova 44/44R; New Brunswick, cat. no. M1282–0000)

• NanoDrop 2000c spectrophotometer (Thermo Fisher, cat. no. ND-2000)

• Bench-top centrifuge (Beckman Coulter, cat. no. B30134)

• Centrifuge (Beckman Coulter, cat. no. A99465)

• PCR tube strips (VWR, cat no 53509–304)

Table 1:

Oligonucleotide List for BASIC PROTOCOL 1

Name	Sequence 5’–3’
Sap1F	GGTTTTCGATCAGAAGTGTU
ThiolR	A*T*C*GCCGCCCTGGCTCA

^*indicates phosphorothioate bonds

Protocol:

Cloning in pLASSO

• 1Start by thawing on ice with the pre LASSO library (from Twist Bioscience or other DNA oligo pool suppliers) pre-amplified as described in SUPPORT PROTOCOL.2 and pLASSO obtained as described in SUPPORT PROTOCOL.1

In parallel with the assembly of your LASSO library(s) remember to perform, in a separate tube, the assembly LASSO M13 starting from pre-LASSOM13 (Table 1) and pLASSO linearized with NEB1F and NEB1R primers (Table 1). LASSO M13 will be used as positive control for subsequent capture experiments and need to be assembled only one time. If pre-LASSO M13 is purchased as a dsDNA oligo (Gblock, IDT) it does not need to be pre-amplified, thus start the assembly directly from the cloning at step 2 below

• 2For each pre-LASSO library set up a PCR with the following NebBuilder assembly reaction. Remember to include a separate tube for the pre-LASSO M13. Assemble the reaction on ice according to the table 2 below.
• 3Incubate in a PCR thermal cycler at 50°C for 30 minutes.Following incubation, store samples at −20°C for subsequent transformation

Table 2:

Neb Builder reaction components

COMPONENT	Amount	Final (concentration/ amount)
Linearized pLASSO	~50 ng	2.5 ng/μL
Pre-LASSO library (pre-LASSO M13)	~16ng	0.8 ng/μL
NEBuilderHiFi DNA Assembly Master Mix 2X	10 μL	1X
PCR grade water	Fill to 20 μL

E.coli Transformation

• 4Prepare large LB agar plates with Ampicillin (optimally by dispensing 40ml of LAB agar 100µg/ml ampicillin). Once the agar is solid incubate at 37 °C.
• 5Thaw 5-alpha competent E. coli cells on Ice. Transfer 50 μL of chemically competent cells to a pre-chilled microcentrifuge tube. Add 1μL of the assembly product above to the chemically competent cells, flick the tube. Place the mixture on ice for 30 minutes. Do not mix. Heat shock at exactly 42°C for exactly 30 seconds. Do not mix. Place on ice for 5 minutes. Add 950μL of room-temperature SOC media to the tube immediately after the heat shock. Place the tube at 37°C for 60 minutes while shaking vigorously (250 rpm) or rotating.

Include a pUC19 NEB positive control for transformation (provided with chemically competent cells).

• 6Plate aliquots of 500μL of the SOC medium containing transformed E. coli cells unto pre-warmed petri dishes and incubate overnight at 37°C. Use 100μL volume to make 1/10 and 1/100 serial dilutions in fresh SOC medium and plate the 1/10 and 1/100 in smaller petri dishes and Incubate overnight at 37°C
• 7The next day estimate the number of colonies in the petri dishes by counting the E. coli colonies in the dilution plates.
• 8Harvest the E. coli colonies from agar plates by spreading ~10 ml of sterile water on selection agar plates, scrape colonies by using a glass or a plastic spreader. Collect the water plus E. coli solution using a 10ml pipet and dispense the same library in a single 50ml Corning tube.
• 9Pellet the E. coli cells by centrifugation, discard the supernatant and resuspend the cells in Resuspension Buffer R3 (PureLink quick Plasmid Miniprep Kit) by using 250µl of R3 Buffer for every 5ml of the E. coli solution. Dispense the resuspended cells in 300 µl aliquots in 1.5ml Eppendorf tubes. Then follow the lysis protocol as described by the Invitrogen PureLink quick Plasmid Miniprep Kit.
• 10Quantify the concentration of the eluted library at the Nanodrop.
• 11(Optional) Verify successful cloning of the pre-LASSO pool into pLASSO by setting up the following double digestion in 25µl of 1X cut Smart Buffer using 500ng of the recovered pLASSO library, 1 µl of SalI and 1 µl BamHI (details in the table 3 below). Digest for 1h at 37°C. Perform gel electrophoresis by loading 4μL of the digested library in a 2% agarose gel. If the cloning of the pre-LASSO library was successful, a DNA band correspondent with the size of the pre-LASSO library (~160bp) should be present in the lane as shown in figure 4.

Table 3:

Components for the pLASSO digestion

Component	Amount	Final (concentration/ amount)
pLASSO cloned library	500 ng	2.5 ng/μL
CutSmart Buffer	2.5 μL	1X
SalI restriction enzyme	20 units	0.8 units/µl
BamHI restriction enzyme	20 units	0.8 units/µl
Nuclease free water		Fill to 25 μL

Figure 4.

Sample gel showing the successful cloning of the pre-LASSO pool into pLASSO, in lane 1, corresponding to an ~160-bp band. Lane L1, Quick-Load Purple 1 kb Plus DNA ladder; lane L2, low-molecular-weight DNA ladder. (Basic Protocol 1).

Nicking

• 12Perform nicking endonuclease digestion of the pLASSO library by setting up in a PCR tube the reaction according to the table 4 below

Table 4:

Components for the pLASSO nicking reaction

COMPONENT	AMOUNT	FINAL CONCENTRATION
pLASSO library	2µg	40 ng/μL
CutSmart Buffer	5μL	1X
Nt.BbvCI (10units/μL)	1μL	0.4 U/µl
Nuclease free water	Fill to 50 µl

Gently mix the reaction components by pipetting and incubate at 37°C for 1h and heat inactivate 10 min at 80°C. At this point, the samples can be stored at − 20°C for long-term storage.

Cre recombination and purification of DNA minicircles

• 13Perform the Cre recombination of the nicked pLASSO library following the experimental setup in table 5 below. Assemble the reaction on ice and add the Cre Recombinase last.
• 14Gently mix the reaction by pipetting and incubate at 37°C for 30min
• 15Heat-inactivate at 70°C for 10min
• 16Add 1µl of SwaI directly to the 50µl Cre-Recombinase reactions in step 15
• 17Gently mix the reaction by pipetting and incubate at 25°C for 1h.
• 18Heat-inactivate at 70°C for 10min
• 19Cool the reaction on ice
• 20Add 2µl ATP 10mM and 1µl di Exonuclease V
• 21Gently mix the reaction by pipetting up and down and incubate at 37°C for 30min
• 22Heat-inactivate at 70°C for 30min after which the reaction tube can be stored at − 20°C for long-term storage

Table 5:

Components for the pLASSO Cre-recombination reaction

COMPONENT	AMOUNT	FINAL CONCENTRATION
pLASSO library in step 12	250 ng (6.25 µl)	5 ng/μL
Cre Recombinase Buffer (NEB)	5 µl	1X
Cre Recombinase (ABCAM) (0.5mg/ml)	1 µl	0.01 µg/µl
Nuclease free water	Fill to 50 µl

INVERTED PCR

• 23Use 10 µl of the solution in step 22 as template for the following PCR reaction (see Table 6 & 7)
• 24Verify successful inverted PCR (optional) on a 1% EtBr agarose gel (in 1X TBE); see figure 5.
• 25Take the AMPure magnetic beads out of the fridge and leave at room temperature for 30min. Vortex before use.
• 26Add 1.8X beads (83μL of beads for the remaining 46 μL of inverted PCR reaction) to the sample in step 23 and gently mix by pipetting 10 times
• 27Incubate the sample with the beads at room temperature for 5 min.
• 28Condense the beads into a pellet with the magnet for 3–5 min.
• 29Remove and discard the supernatant without disturbing the beads, leaving ~3 μL behind at the bottom of the tube. Keep the beads pelleted until the elution step; do not disturb the pellet.
• 30Pipette 200 μL of 80% (vol/vol) ethanol without disturbing the beads, and keep them pelleted. Prepare fresh 80% (vol/vol) ethanol.
• 31Leave the ethanol on the beads for 30 sec; then remove and discard the ethanol.
• 32Repeat the wash (steps 30 and 31 for a total of two ethanol washes).
• 33Remove as much of the ethanol as possible. Be mindful of small ethanol droplets.
• 34Air-dry the pellet for ~2 min. We recommend not exceed 2.5 min in dry time which will lead to over drying.
• 35Add 25 μL of nuclease-free water to the sample and then pipet 15 times to mix. Repeat the mixing to ensure better recovery.
• 36Incubate at room temperature for 5 min.
• 37Condense beads into a pellet with the magnet for 3–5 min.
• 38Collect the supernatant into a new tube
• 39Quantify the concentration of the purified PCR product using a Nanodrop (expected yield from 5 to 50 ng/ μL) At this step the purified inverted PCR product can be stored at −20°C for up to 1 year.
• 40We recommend performing Next Generation Sequencing of the purified inverted PCR product to validate the purity and identity of the pre-LASSO and the correct assembly of the LASSO probes. We used NEBNext Ultra DNA Library Prep Kit required the fragmentation and ligation of the fragments with primer adapters for Illumina but you may use other compatible kits.

Table 6:

Components for the Inverted PCR reaction

COMPONENT	FINAL CONCENTRATION	PER 50 μL REACTION
DNA solution at step 22	-	10 μL
10 mM each dNTP Mix	0.3 mM each dNTP	1 μL
10 μM TiolForward Primer	0.3 μM	1.5 μL
10 μM SapI Reverse primer	0.3 μM	1.5 μL
KAPA HiFi HotStart DNA Polymerase (1 unit/μL)	0.04 units/μL	1 μL
5x KAPA HiFi Fidelity Buffer	1x	10 μL
PCR grade water		25 μL

Table 7:

PCR cycling conditions for the Inverted PCR reaction

CYCLING STEP	TEMPERATURE		DURATION
1	Initialization Denaturation	3 min at 95°C	1x
2	Denaturation	20 sec at 98°C	25 Cycles
3	Annealing	15 sec at 60 °C
4	Extension	1 min at 72°C
5	Final Extension	3 min at 72°C	1x

Figure 5.

Sample gel showing the inverted PCR product in lane 1 corresponding to an ~550-bp band. Lane L, Quick-Load Purple 1 kb Plus DNA ladder. (Basic Protocol 1).

Maturation

• 41Pipet the equivalent of 400 ng of purified PCR product in step 38 and add to it: 5 μL of CutSmart Buffer, 1 μL of BspQI Restriction enzyme and make up to 50 μL in volume of water
• 42Gently mix by pipetting and incubate at 50 °C for 1h
• 43Heat-inactivate for 20 min at 80 °C
• 44Add 1 μL of Lambda Exonuclease
• 45Gently mix by pipetting and incubate at 37 °C for 30 min
• 46Heat-inactivate for 10 min at 80 °C
• 47Add 1 μL of USER enzyme
• 48Gently mix by pipetting and incubate at 37 °C for 30 min
• 49Store the mature LASSO probe library and the mature LASSO M13 probe that will be used as positive control for capture experiments at − 20°C. At this step the mature LASSOs can be stored at −20°C for up to 1 year.

SUPPORT PROTOCOL 1: pLASSO vector generation

pLASSO plasmid is a critical reagent in the development of mature LASSO probes and is needed for the first step of BASIC PROTOCOL 1. This protocol takes around 3 days of preparation. The role of the pLASSO plasmid is to supply the backbone (sequence available in Table 2) for the mature LASSO probes and a number of functional sites required for the assembly (Fig. 1). In particular, pLASSO contains two LoxP sites (purple triangles) for the Cre-recombination, a selector primer annealing site. At the end of the SUPPORT PROTOCOL 1 pLASSOs have to be linearized by using tailed selector primers (Table 2) that attaches 20bp regions matching with the sequence of the primer annealing sites of the pre-LASSO probe library of choice (Fig. 1). In pLASSO there is also an ampicillin-resistance gene for E. coli colony selection.

Additional Materials (also see Basic Protocol 1)

• SYBR® Green I nucleic acid gel stain (Sigma Aldrich, cat. no. S9430-.5ML)

• EcoRI HF (New England BioLabs, cat. no. R3101S)

• Quick CIP (New England BioLabs, cat. no. M0525S)

• T4 DNA Ligase (New England BioLabs, cat. no. M0202S)

• Gel/PCR DNA Fragment Extraction Kit (IBI scientific, cat. no. IB47010)

• LoxP2+ (linearized) (it comes together with Cre Recombinase New England BioLabs, cat. no. M0298S)

• Oligonucleotides from table 8

• Accuris SmartDoc 2.0 System with Blue Light Illumination Base, 115V (Accuris Instruments, cat. no. E5001-SDB)

Table 8:

Oligonucleotide List for SUPPORT PROTOCOL 1

Name	Sequence 5’–3’
EcoR1 Backbone	TCGAGGAATTCAGAGAAGTCATCAAAGAGTTTAAAGAGTTTATGAGATTTAAGGTCAAGACAACGAGACACGAG TTCGAGATTGAGGGAGAGAAGGCCCCTCAGCGGCCTTATAACTATAACGGTCCTAAGGTAGCGAACGAACAAAC CGCTAAGCTCAAGGTCACAAAAGGTCGACGAGGACCCGGATCCCTCCCCTTCTCCTGGTACGGAAGCAAAGCCTA TGTTAAACACTGACTATCTGAAGCTCTCCTTCCCTGAAGGCTTGAGAGATTCATGAACTTCGAGGAAGGACGGAGA GTTTATTTATAAGGAACCAACTTCCCCTCCGATGGCCCTGTCATGAATTCT
NebF	AGCCTCCCCTTCTCCTGGGATCCTACGGTCATTCGTACGGAAGCAA
NebR	TTTTGTGACCTTGAGCTTAGCGGTGTCGACACTGGCCGTCGTCTGC

• 1Procure DNA oligos listed in Table 1 from a commercial vendor.
• 2In a PCR tube, add 2.5 µl (50ng) of LoxP2+ linear plasmid, 1 unit of T4 DNA ligase, and nuclease-free water to 25 µl total volume. Incubate overnight at 16 °C or 10 min at room temperature. Add the T4 ligase last.
• 3Prepare large LB agar plates with Ampicillin (optimally by dispensing 40ml of LAB agar 100µg/ml ampicillin). Once the agar is solid, incubate at 37 °C.
• 4Thaw 5-alpha competent E. coli cells on Ice. Transfer 50 μL of chemically competent cells to a pre-chilled microcentrifuge tube. Add 1μL of the assembly product above to chemically competent cells, flick the tube. Place the mixture on ice for 30 minutes. Do not mix. Heat shock at exactly 42°C for exactly 30 seconds. Do not mix. Place on ice for 5 minutes. Add 950μL of room-temperature SOC media to the tube immediately after the heat shock. Place the tube at 37°C for 60 minutes while shaking vigorously (250 rpm) or rotating.

  Include a pUC19 NEB positive control for transformation (provided with chemically competent cells)

• 5Plate 100µl of the SOC medium on an Ampicillin Agar plate and incubate over night at 37°C
• 6Collect few single colonies from ampicillin agar plate using a sterile tip and inoculate in 5ml of LB medium with Ampicillin in a Corning tube and shake overnight at 200 RPM at 37°C.
• 7Perform plasmid extraction using the PureLink Quick Plasmid Miniprep Kit as described by the vendor
• 8Set the Digestion of LoxP2+ obtained in 12 in a PCR tube as below (perform in parallel step 12 to save time)
• 9Measure the concentration of LoxP2+ at the nanodrop and use the required volume according to the amount cited in table 9.
• 10Incubate in the thermal cycler at 37°C for 1h and heat inactivate at 80°C for 10min.
• 11Prepare an 1% agarose gel with SybrGreen, load 10 µl of digestion solution in step 10 and run at 100V for 30 min (2/3 of the gel)
• 12Visualize the gel in the SmartDoc Gel Imaging System light (figure 6).
• 13Cut with a blade or an agarose gel band cutter the 2.9kb DNA fragment of LoxP2+. Purify the DNA by using the Gel/PCR DNA Fragments Extraction Kit, quantify the final DNA concentration at the Nanodrop.
• 14Digest 100ng of the synthetic dsDNA fragment named “EcoRI Backbone” (see Table 2) with 1 unit of EcoRI HF restriction enzyme in 25 µL of 1X CutSmart buffer at 37 °C for one hour and purify by using “DNA Purification SPRI Magnetic Beads” as described by the vendor, quantify the final DNA concentration at the Nanodrop
• 15Set up the ligation of the 2.9kb DNA fragment of LoxP2+ at step 14 with the “EcoRI Backbone” in a PCR tube as shown in the table 10 and Incubate at 16 °C overnight or 10 min at room temperature.
• 16Use 0.5 µL of the ligation for transformation of 5-alpha chemically competent E. coli cells. Follow the transformation protocol provided by NEB with the competent cells and plate transformed cell on an Ampicillin resistance selective agar plate
• 17Collect few single colonies (up to 5) from the Ampicillin selective agar plates using a sterile tip and inoculate in 5ml of LB medium with Ampicillin in a Corning tube and shake at 200 RPM overnight at 37°C
• 18From the Broth cultures in Corning tubes in step 17 extract pLASSO performing plasmid extraction using the PureLink Quick Plasmid Miniprep Kit as described by the vendor and quantify the final DNA concentration at the Nanodrop. Remember to freeze 500 µL or 1ml of broth culture in Nalgene tubes and keep until selection at the step 19
• 19Double check the correct assembly of pLASSO by performing multiple digestion of ~500ng of pLASSO performing with SwaI, BamHI and SalI restriction enzyme restriction enzymes.
• 20Check DNA pathway on 1% gel electrophoresis as shown in figure 7.
• 21Keep at −80 °C the Nalgene tubes at point 18 that contains the correct pLASSO clones and discard the remaining tubes

Table 9:

LoxP2 digestion reaction components

Component	Amount	Final (concentration/ amount)
Eco HF restriction enzyme	1µL	20 U
Quick CIP	1 µL	5 U
CutSmart buffer	2.5 μL	1X
LoxP2 +		500ng
Nuclease free water		To 25 µl

Figure 6.

Sample gel showing the LoxP2+ DNA band at 2.9 Kb and a DNA band at 750 bp following digestion (Support Protocol 1).

Table 10:

EcorI ligation reaction components

Component	Amount	Final (concentration/amount)
2,9kp fragment from pLox2+	40ng	1.6 ng/μL
EcoR1 Backbone	10ng	0.5 ng/μL
10X T4 DNA Ligase Buffer	2.5 μL	1X
T4 DNA Ligase	1 μL	16 units/ μL
PCR grade water	Fill to 25 μL

Figure 7.

Sample gel showing the correct assembly of pLASSO following multiple digestion with SwaI (lane 1; expected size 3204 bp), BamHI (lane 2; expected size 3204 bp), and BamHI + SwaI (lane 3; expected sizes of 1592 and 1631 bp, as one band at ~ 1.6 kb). Lane L: Quick-Load Purple 1 kb Plus DNA ladder. (Support Protocol 1).

Linearization of pLASSO

• 22In a PCR tube set up the following PCR reaction according to table 11 and 12 and figure 8.
• 23Perform quality analysis of the linearized pLASSO by running the PCR product on a 0.8 % agrose gel and verify the presence of the correct size of the amplicon. An optimized PCR-linearized pLASSO yields a strong DNA band of the correct ~3.3kb size (example in figure 3.) the same analysis can be also performed using an Agilent® 2100 Bioanalyzer.
• 24Purify pLASSO by performing DNA purification by using Gel/PCR DNA Fragments Extraction Kit and elute in 25 μL of TE 0.1X and measure the concentration at the Nanodrop. The expected yield is 50–100 ng/μL of purified linear pLASSO. Store at − 20°C for long-term storage.

Table 11:

Reaction components for the linearization of pLASSO

Component	Amount	Final (concentration/amount)
5x KAPA HiFi Fidelity Buffer	5.0 μL	1x
10 mM each dNTP Mix	0.75 μL	0.3 mM each dNTP
10 μM NEBF Primer	0.75 μL	0.3 μM
10 μM NEBR primer	0.75 μL	0.3 μM
(1) 0.5 ng of pLASSO	0.5 μL	0.4 ng/μL
KAPA HiFi HotStart DNA Polymerase (1 unit/μL)	0.5 μL	0.5 units/reaction
PCR grade water	Fill to 25 μL	—

Table 12:

PCR cycling conditions for the linearization of pLASSO

CYCLING STEP	TEMPERATURE		DURATION
1	Initialization Denaturation	4 min at 95°C	1x
2	Denaturation	20 sec at 95°C	28 Cycles
3	Annealing	20 sec at 65 °C
4	Extension	2 min at 72°C
5	Final Extension	3 min at 72°C	1x

Figure 8.

Sample gel showing the linearized pLASSO amplicon with expected size at 3.3 kb (Support Protocol 1).

SUPPORT PROTOCOL 2: pre LASSO preparation

The pre-LASSO library composed of thousands of different synthetic ssDNA short oligo pool (~160bp), is provided by commercial vendors of oligo pools (e.g. Twist Bioscience, IDT, Creative Biogene, or others) in nanograms total amount (~ 100 ng in the case of Twist Bioscience). The aim of the support protocol 2 is to increase the amount of pre-LASSOs and to convert them to double strands that will be used in the basic protocol 1. Each single pre-LASSO probe is composed by six different parts: primer-annealing site, ligation arm, conserved region, extension arm, primer-annealing site. Primer-annealing sites are specific for the library. It is thus possible to design a library that contains different sub-library that can be selectively amplified by using a different selector primer design. This support protocol describes how to amplify and purify a single pre-LASSO library pool. You can choose to perform Next Generation Sequencing of the purified PCR product to validate the purity and identity of the pre-LASSO at the of this SUPPORT PROTOCOL 2 but we recommend performing a Next Generation Sequencing at step 40 of the Basic Protocol 1 to validate both the purity and the correct assembly of the LASSO probes in their final configuration.

Additional Materials (also see Basic Protocol 1):

• Low molecular weight DNA ladder (New England BioLabs, cat. no. N3233S)

• Oligonucleotides from table 13

Table 13:

Oligonucleotide List for SUPPORT PROTOCOL 2:

Name	Sequence 5’–3’
Pre-LASSO design	CAGACGACGGCCAGTGTCGAC, Ligation Arm, AACACTTCTTGCGGCGATGGTTCCTGGCTCT TCGATC, Extension Arm, GGATCCTACGGTCATTCAGC
pre-LASSO 1kbM13	CAGACGACGGCCAGTGTCGACTTGGAGTTTGCTTCCGGTCTGGTTCGAACACTTCTTGCGGCGA TGGTTCCTGGCTCTTCGATCGCCGTTGCTACCCTCGTTCCGATGCGGATCCTACGGTCATTCAGC
SalF	CAGACGACGGCCAGTGTC
BamHR	GCTGAATGACCGTAGGATCC

pre-LASSO probe amplification

1. Prepare a stock solution of your pre-LASSO probe Oligo Pool by re-suspending in 10 mM Tris buffer, pH 8.0 to a concentration of at least 20 ng/μL.

   Stock solution concentration (ng/μL) = Total yield (ng) / resuspension volume (μL)

2. Use the KAPA HiFi HotStart PCR Kit to perform PCR using the pre-LASSO primer pair according to the primer annealing site of the pre-LASSO library (Table 3). If the pre-LASSO library is composed by different sub-libraries, make sure to use the appropriate pre-LASSO primers pairs to select the sub-library of choice.

3. Assemble the PCR reaction according to the set up in tables 14 and 15 to produce the products as shown in figure 9.

4. Perform quality analysis of pre-LASSO probe library by running the PCR product on a 2.5% agarose gel and verify the presence of the correct size of the amplicon an optimized PCR-amplified oligo pool yields a strong DNA band/ peak at the correct size (figure 9) the same analysis can be also performed by using an Agilent® 2100 Bioanalyzer. A clean peak at the expected size indicates effective oligo pool amplification. See troubleshooting in case of other profiles.

5. Purify the PCR reactions with AMPure magnetic beads using a high bead-to-DNA ratio (1.8x)

6. Take out of the fridge the AMPure magnetic beads and leave at room temperature for 30min and vortex before use

7. Add 1.8X beads (83μL of beads for the remaining 46 μL of inverted PCR reaction) to the sample in 23 and gently mix by pipetting 10 times

8. Incubate the sample with the beads at room temperature for 5 min.

9. Condense the beads into a pellet with the magnet for 3–5 min.

10. Remove and discard the supernatant without disturbing the beads, leaving ~3 μL behind at the bottom of the tube. Keep the beads pelleted until the elution step; do not disturb the pellet.

11. Pipette 200 μL of 80% (vol/vol) ethanol without disturbing the beads and keep them pelleted. Prepare fresh 80% (vol/vol) ethanol.

12. Leave the ethanol on the beads for 30 sec; then remove and discard the ethanol.

13. Repeat the wash (steps 11 and 12 for a total of two ethanol washes).

14. Remove as much of the ethanol as possible. Be mindful of small ethanol droplets.

15. Air-dry the pellet for ~2 min. We recommend not exceed 2.5 min in dry time which will lead to overdrying.

16. Add 25 μL of nuclease-free water to the sample and then pipet 15 times to mix. Repeat the mixing to ensure better recovery.

17. Incubate at room temperature for 5 min.

18. Condense beads into a pellet with the magnet for 3–5 min.

19. Collect the supernatant into a new tube.

20. Quantify the concentration of the purified PCR product using a Nanodrop. At this step the purified inverted PCR product can be stored at −20°C for up to 1 year or used for the first step in BASIC PROTOCOL 2.

Table 14:

Components for the PCR amplification of preLASSO probes

COMPONENT	FINAL CONCENTRATION	PER 25 μL REACTION
5x KAPA HiFi Fidelity Buffer	1x	5.0 μL
10 mM each dNTP Mix	0.3 mM each dNTP	0.75 μL
10 μM SalF	0.3 μM	0.75 μL
10 μM BamHR	0.3 μM	0.75 μL
Twist Oligo Pool (20 ng/μL)	0.4 ng/μL	0.5 μL
KAPA HiFi HotStart DNA Polymerase (1 U/μL)	0.5 U/reaction	0.5 μL
PCR grade water	—	Fill to 25 μL

Table 15:

PCR cycling conditions for the amplification of preLASSO probes

CYCLING STEP	TEMPERATURE		DURATION
1	Initialization Denaturation	3 min at 95°C	1x
2	Denaturation	20 sec at 98°C	6–12 Cycles**
3	Annealing	15 sec at 58 °C
4	Extension	15 sec at 72°C
5	Final Extension	1 min at 72°C	1x

Figure 9.

Sample gel showing a DNA band at around 160 bp for the amplified preLASSO library.

(Support Protocol 2).

BASIC PROTOCOL 2: LASSO probe target capture

Massively Parallel Large DNA Target Capture

The mature LASSO library can now be used for a massively parallel capture that is performed in 4 phases in a PCR thermal cycler: hybridization, capture, purification of circularized targets, and post capture PCR amplification.

Hybridization

During the hybridization, the DNA template (genomic DNA or cDNA) of interest is mixed with the LASSO probe library for some time.

Capture

The capture is performed by adding the Gap Filling Mix directly into the hybridization reaction that is incubating in the thermal cycler. We developed a novel Gap Filling Mix that contains DNA polymerase and a thermostable DNA ligase formulation, meets our needs and can be stored for 2 months at −20 °C. The gap that is between the ligation and the extension arm hybridization sites is filled by the DNA polymerase using free nucleotides and the ends of the probe are ligated by the DNA ligase, resulting in a fully circularized DNA loop containing the DNA target sequence.

Purification of circularized targets

The ssDNA circles, representing the LASSO probes containing targets, are purified from the rest of the linear template dsDNA or the unreacted LASSO probes by adding a Digestion Enzyme Mix that contains exonucleases.

Post Capture PCR

To enrich the captured targets, PCR amplification is performed using as template the capture reaction that was subjected to exonuclease digestion and universal primers that anneal on the backbone sequence of the probe in proximity to the arms. The capture is verified by running the post capture PCR product on agarose gel to verify the presence of the expected size of the targeted genomic regions.

Preparation of captured targets for NGS sequencing or transfer in Gateway pDONR for downstream applications

For NGS analysis, the post capture PCR product is purified and subjected to enzymatic fragmentation. NebNext Ultra (NEB) or other commercial kits, depending on the sequencing platform of choice, can subsequently be used to prepare the fragmented library for NGS sequencing.

For downstream expression experiments, the post capture PCR product is subjected to a second PCR amplification using tailed primers containing Gateway attB1 and attB2 sequences. The purified PCR product is mixed with the Gateway ‘donor vectors’ (pDONR221) and the BP Clonase enzyme mix (Invitrogen). The purified BP reaction can be used for E. coli electroporation to generate an entry clone library for downstream expression.

Additional Materials (also see Basic Protocol 1):

• Mature LASSO library from step 49

• M13mp18 single-stranded DNA (New England BioLabs, cat. no. N4040S)

• Ampligase DNA ligase (100 units/µl) (Lucigen Corporation cat. no. A0102K)

• Ampligase 10X Reaction Buffer (Lucigen Corporation cat. no. A1905B)

• Lambda Exonuclease (New England BioLabs, cat. no. M0262S)

• Exonuclease I (New England BioLabs, cat. no. M0568S)

• Exonuclease III (New England BioLabs, cat. no. M0206S)

• NEBNext Ultra DNA Library Prep Kit (New England BioLabs, cat. no. #E7805)

• PCR Cloning System with Gateway™ Technology with pDONR™221 & OmniMAX™2 Competent Cells (Thermofisher, cat. No 12535029)

• Kanamycin Sulfate 100 ml (Thermofisher, cat. No 15160–054)

Reagent setup

Gap Filling Mix

Prepare Gap Filling Mix assembling the component in the order shown in table 16, vortex and store at −20 °C for up to two months

Table 16:

Gap Filling Mix

ORDER	COMPONENT	Amount PER 1ml Stock
1	PCR grade Water	791 µl
2	10X Ampligase DNA ligase Buffer	100 µl
3	10 mM dNTPs	4 µl
4	Ampligase DNA Ligase (100U/ul)	1 µl
5	Omni Klentaq LA	4 µl
6	Glycerol	100 µl

Digestion Mix

Prepare Digestion Mix assembling the component in the order shown in table 17, vortex and store at −20 °C for up to three months

Table 17:

Digestion Mix

ORDER	COMPONENT	Amount PER 240 µl Stock
1	PCR grade Water	120 µl
2	Exonuclease I	40 µl
3	Lambda Exonuclease	40 µl
4	Exonuclease III	40 µl

Oligos and primers

Purchase the oligos in Table 18 and resuspend IDT DNA oligos (Table 1) and primers (Table 2) to 100 µM in nuclease-free water. Dilute to a 10 µM concentration by adding 10 µL of 100 µM primers to 90 µL of nuclease-free water. DNA oligos and primers can be stored at 10 µM or 100 µM at −20 °C for up to 2 years.

Table 18:

Oligonucleotide List for BASIC PROTOCOL 2

Name	Sequence 5’–3’
AttB1 CaptF	GGGGACAAGTTTGTACAAAAAAGCAGGCTtcACCGCTAAGCTCAAGGTCACA
AttB2 CaptR	GGGGACCACTTTGTACAAGAAAGCTGGGTcctaatCTTCCGTACCAGGAGAAGGG

Protocol

Capture

In our experience 200 – 500 ng of bacterial total genomic DNA is optimal for a single capture experiment. For eukaryotic genomes, we recommend to use ~ 1µg total genomic DNA or cDNA for a single capture. Consequently, the DNA template needs to be of the appropriate concentration in order to fit the 15 μL capture volume. For bacterial or small genomes ~ 50 ng/μL concentration can be sufficient. For eukaryotic DNA or cDNA we recommend to have at least ~ 250 ng/μL as template DNA concentration.

• 1In the PCR thermal cycler set up the following thermal protocol in table 19

Table 19:

Capture cycling conditions

CYCLING STEP	TEMPERATURE		CYCLE
1	Denaturation 1	5 min at 98 °C	1x
2	Hybridization	60 min* at 65 °C	1x
3	Add Gap filling Mix	5 min at 65°C	1x
4	Capture	30min at 65 °C	1x
5	Denaturation 2	3 min at 98 °C	1x
6	Add Digestion MIX	5 min at 37 °C	1x
7	Digestion	60 min at 37 °C	1x
8	Inactivation	20 min at 80 °C	1x
9	End	∞ 4 °C	1x

^*In our experience 60 min of hybridization is optimal for bacterial genomes. For eukaryotic or Human DNA capture, we recommend to perform overnight hybridization.

* In our experience 60 min of hybridization is optimal for bacterial genomes. For eukaryotic or Human DNA capture, we recommend to perform overnight hybridization.

• 2Thaw on Ice LASSO M13 positive control, M13mp18 Single-stranded DNA, your LASSO probe library(es) and your DNA template.
• 3Dilute the LASSO M13 positive control for capture in 1/10 and 1/100 (vol/vol) dilution in PCR grade water
• 4Set up the positive and negative control capture in table 20 and 21
• 5Set up the capture reaction(s) in a PCR tube rack at room temperature according to table 22.
• 6Put the above-assembled reactions in 4 and 5 in the thermal cycler and start the program in 1 set a timer to start ringing with the beginning of the “Gap filling Mix” step.
• 7At the “Gap filling Mix” step open the cover of the thermal cycler, open the cup of PCR tubes and add 5 μl of Gap filling Mix to the capture reactions.
• 8Close the tubes caps and close the cover of the thermal cycler and set the timer with the beginning of the “Add Digestion MIX” step.
• 9At the “Add Digestion MIX” step, immediately open the cover of the thermal cycler, open the cup of PCR tubes and add 3 μl of Digestion Mix to the capture reactions and pipet 5 times up and down. Wait until the program has ended.

Table 20:

Positive control capture reaction components

COMPONENT	AMOUNT	FINAL CONCENTRATION
LASSO probe M13 (1/100)	1 μL	-
M13mp18 Single-stranded DNA	0.5 μl	0.03 ng/μL
10X Ampligase DNA Ligase Buffer	1.5 μl	1X
PCR grade water	Fill to 15 μl	-

Table 21:

Negative control capture reaction components

COMPONENT	AMOUNT	FINAL CONCENTRATION
LASSO probe M13 (1/100)	1 μL	-
10X Ampligase DNA Ligase Buffer	1.5 μl	1X
PCR grade water	Fill to 15 μl	-

Table 22:

Library capture reaction components

COMPONENT	AMOUNT	FINAL CONCENTRATION
Mature LASSO probe library	10 ng	0.7 ng/μL
DNA template	up to 2µg	133 ng/μL
10X Ampligase DNA Ligase Buffer	1.5 μl	1X
PCR grade water	Fill to 15 μl	-

■ PAUSE POINT Store LASSO probes at −20°C for up to 1 year

Post Capture PCR

• 10Set up on ice the post capture PCR following reaction as shown in table 23 and 24.
• 11Take the AMPure magnetic beads out of the fridge and leave at room temperature for 30min. Vortex before use.
• 12Add 0.7 X beads to remove shorter fragments (smaller than 300 bp) to the sample in step 11 and gently mix by pipetting 10 times.
• 13Incubate the sample with the beads at room temperature for 5 min.
• 14Condense the beads into a pellet with the magnet for 3–5 min.
• 15Remove and discard the supernatant without disturbing the beads, leaving ~3 μL behind at the bottom of the tube. Keep the beads pelleted until the elution step; do not disturb the pellet.
• 16Pipette 200 μL of 80% (vol/vol) ethanol without disturbing the beads and keep them pelleted. Prepare fresh 80% (vol/vol) ethanol.
• 17Leave the ethanol on the beads for 30 sec; then remove and discard the ethanol.
• 18Repeat the wash (steps 17 and 18 for a total of two ethanol washes).
• 19Remove as much of the ethanol as possible. Be mindful of small ethanol droplets.
• 20Air-dry the pellet for ~2 min. We recommend not exceed 2.5 min in dry time which will lead to overdrying.
• 21Add 25 μL of nuclease-free water to the sample and then pipet 15 times to mix. Repeat the mixing to ensure better recovery.
• 22Incubate at room temperature for 5 min.
• 23Condense beads into a pellet with the magnet for 3–5 min.
• 24Collect the supernatant into a new tube.
• 25Quantify the concentration of the purified PCR product using a Nanodrop.

Table 23:

Post capture PCR reaction components

COMPONENT	PER 50 μL REACTION	FINAL CONCENTRATION
Capture Reaction at step 9	10 μL	-
10 mM each dNTP Mix	1 μL	0.3 mM each dNTP
10 μM AttB1 CaptF primer	1.5 μL	0.3 μM
10 μM AttB1 CaptR primer	1.5 μL	0.3 μM
Omni Klentaq LA	0.5 μL	units/μL
10 x Klentaq DNA Polymerase Buffer	5 μL	1x
PCR grade water	30.5 μL

Table 24:

Post capture PCR cycling conditions

CYCLING STEP	TEMPERATURE		DURATION
1	Initialization Denaturation	3 min at 95°C	1x
2	Denaturation	20 sec at 98°C	25 Cycles
3	Annealing	15 sec at 60 °C
4	Extension	2 min at 68°C
5	Final Extension	1 min at 68°C	1x

Preparation for NGS Sequencing

• 26Use 5 ng–1 µg of the purified PCR product from step 25 to prepare the DNA for sequencing according to the kit procedure and the requirement of the sequencing platform. We used NEBNext Ultra DNA Library Prep Kit for Illumina but you may use other compatible kits. NEBNext Ultra DNA Library Prep Kit required the fragmentation and ligation of the fragments with primer adapters.
• 27Perform quality analysis of the fragmented amplified library by running the PCR product on a 1.5% agarose gel as seen in figure 10.

Figure 10.

Sample gel image from quality control analysis of the fragmented amplified library with Illumina P5 and P7 primers (Basic Protocol 2).

Cloning ORFeome in Gateway system

• 28For this specific ORFeome library targets we used 20ng of the purified PCR product from step 26 and followed the steps detailed in the protocol PCR Cloning System with Gateway™ Technology with pDONR™221 & OmniMAX™2 Competent Cells. Please see gel of the cloned library in pDONR 221 in (figure 12).

Figure 12.

Histogram of the expected size for the targeted ORFs, and gel showing the amplicons of the capture with the LASSO probe library (lanes 1 and 2), along with positive (lane 3) and negative (lane 4) controls. Lane L, 1-kb Ladder (NEB); lane 1, capture of 3000 ORFs of E. coli K12 using 0.5 ng LASSO library; lane 2, capture of 3000 ORFs of E. coli K12 using 5 ng LASSO library; lane 3, positive control for capture reaction (1-kb target within M13mp18 ssDNA); lane 4, negative control (same as 1 but without LASSO library in the capture).

REAGENTS AND SOLUTIONS:

1× TAE buffer

Mix 100 mL of 10 × TAE with 900 mL of water for 1L of 1× TAE. Store at room temperature (25 °C) until expiration date on packaging.

Agarose gel

Prepare ahead of time. Mix 0.6 g for 1.2% (wt/vol) agarose with 50 mL of 1× TAE, heat in microwave until agarose completely dissolves, add 1.5 µL of ethidium bromide (10 mg/mL) pour the solution into the casting box with the comb positioned, and cool at room temperature for at least 20 min until the gel solidifies.

80% (vol/vol) ethanol solution

Mix 8 mL of ethyl alcohol (pure, 200 proof) with 2 mL of nuclease-free water to obtain 1 mL of 70% (vol/vol) ethanol right before use.

CRE recombinase (ABCAM)

Aliquot in PCR tubes in 4µl aliquots and store at −80 °C

pLASSO vector

Assemble according to the description in SUPPORT PROTOCOL.1

Pre-LASSO library

Pre-amplified according to the description in SUPPORT PROTOCOL.2

Oligos and primers

Procure oligos in Table 1 and resuspend IDT DNA oligos (Table 1) and primers (Table 2) to 100 µM in nuclease-free water. Dilute to a 10 µM concentration by adding 10 µL of 100 µM primers to 90 µL of nuclease-free water. DNA oligos and primers can be stored at 10 µM or 100 µM at −20 °C for up to 2 years.

COMMENTARY

Background Information:

Multiplex cloning can be a conduit for functional high-throughput genomics that has been limited by existing PCR based methods that lack cost/time-effectiveness, scalability, and specificity. The conventional strategy to clone ORFs or any long DNA sequence requires PCR cloning that is an expensive process, labor intensive, and not easily scalable. In fact every ORF needs to be amplified in a separate PCR tube by using a pair of expensive oligonucleotide primers, the PCR products need to be purified, and individually cloned (Carter et al., 2020; Bischof et al., 2013). The insert sequences need to be validated one by one with Sanger sequencing. Multiplex PCR on the other hands is not a viable solution because combining different primers can cause interference during the amplification process, particularly when using large number of different primer set (Rachlin et al., 2005). Digital PCR has overcome individual PCR amplification by enabling multiple PCR reactions to occur in a same vial by reducing the volume of each reactions to a droplet size and keeping them separated by an emulsion process (Tewhey et al., 2010). Nevertheless, to do so primer pairs need to be column synthesized individually then paired and reformatted as droplets in a complex microfluidic equipment thus producing a primer pair library in droplet size ready for the massively parallel singleplex PCR amplification (Anna et al., 2003). This technology gives a uniform coverage of targeted sequences but still requires a laborious primer pairing and feeding to the machine that partitions them at the start of the process.

Molecular Inversion Probes (MIPs) (Nilsson et al., 1994) offer a single-probe that is designed with spatial proximity of complimentary arms during a target capture, thus constraining MIPs to hybridize to the desired target even when thousands of different probes are in the same reaction volume. MIPs, hybridize to a DNA target template, gap fill with a DNA polymerase, ligate and circularize targets, yet they are ineffective at capturing larger DNA targets because of the short length of the linker region (Landegren et al., 2004). Another commonly used target enrichment strategy is hybridization‐based by which DNA is fragmented, barcoded then hybridized on strepatavidin oligopools-conjugates and separated with magnetic beads (Kozarewa et al., 2015) to be later analyzed through sequencing. Although effective in improving enrichment of difficult or small regions (Gaudin & Desnues, 2018; Bundok et al., 2012) hybridization target enrichment relies on random shearing therefor resulting with sequences captured at a random lengths (Table 25). Therefore, this approach cannot be used for cloning applications where correct reading frame, start and stop codons needs to be maintained. Another method for massively parallel DNA target capture relies on short selector oligonucleotides (~70bp) act as a template to circularize DNA segments following restriction enzymes digestion. This technique is not suitable for cloning of ORF because it relies on the presence of specific restriction enzyme sites in the target sequences (Nilsson et al., 2006). A number of commercially available platform use the above cited methodologies in combination with NGS (Table 25).

Table 25.

Current commercially available technologies for DNA fragments capture

Technology (supplier)	Mechanism	Scalability	Target length	limitations
Ampliseq (Thermofisher, Illumina)	Multiplex PCR amplification of very short amplicons	Low (max 100 genes)	-Precise Max 175bp	Difficult primer design-risk false positive
MIPs (Thermofisher , Illumina)	Gap filling, ligation and visualization on DNA microarray	High	~200bp
Halo Plex (Agilent)	Molecular selector probes	High	200bp	Rely on the presence of specific restriction sites
Hybridization beads (Agilent SureSelect, Roche KAPA target enrichment)	Hybridization and selection using Streptavidin beads		fragmentation dependent	-risk of aspecific hybridization
LASSO	probes hybridization Gap filling & ligation	High	Precise, 5 kb maximum length	Decrease capture efficiency with target length

In 2017, we developed and tested a first-generation design LASSO probes as a novel tool for massively parallel cloning of kilobase-long genomic DNA sequences (Tosi et al., 2017). LASSO design is inspired by MIPs, though includes a user-defined long adapter region in the probe assembly to enable longer target capture in a multiplexed format. Initial proof-of-concept studies confirmed LASSOs ability to simultaneously clone a near-complete ORFeome of a bacteria in a single capture reaction. Because of LASSO specificity in capturing a pool of long DNA targets, this tool can find applications in systems biology, such as functional studies of proteomes that necessitate the cloning of all of an organism’s protein-encoding open reading frames (ORFs) collected into an ORFeome library.

Despite the potential of LASSO technology, it remained at the proof of principle stage and was not exploited by other research groups because the protocol we presented for the assembly of the LASSO probes was labor intensive and the quality of our final LASSO library was suboptimal in terms of probe representation and identity, which resulted in low capture efficiency. In a subsequent study, we found that the self-ligation step we used for the assembly process (Shukor et al. 2019) produced along with correct DNA circles containing a single LASSO precursor, a large amount of LASSO precursors concatemers that generated LASSO probes with discordant arms that were not functional.

To address these issues we set up a completely different LASSO assembly methodology that avoids the critical self-circularization step of the previous LASSO assembly process and the initial fusion PCR steps thus generating a pure population of mature LASSO probes with a consequent dramatic improvement in the capture efficiency. This innovative assembly strategy leads to the same mature LASSO probe structure but, differently from the previous method where we used a Long Adapter sequence (Tosi et al., 2017), here we developed a custom plasmid pLASSO (Fig 1, b) that supplies the backbone and functional sites required for the assembly of the mature LASSO probe. Specifically, pLASSO contains two LoxP sites for Cre-recombination, a selector primer annealing site for linearization and an Ampicillin-resistance gene for E. coli selection. The novelty of this LASSO assembly protocol is derived from the use of a Cre-recombinase mediated assembly that solves the drawbacks of the previous assembly methodology.

CRITICAL PARAMETERS

Good laboratory practices are critical for cloning, enzymatic reactions, PCR amplification, and purification. Special attention has to be paid during the cloning step in BASIC PROTOCOL 1 to guarantee a uniform representation of all probes in the final LASSO library. The scientist has to check the number of the - colonies in selection agar plates and make sure that it is at least 100 times the number of pre-LASSO probes in the library (e.g. a 4000 different pre-LASSO probe library needs 400,000 colonies). If the total number of colonies is lower than 100 times the number of pre-LASSO probes, you should repeat the cloning step and plate in a larger number of petri dishes in order to reach the required number of colonies.

To prevent degradation, where specified, reactions must be assembled on ice especially when using the Cre Recombinase enzyme.

During DNA wash/purification steps that call for the use of ethanol we highly recommend freshly preparing 80% (vol/vol) ethanol because ethanol that has been stored for too long will have an incorrect ethanol/water ratio that will impair DNA yield. At the AMPure beads drying time you should also be careful not to overdry the pellet, which will lead to cracking and/or breakup. This will make re-suspension more difficult thus will reduce DNA recovery.

To get a full library capture the researcher has to evaluate the complexity of the genome that will be used as a template and adjust the quantity thereof: for more complex genomes more DNA has to be used for the capture. In addition, we recommend the researcher to divide the LASSO library in pools whereby LASSOs targeting regions of similar lengths are grouped in the same pool. The scientist has to also pay attention to the extension time during the post capture program cycle and prolong it when longer regions are targeted (adding 1 min for each extra 1 Kb that needs to be amplified).

Troubleshooting

See table 26 for the troubleshooting guide.

Table 26.

Troubleshooting table

Step	Problem	Possible cause	solution
BASIC PROTOCOL 1:7	Number of colonies in the dilution plate is too low whereas the pUC19 control plate have high number of colonies	pLASSO was not linearized by using the correct adapters for the pre-LASSO library of choice.	Verify identity, purity and concentration of both linearized pLASSO and pre-LASSO library and go back from the step 2
BASIC PROTOCOL 2:10	In the gel run, the capture Lane shows no visible amplicon while the positive control appeared as a clear and strong band in the gel.	Too few cycles in the Post capture PCR in step 10, or the concentration of template is suboptiomal in the capture reaction, or failed assembly of the LASSO probe library	Increase cycle number PCR in step 10, or perform a new capture experiment with higher concentration of template, or re perform inverted PCR starting from step 23
SUPPORT PROTOCOL 2: 4	Multiple side peaks In the gel run	non-specific amplification	Repeat PCR with higher annealing temperature to increase specificity, or re-design PCR primers.
SUPPORT PROTOCOL 2: 4	The presence of a hump after the peak of interest	Presence of heteroduplexes, a result of over-amplification.	Re-try PCR with lower number of cycles

TIME CONSIDERATIONS

BASIC PROTOCOL 1: Cloning- and E.coli transformation: 2 days. Long term −20 storage following PureLink quick Plasmid miniprep purification.

BASIC PROTOCOL 1: Nicking, recombination and purification of DNA minicircles: 1 day. The protocol can be paused and the product stored at −20°C after nicking, or purification of DNA minicircles.

BASIC PROTOCOL 1: Inverted PCR, and maturation of LASSOs: 2 days. The protocol can be stopped either after beads purification of the inverted PCR product or after the maturation of the LASSOs and the product stored at −20 °C.

SUPPORT PROTOCOL 1: p-LASSO generation: 3 days. This support protocol has 2 overnight E.coli transformation after which the purified p-LASSO can be stored for long term storage at −20°C.

SUPPORT PROTOCOL 2: pre-LASSO amplification: 1 day. The pre-LASSO library can be stored at −20°C for long term storage after amplification and purification.

BASIC PROTOCOL 2: capture and post capture: 2 d. The protocol can be stopped and the products of the capture and the purified post-capture stored at −20 °C for long term storage.

BASIC PROTOCOL 2: Sample preparation for sequencing: 1d

Understanding Results:

Gel electrophoresis of a post-capture PCR amplicon should reproduce the expected size distribution of the targeted ORFs plus ~140 bp that corresponds to the length of the primers that are added during the post-capture plus residual LASSO sequences. Fig. 11 shows an example of a smear of the correct size of the PCR product of the capture of ~3000 ORFs of E.coli K12 using 0,5ng LASSO library in Lane 1 and using 5ng LASSO library Lane 2. The expected size of the targets is shown in the histogram to the left of the gel. The untargeted regions below 400 bp that have not been captured as can be seen in the gel, serve as a negative control. Two more negative controls have been tested shown in Lane 3 and 4 that have the same conditions as in lane 1 with no LASSO library and no E.coli K12 DNA template in lane 4 during the capture. Lane 5 shows the positive control for capture reaction that is 1kb target within ssDNA of the M13mp18 phage. The PCR product, having attb ends, can be cloned into a vector of choice via BP reaction (Gateway system) or subjected to NGS. In a recent work, we sequenced the LASSO’s and the captured ORFeome of E.coli with Illumina NextSeq and demonstrated that Cre-Loxp recombination strategy generated high quality LASSO probes libraries (~46% of probes assembled correctly) and the capture resulted in significant enrichment of the ORFs (30 times of all targeted ORFs versus untargeted ORFs) (Tosi et al., 2021).

Figure 11.

Gel electrophoresis showing a DNA smear (lane 1) of the expected DNA size distribution, confirming the successful cloning of the E. coli ORFeome library into pDNOR221.

The presence of the ORFs library in pDONR221 was verified by PCR with M13Fcom and M13R universal primers that anneal adjacently the attL1 and attL2 sites of the entry vector pDONR221. A smear of the expected size appeared confirming the successful cloning of the E.coli ORFeome library in pDNOR221 without low MW products formation (Fig. 12 lane1).

The post-capture was performed in a real-time PCR for testing different ratios of LASSOs to their expected DNA target. Fig. 13 shows that increasing the amount of LASSO slightly improves the capture efficiency. The best efficiency was obtained by using 10 individual LASSO for each target.

Figure 13.

Effect of LASSO/DNA target ratio on capture efficiency: the LASSO target ratio is the ratio between each of the LASSO probes and E. coli genomes. The capture efficiency is defined as cycle threshold (ct).