Damage Associated Molecular Patterns in Necrotic Femoral Head Inhibit Osteogenesis and Promote Fibrogenesis of Mesenchymal Stem Cells

Abstract

In Legg-Calvé-Perthes disease (LCPD), a loss of blood supply to the juvenile femoral head leads to extensive cell death and release of damage-associated molecular patterns (DAMPs). Over time chronic inflammatory repair process is observed with impaired bone regeneration. Increased fibrous tissue and adipose tissue are seen in the marrow space with decreased osteogenesis in a piglet model of LCPD, suggesting inhibition of osteoblastic differentiation and stimulation of fibroblastic and adipogenic differentiation of mesenchymal stem cell (MSC) during the healing process. Little is known about the DAMPs present in the necrotic femoral head and their effects on MSC differentiation. The purpose of this study was to characterize the DAMPs present in the femoral head following ischemic osteonecrosis and to determine their effects on MSC differentiation. Necrotic femoral heads were flushed with saline at 48 hours, 2 weeks and 4 weeks following the induction of ischemic osteonecrosis in piglets to obtain necrotic bone fluid (NBF). Western blot analysis of the NBF revealed the presence of prototypic DAMP, high mobility group box 1 (HMGB1), and other previously described DAMPs: biglycan, 4-hydroxynonenal (4-HNE), and receptor activator of NF-κB ligand (RANKL). ELISA of the NBF revealed increasing levels of inflammatory cytokins IL1β, IL6 and TNFα with th temporal progression of osteonecrosis. To determine the effects of NBF on MSC differentiation, we cultured primary porcine MSCs with NBF obtained by in vivo necrotic bone flushing method. NBF inhibited osteoblastic differentiation of MSCs with significantly decreased OSX expression (p=0.008) and Von Kossa/Alizarin Red staining for mineralization. NBF also significantly increased the expression of proliferation markers Ki67 (p=0.03) and PCNA (p<0.0001), and fibrogenic markers Vimentin (p=0.02) and Fibronectin (p=0.04). Additionally, NBF treated MSC cells showed significantly elevated RANKL/OPG secretion ratio (p=0.003) and increased expression of inflammtory cytokins IL1β (p=0.006) and IL6 (p<0.0001). To specifically assess the role of DAMPs in promoting the fibrogenesis, we treated porcine fibroblasts with artificial NBF produced by bone freeze-thaw method. We found increased fibroblastic cell proliferation in an NBF dose-dependent manner. Lastly, we studied the effect of HMGB1, a prototypic DAMP, and found that HMGB1 partially contributes to MSC proliferation and fibrogenesis. In summary, our findings show that DAMPs and the inflammatory cytokines present in the necrotic femoral head inhibit osteogenesis and promote fibrogenesis of MSCs, potentially contributing to impaired bone regeneration following ischemic osteonecrosis as observed in LCPD.

1. Introduction

Legg-Calvé-Perthes disease (LCPD) is a juvenile ischemic osteonecrosis of the femoral head first described in 1910 ^1,2. LCPD affects 1 in 740 boys and 1 in 3500 girls between the ages of 2 to 14³. In patients with LCPD and in a piglet model of LCPD, chronic hip synovitis and chronic inflammatory repair response with increased bone resorption and decreased new bone formation in the necrotic femoral head are observed^4–6. Uncoupling of osteogenesis and osteoclastogenesis, and increased fibrous and adipose tissues in the bone marrow have been found in the LCPD and in patients with osteonecrosis, which mechanically weaken the femoral heads^6,7. It is postulated that damage-associated molecular patterns (DAMPs) released by dying cells due to the loss of blood supply to the femoral head promote chronic inflammation and excessive bone resorption which result in the femoral head deformity^8,9.

DAMPs are endogenous alarmins released from dying cells that are recognized by pattern recognition receptors (PRRs) to activate the innate immune system^10,11. Furthermore, some DAMPs contribute to bone resorption through promoting inflammation and Receptor activator of NF-κB ligand (RANKL) activation^12,13. Not only are proteins released from the intra-cellular space of the dying cells, but DNA fragments are also released as DAMPs ^14–16. DAMPs escalate the pro-inflammatory response in the necrotic environment with activation of multiple signaling pathways^17,18, such as the NF-κB and the redox modulation pathways, to trigger innate immune responses and cell autophagy^10,19–21. Numerous DAMPs have been identified and characterized in non-osteonecrotic conditions, and the number is still increasing^22–24. Of the DAMPs studied, High mobility group box 1 (HMGB1) has been characterized as a prototypical DAMP that induces inflammation after the release from necrotic cells^25–28. HMGB1 is a nuclear protein belonging to the high mobility group (HMG) family. The family members are constitutively expressed in cells and can be found in nucleus and cytoplasm, functioning to maintain the structure of chromatin and regulate gene transcription^25,28. When necrotic cell death occurs, HMGB1 is released to extracellular space and triggers inflammatory responses. Previous studies have shown that elevated HMGB1 level is observed in patients suffering from inflammatory and autoimmune diseases^29–31. Moreover, extracellular HMGB1 plays a critical role in RANKL-induced osteoclastogenesis in vitro and in vivo murine model studies³². Biglycan, a small leucine-rich proteoglycan, is an extracellular matrix component with both structural and signal functions³³. Soluble biglycan released from dying cells is a DAMP that can modulate multiple inflammatory signaling pathways³⁴. Furthermore, soluble biglycan in plasma or synovial fluid serves as a biomarker of inflammatory diseases, such as osteoarthritis and inflammatory renal and hepatic diseases^35–38. 4-hydroxynonenal (4-HNE) is a lipid peroxidation product, which indicates oxidative stress and is also identified as a potent redox-derived DAMP to promote inflammatory response^24,39,40. RANKL is a member of the tumor necrosis factor (TNF) superfamily, and an essential factor for osteoclast differentiation and activation⁴¹. Moreover, RANKL has been recently identified as a proinflammatory modulator in a model of arthritis⁴².

We recently investigated DAMPs in synovial fluid of LCPD patients and found elevated levels of HMGB1 and IL-F6 proteins^43,44. However, the components of DAMPs present in necrotic femoral heads and temporal changes of DAMPs in the marrow space following the induction of ischemic osteonecrosis have yet to be characterized. Furthermore, it is unknown how DAMPs influence the differentiation of mesenchymal stem cells (MSC). The purpose of this study was to characterize the DAMPs present in the femoral head following ischemic osteonecrosis and to determine their effects on MSC differentiation. In this study, DAMPs-containing necrotic bone fluid (NBF) collected from a piglet model of LCPD was analyzed for the presence of DAMPs discussed above.

2. Materials and methods

2.1. Experimental design and source of necrotic bone fluid (NBF)

We obtained NBF using three methods in order to acquire adequate amount of NBF for DAMP analysis and for various short and longer-term culture experiments. The three methods are described below and the use of NBF for various experiments are summarized in table 1.

Table 1.

Three methods to produce DAMPs-containing NBF.

Method No.	Procedure	Analyses Applied
1	In vivo necrotic femoral head flushing	•Short-term cell culture  -MSC gene expression •MSC migration assay
2	Elution of necrotic femoral head retrieved from piglets euthanized at 48 hours, 2 and 4 weeks post-osteonecrosis induction	•Protein concentration •DNA concentration •ELISA •Western blot analysis
3	Artificial NBF produced using freeze-thaw method	•Long-term cell culture  -MSC osteogenesis •Fibroblast cell culture •Western blot analysis

In the Method 1, NBF was obtained by flushing the femoral heads 1 week after the induction of ischemic osteonecrosis in 5 piglets using a minimally invasive, multi-needle bone wash technique. The details of the NBF collection method are described below. The Method 1 NBF samples were used for short-term (24 hours to 4 days) cell culture experiments to test the effects of NBF on MSC gene expression and migration.

In the Method 2, NBF was obtained following the surgical induction of ischemic osteonecrosis of 11 piglets and by retrieving the necrotic femoral heads following euthanization at 48 hours (n=3), 2 weeks (n=4), and 4 weeks (n=4) after the induction of ischemic osteonecrosis. The details of the ischemia surgery and the NBF collection method are described below. The Method 2 NBF samples were used to characterize DAMPs present in the NBF and to determine the temporal changes of NBF.

In the Method 3, artificial NBF (aNBF) was produced using a well-established method previously used by others to obtain DAMPs-containing NBF in vitro^45–47. This method allowed a large amount of NBF production needed for longer term culture (up to 14 days) experiments and minimized unnecessary use and euthanization of animals. Normal piglet distal femurs were obtained immediately after euthanization using a sterile technique. The articular cartilage and growth plate surrounding the distal femoral epiphyses were removed. The bony epiphyses were then placed into a sterile freezer bag for 5 freeze-thaw cycles consisting of quick freeze in liquid nitrogen for 3 minutes followed by thawing in 37°C water bath for 30 minutes. After the freeze-thaw cycles, the bony epiphyses were cut into 5 mm³ square pieces, and washed with a double volume of saline (to bone weight) to elute the NBF. The mixture was incubated for 5 minutes, and vortexed for 1 minute. Filtration of the mixture was performed using a 40-μm blue FALCON filter (#352340) to remove large bone particles. The filtered mixture was centrifuged at 1500 rpm for 10 min and the supernatant was collected. A secondary filtration of the supernatant was performed using a 0.22-μm yellow MILLEX GV filter (#SLGV033RB) to sterilize the solution.

2.2. Surgical induction of ischemic osteonecrosis in piglets

The animal experiments were approved by the Institutional Animal Care and Use Committee (IACUC) at University of Texas Southwestern (UTSW) Medical Center. A total of 16 male Yorkshire piglets of 6–8 weeks were obtained from a local breeder and individually housed to minimize the variability of food consumption and differential weight gain, and to avoid aggressive behavior. A non-steroidal anti-inflammatory drug, carprofen, was given to animals once a day before and after surgery for 4 days for pain control. Ischemic osteonecrosis of the femoral head was surgically induced by placing a suture ligature tightly around the femoral neck after transecting the ligamentum teres^3,9,48,49.

One week after the induction of ischemic osteonecrosis, in vivo necrotic bone washing using minimally invasive multi-needle bone washing technique was performed on five piglets to collect NBF from necrotic femoral head⁸ described as Method 1. Three intraosseous needles (1.8-mm diameter) were placed into the femoral head (Fig 1) using fluoroscopic guidance under general anesthesia and sterile condition. The femoral head was flushed with saline through one needle while the wash solution was collected using another needle. Total 460 mL saline was used to flush the femoral head, and the first 3 mL was used for cell culture since it contains relatively high protein concentration.

Figure 1. X-ray of intraosseous washing of necrotic femoral head in live piglet.

X-ray image during the surgery process shows three needles are intraosseously inserted into the piglet femoral head.

To obtain the Method 2 NBF, the piglets were euthanized at 48 hours (acute necrotic phase, n=3), 2 weeks (acute inflammatory phase, n=4), and 4 weeks (chronic inflammatory phase, n=4) post-osteonecrosis induction. The piglets were euthanized by intravenous injection of pentobarbital sodium. Contralateral unoperated femoral heads were used as controls. Both control and ischemic osteonecrosis induced femoral heads were retrieved and dissected. The femoral heads were cut in half using a thin band saw and sharp knife was used to cut the femoral epiphysis into 5-mm³ pieces (weighted 0.32~1.43 g) to facilitate the elution of DAMPs from the necrotic bone. The same method used for the elution and filtration of artificial NBF was used, as described above.

2.3. Femoral head radiography and histology

After photo graphy of the femoral head specimens, X-rays were obtained using a MX-20 X-ray machine (Faxitron Bioptics LLC). The femoral heads were sectioned into two halves (anterior and posterior). The anterior half was used for the collection of DAMPs (Method 2) and the posterior half was used for histology. The posterior half was fixed in 10% neutral buffered formalin and decalcified in 14% ethylenediaminetetraacetic acid, embedded into paraffin block, sectioned at 4 μm of thickness, and stained with hematoxylin and eosin (H&E) staining.

2.4. DAMPs characterization

BCA protein assay (Pierce™ BCA Protein Assay Kit, Thermo Fisher Scientific) was used to measure the protein concentration of all NBF samples described above and the control BF (bone fluid) from normal bone. The DNA concentration of NBF was measured by NanoDrop Microvolume Spectrophotometers (Thermo Fisher Scientific). ELISA (Thermo Fisher Scientific) was used to measure IL1β, IL6, and TNFα protein levels in the control BF and NBF collected at different time points. Western blot analysis was used to compare the amount of HMGB1 (Abcam), Biglycan (Santa Cruz Biotechnology), 4-HNE (Abcam), RANKL (Abcam), and IL6 (Abcam) present in different NBF samples. In brief, SDS-PAGE was performed to separate proteins in obtained NBF samples using 12% polyacrylamide gel with equal amount of protein loaded in each well (40 micro gram). After transferring to PVDF membrane (LI-COR Biosciences), each individual component was detected by the corresponding primary antibody. Odyssey Imaging System (LI-COR Biosciences) was used to detect the signal produced by IRDye secondary antibody against primary antibody.

2.5. Assessment of MSC differentiation and migration

Porcine bone marrow cells were aspirated from the iliac crest and cultured in vitro for one week to obtain and expand MSCs. MSCs from passage 3–5 were used, and cultured in the complete medium (aMEM (Gibco) with 10% FBS and 1% P/S) in 37 °C with 5% CO₂. The medium was replaced every 2–3 days. To test the direct effect of NBF on MSC differentiation, the MSCs were treated with and without 100 μg/mL NBF for gene expression analysis for 24 hours. Total RNA was isolated with PureLink™ RNA Mini Kit (Thermo Fisher Scientific). The 500 ng of RNA from each sample was employed to synthesize cDNA using iScript™ Reverse Transcription Supermix for RT-qPCR (Bio-Rad). iTaq Universal SYBR Green Supermix (Bio-Rad) was used to quantify the mRNA level with a QuantStudio 6 Flex qPCR machine (Thermo Fisher Scientific). Primers used in this study are shown in table 2. All gene expressions were normalized to HSP90 as the housekeeping gene.

Table 2.

Quantitative RT-PCR primers used in the study.

Gene Name	Forward Primer	Reverse Primer	Comment
HSP90	GTCGAAAAGGTGGTTGTGTCG	TTTGCTGTCCAGCCGTATGT	Housekeeping
OSX Col1a1	GCTTGAGGAGGAAGCTCACTA CCAAGAGGAGGGCCAAGAAGAAGG	AGTCGTTGAGTCCCGCAGAG GGGGCAGACGGGGCAGCACTC	Osteogenic Marker
Vimentin Fibronectin	GCCCAGCTTTTCACCTCGTA AGCAAGGTCTGCTTTTGTGC	TTCCTGTCTGTGGCACCATC AAACCCACAGAACATCACAGC	Fibrogenic Marker
Adiponectin FABP4	ATGATGTCACCACTGGCAAATTC GGGCCAGGAATTTGATGAAG	GACCGTGACGTGGAAGGAGA CTTTCCATCCCACTTCTGCAC	Adipogenic Marker
IL1β IL6	CAGCCAGTCTTCATTGTTCAGG CCCACCAGGAACGAAAGAGA	GGTCATTATTGTTGTCACCGTAGT TGAAGGCGCTTGTGGAGAG	Proinflammatory Cytokine
Ki-67 PCNA	CCTCCTAACACGCCTCTCAAG TACGCTAAGGGCAGAAGATAATG	GATGGCTGAGGCTTGATGATTT CTGAGATCTCGGCATATACGTG	Proliferation Marker
RANKL OPG	TGTCAGTGCTCATGCTGCTAT TGACAACACATGTTCTGGAAGC	TGTTAACTGCTGGGGACAGAG CTCCTCACACAGGGTTACATCTAT	Osteoclastogenic Factor

Two well silicone inserts with a defined cell-free gap (ibidi GmbH) was applied for the MSC migration assay. Cells were placed into two well inserts for 24 hours, and culture-inserts were removed. Cells were treated with and without 100 μg/mL NBF, and live cell images were recorded every 24 hours to monitor the cell migration until day 4. Cell covered area was measured using ImageJ software. All data were collected in triplicate.

2.6. Assessment of osteogenic differentiation

Six-well cell culture plates (Falcon) were pre-coated with 500 μL Rat Tail Collagen Type I (0.15 mg/mL) in 0.02 M acetic acid overnight and dried at room temperature under the cell culture hood. MSCs were seeded into the plates (0.5×10⁵ cells per well). When cells reached 70–80% confluence after 2 days, osteogenic medium (complete medium supplemented with 10 mM Beta-glycerol phosphate, 50 μM ascorbic acid, and 100 nM Dexamethasone) was applied to initiate osteogenesis. Normal complete medium was applied for control cells. For NBF treated condition, 500 μg/mL NBF was added. The medium was replaced every 2–3 days for a total culture period of 14 days before harvesting the cells. The harvested cells were used for RNA isolation and quantitative mRNA analysis as described above. Alizarin Red S and Von Kossa staining were performed directly on the cell culture wells to detect mineralization.

2.7. Assessment of fibroblast proliferation

Porcine fibroblasts were obtained by digesting piglet skin tissue overnight in a cocktail digestion buffer containing 0.025% Collagenase I (invitrogen) and 0.1% Dispase (invitrogen) in the complete medium (DMEM (Gibco) with 15% FBS and 1% P/S). Cells from passage 3–5 were used, and cultured in the complete medium (aMEM with 10% FBS and 1% P/S) at 37 °C with 5% CO₂. The medium was replaced every 2~3 days. The fibroblasts were treated with 100 μg/mL or 500 μg/mL NBF. Live cell images were recorded every 24 hours until day 2 for cell proliferation quantification. Total RNA of cells was isolated for gene expression analysis.

2.8. Statistical analysis

GraphPad Prism 7.0 (GraphPad Software Inc.) was used to present data as mean ± standard deviation (SD) and perform statistical analysis. For three or more group comparisons, one-way ANOVA with post-hoc Tuk y’s mu tip comp rison t st was used. To compare two groups, unpaired t test was used. P-value < 0.05 was considered statistically significant.

3. Results

3.1. Repair process after ischemic osteonecrosis

To assess the femoral head osteonecrosis, early repair process, and morphological changes, we performed visual, radiographic, and histologic assessments at three post-osteonecrosis time points (48 hours, 2 weeks, and 4 weeks) (Fig 2). A mild femoral head deformity was present at 4 weeks post-osteonecrosis induction as shown in the x-ray and gross images (Fig 2A).

Figure 2. Bone necrosis and repair process following ischemic induction of piglet femoral head.

A) X-ray and gross images of control and necrotic femoral heads at different post-osteonecrosis time points (48 hours, 2 weeks, and 4 weeks). Mild deformity of femoral head was observed at 4-week time point. B) H&E staining images of control and necrotic femoral heads at different post-osteonecrosis time points (48 hours, 2 weeks, and 4 weeks). Green arrows indicate bone lining osteoblasts. White arrows indicate dead osteocytes. Yellow arrows indicate active bone resorption activities.

Histologic assessment of control samples showed abundant hematopoietic cells and adipocytes evenly distributed in bone marrow space, and osteoblasts lining the trabecular bone surface. At 48-hour post-osteonecrosis induction, pyknosis and karyolysis of nucleus, and disrupted cell memberane were observed in the bone marrow indicating cell necrosis; and osteoblasts were absent on the trabecular surface. At the 2-week time point, most bone marrow cells lost their cytoplasmic and nuclear staining and empty lacunae were present in the trabeculae, indicating osteocyte death. At the 4-week time point, more empty lacunae were observed, while the marrow space showed invasion of fibrovascular granulation consisting of small vessels, fibroblasts, and adipocytes in the peripheral region of the necrotic head along with osteoclasts actively resorbing the necrotic bone (Fig 2B).

3.2. Temporal changes of DAMP components in NBF

NBF samples collected at 48 hours, 2 and 4 weeks post-osteonecrosis were analyzed for total protein and DNA levels (Fig 3A). Compared to normal femoral heads, the extracellular protein content in the necrotic femoral heads was significantly decreased at 48 hours (p=0.002) and 2 weeks (p<0.0001). The protein level returned to a level comparable to the control level at 4 weeks post-osteonecrosis with no significant difference to the control group. The extracellular DNA level was significantly increased at 48 hours (p=0.002), and decreased to a level comparable to the control level at 2 and 4 weeks.

Figure 3. Characterization of NBF collected from piglet necrotic femoral heads.

A) Amounts of extracellular total protein and total DNA in the NBF collected at different post-osteonecrosis time points (48 hours, 2 weeks, and 4 weeks). B) ELISA results of inflammatory cytokins IL1β, IL6 and TNFα in the NBF collected at different post-osteonecrosis time points (48 hours, 2 weeks, and 4 weeks). C) Western blot image of HMGB1, biglycan, 4-HNE, RANKL and IL6 protein expression in the control BF, the NBF collected at 48 hours and 4 weeks post-osteonecrosis through method 2), and the aNBF produced through the method 3). (*: p<0.05, **: p<0.01, ***: p<0.001, ****: p<0.0001)

The protein level of three inflammatory cytokines, IL1β, IL6, and TNFα, were measured by ELISA (Fig 3B). At 48 hours, the cytokines levels were undetectable. At 2 and 4 weeks, the cytokine levels were increased with signficantly higher levels of IL1β and TNFα seen at 4 weeks compared to the control.

We assessed the presence of prototypic DAMP, HMGB1, other DAMPs, biglycan, 4-HNE, RANKL, and a representative inflammatory cytokine, IL6, at 48 hours and 4 weeks post-osteonecrosis, and compared these with the control BF and the aNBF by Western blot analysis (Fig 3C). These DAMPs were markedly increased in the NBF compared to the control BF at both time points. In addition, we found that the NBF collected by the Method 2 and the aNBF collected by the Method 3 both contained these DAMP components and IL6.

3.3. The effects of DAMPs on MSC differentiation

Osteogenic, fibrogenic, and adipogenic gene markers were measured after treating MSCs with NBF (100 μg/mL) (Fig 4A). The expression of osteogenic marker, Osterix (OSX), was significantly decreased (p=0.008), and the expression of fibrogenic markers, vimentin and fibronectin, were significantly increased (p=0.02 and p=0.04, respectively). The expression of adipogenic markers, adiponectin (p=0.1) and FABP4 (p=0.06), were increased but not significantly changed. The NBF treatment significantly increased the RANKL/OPG ratio (p=0.003) expressed by MSC. The expression of proinflammatory cytokines, IL1β (p=0.006) and IL6 (p<0.0001), and the expression of proliferation markers, Ki67 (p=0.03) and PCNA (p<0.0001), were also significantly increased after the NBF treatment. Moreover, MSC cell migration activity was significantly elevated at 48 hours (p=0.04) and 96 hours (p=0.003) with the NBF treatment (Fig 4B and C).

Figure 4. Effects of NBF on MSC gene expression and migration.

A) mRNA gene expression results of MSCs after 24 hours NBF treatment. B) Cell migration images at day 0, day 2, and day 4 after NBF treatment. C) Cell migration quantification at day 0, day 2, and day 4 after NBF treatment (n=3). (*: p<0.05, **: p<0.01, ***: p<0.001, ****: p<0.0001)

3.4. The effects of DAMPs on osteogenesis

MSCs were treated with the artificial NBF (aNBF, 500 μg/mL) in a longer-term osteogenic culture condition. After 14 days, cells cultured in an osteogenic media with NBF showed decreased Alizarin Red S and Von Kossa staining indicating reduced mineralization compared to the control condition (Fig 5A). The mRNA levels of all three osteogenic markers, Col1a1, ALP, and OCN, were significantly decreased in the NBF treated condition compared to the control condition (osteogenic media alone) (Fig 5B), consistent with the inhibition of osteogenesis indicated by Alizarin Red S and Von Kossa staining results.

Figure 5. Effects of NBF on MSC osteogenesis process.

A) Alizarin Red S and Von Kossa staining of MSCs in three conditions after 14-day osteogenesis process. i. control (Con), cultured in basal completed medium; ii. osteogenesis (Os), cultured in osteogenic medium; iii. osteogenesis with NBF (Os+NBF), cultured in osteogenic medium with NBF. B) Osteogenesis marker genes expression of MSC in three treatments after 14-day osteogenesis process. (*: p<0.05, **: p<0.01, ***: p<0.001, ****: p<0.0001)

3.5. The effects of DAMPs on fibrogenesis

To test the effects of aNBF on fibrogenesis, porcine skin fibroblasts were cultured with aNBF (100 and 500 μg/mL) for 48 hours. The number of cells were counted before treatment and at 24 and 48 hours after treatment (Fig 6A and B). The aNBF treatment t 500 μg/mL significantly increased the number of fibroblasts (p=0.005) compared to the control (no NBF).

Figure 6. Effects of NBF on fibroblast cells.

A) Cell images before, and 2 days after NBF treatment. B) Cell number count before, and after 1 day and 2 day of NBF treatment (n=3). C) Proliferation cytokines and proliferation marker genes expression of fibroblasts after 2 day NBF treatment. (*: p<0.05, **: p<0.01, ***: p<0.001, ****: p<0.0001)

The expression profile of proinflammatory cytokines (IL1β and IL6) and proliferation markers (Ki-67 and PCNA) were assessed by qPCR (Fig 6C). IL6 expression was significantly increased after the aNBF treatment at both 100 (p=0.003) and 500 μg/mL (p<0.0001). IL1β expression remained unchanged. PCNA (p<0.0001) expression was significantly increased only at the higher concentration of NBF (500 μg/mL), whereas Ki-67 expression was significantly increased at low and high concentrations (p=0.01 and p=0.002) compared to the control. Collectively, the NBF promoted fibroblast proliferation and induced IL6 expression.

3.6. The effects of HMGB1 on MSC differentiation

HMGB1 is a prototypical DAMP found in NBF (Fig 3C). Previous studies of non-osteonecrotic conditions showed that HMGB1 stimulates multiple inflammatory signaling responses^17,18,50,51. To assess the effect of HMGB1 on MSCs, we used recombinant human HMGB1 (1 μg/mL) to treat porcine MSCs for 24 hours. HMGB1 significantly increased the expression of fibrogenic markers, vimentin (p=0.02) and fibronection (p=0.03), adipogenic marker FABP4 (p=0.02), and the cell proliferation marker Ki-67 (p=0.005). HMGB1 did not significantly affect the inflammatory cytokine IL1β (p=0.2) and the RANKL/OPG ratio (p=0.3) (Fig 7). Unlike MSCs treated with NBF (Fig 4A), HMGB1 alone did not inhibit the expression of osteogenic markers OSX (p=0.1) and Col1a1 (p=0.8).

Figure 7. Effects of rhHMGB1 on MSC gene expression.

mRNA gene expression results of MSCs after 24 hours rhHMGB1 protein treatment. (*: p<0.05, **: p<0.01, ***: p<0.001, ****: p<0.0001)

4. Discussion

Ischemic osteonecrosis of the femoral head leads to extensive cell death and release of DAMPs, however, very little is known about the components of DAMPs released by the dying cells in the ischemic bone and how they affect MSC differentiation. In this study, we identified several DAMPs present in the necrotic bone including HMGB1, biglycan, 4-HNE, RANKL, and inflammatory cytokines (IL1β, IL6, and TNFα). We found temporal changes in the total extracellular protein and DNA levels in the NBF. We also found that the DAMPs-containing NBF affects MSC differentiation by inhibiting osteogenesis and promoting fibrogenesis. Moreover, DAMPs stimulated the proliferation and migration of MSCs. The NBF also increased inflammatory cytokines, IL1β and IL6, and increased RANKL/OPG expression ratio (Fig 8). To our knowledge, this study is the first to report on the DAMPs present in the necrotic bone and the effects of the DAMPs-containing NBF on MSC differentiation. These findings provide new insight into ischemic osteonecrosis and potential negative effects of the DAMPs on the repair process following ischemic osteonecrosis.

Figure 8. The scheme of effects of DAMPs on MSC differentiation.

Our study revealed that DAMPs temporally change after the induction of osteonecrosis. As shown in figure 3, we detected a sharp increase of free extracellular DNA at 48 hours after the induction of ischemic osteonecrosis. Acute extracellular DNA increase indicates irreversible cell damage which is phenotypical in necrotic cell death. In an in vitro necrotic cell culture model of Jurkat T cells, DNA release was detected within one hour after cell death^45,52. Similarly, in an in-vivo freezing-thawing of rat thymus necrosis model, DNA damage with 5’ overhangs is present one hour after inducing cell necrosis⁵². In our study, the DNA levels were decreased at 2-week and 4-week timepoints, suggesting either degradation or clearance or both, which may be related to the necrotic bone repair process. In contrast, the protein content in the NBF was decreased at the 48-hour time point but increased to a normal level at 4 weeks. The findings suggest protein degradation in the acute phase of ischemic osteonecrosis with recovery of the protein level associated with the repair process as the cells involved with the immune and repair responses invade the necrotic marrow space and release various proteins. The ELISA of NBF also revealed temporal increase in the levels of pro-inflammatory cytokines (IL1β, IL6 and TNFα) at later timepoints, further supporting the notion of immune and repair response to the necrotic bone microenvironment over time.

One of the significant findings of this study was that DAMPs-containing NBF alters the fate specification and differentiation of MSCs. NBF treatment decreased osteogenic gene expression, increased fibroblast differentiation, and inhibited mineralization in the in vitro MSC culture experiments. NBF also increased RANKL/OPG levels in MSCs. Interestingly, a recent study showed that necrotic osteocyte triggers increased osteoclast-mediated bone loss in the Dmp1-DTR (diphtheria toxin) genetic mouse model⁵³. The increased osteoclast activity was mediated by SP130, one of the DAMPs secreted by dying osteocytes. Further studies are warranted to delineate how different components of DAMPs orchestrate osteoclast activity and necrotic bone resoprtion and remodeling following ischemic osteonecrosis. Increased osteoclastogenesis and decreased osteoblastogenesis observed in our in vitro experiments may aid in our understanding of the uncoupling and imbalance of osteogenesis (decreased) and bone resorption (increased) observed in the piglet model of LCPD^5,54. Our findings of fibroblast differentiation and proliferation with NBF treatment is also consistent with the previous findings from the piglet model of LCPD^6,9, which showed active fibrogenesis and the persistence of fibrovascular tissue in the recovering necrotic bone marrow.

It is important to note that the NBFs used in this study were collected using three methods for the following reasons. To investigate the effects of DAMPs on short-term MSC differentiation, we used the NBF from the method 1 which was obtained by directly flushing out the necrotic femoral head in vivo. The NBF obtained through this method was ideal for short-term cell culture experiments but was too diluted for protein characterization. To determine the contents of DAMPs by protein analysis (western blot and ELISA), we collected NBF directly from necrotic femoral heads after the tissue retrieval using the method 2. A small volume (0.7–3 ml) of saline was used to flush the necrotic bone to ensure that NBF with adequate protein concentration can be obtained. For long-term cell differentiation assays that require a large amount of NBF, we used the aNBF produced using the method 3, which is an established freeze-thaw method previously described by others^45–47,55. Multiple cycles of freezing and thawing have been shown to break cell membrane and cause the release of DNA and protein from inside of cells. In vitro and in vivo studies have demonstrated the validity of this method to study the effects of DAMPs.^{45–47,52,55} Furthermore, we compared the NBF obtained from the necrotic femoral head and the artificial NBF obtained from the freeze-thaw method and found that both NBFs contained similar DAMPs and inflammatory cytokine IL6 (Figure 3C).

HMGB1 is a prototypic DAMP released from the necrotic cells and not the apoptotic cells²⁷. HMGB1 has been shown to mediate a series of pro-inflammatory responses both in vivo and in vitro. It also promotes macrophage maturation and differentiation, and stimulates the secretion of inflammatory cytokines, such as TNF-α and IL6, from dendritic cells in culture and in a mouse model of liver necrosis⁵⁶. Recently, our group also reported a positive correlation between the HMGB1 and IL6 levels in the synovial fluid of patients with LCPD^43,44. This current study investigated the effects of HMGB1 on MSC differentiation and found that HMGB1 partially mediates the effects of NBF on MSCs via increasing fibrogenesis and adipogenesis markers but not altering osteogenesis and osteoclastogenesis markers. HMGB1 has been reported to have synergistic effects with other inflammatory molecules to modulate the inflammatory response⁵¹. Thus, we postulate that the effects of NBF on MSCs differentiation may be induced by a synergistic effect of HMGB1 and other DAMPs or inflammatory cytokines present in the necrotic tissue.

This study does have some limitations. Firstly, only select DAMPs and inflammatory cytokines were studied in the NBF samples. Rather than trying to be comprehensive, we selected several well-known DAMPs. A comprehensive investigation of DAMPs is not feasible and is beyond the scope of this study. Secondly, we tested the effects of DAMPs on differentiation, proliferation, and migration of MSCs. The effects of DAMPs on other cell types, such as endothelial cells and macrophages were not investigated. In our future research, we plan to study the effects of DAMPs on additional cell types.

In conclusion, the necrotic bone fluid contained DAMPs such as extracellular DNA, HMGB1, biglycan, 4-HNE, RANKL, and inflammatory cytokines such as IL1β, IL6, and TNFα. The content of the NBF changed over time. NBF decreased osteogenesis and increased fibrogenesis of MSCs. To our knowledge, this study is the first to characterize the components and effects of DAMPs on MSC differentiation in the context of ischemic osteonecrosis. We believe that this study provides a foundation for future investigation of ischemic osteonecrosis related to DAMPs and may stimulate the development of new biological treatments targeting DAMPs for the treatment of ischemic osteonecrosis.

Highlights.

NBF from necrotic femoral head contained DAMPs and inflammatory cytokines.

The content of NBF changed over time mediating a chronic inflammatory response.

NBF decreased osteogenesis and increased fibrogenesis of MSCs.