Appendix 1—key resources table.
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| strain, strain background (Escherichia coli) | XL1-Blue Competent Cells | Thermo-competent | Prepared in the lab | Used to prepare plasmid DNA |
| Strain, strain background (S. frugiperda) | Sf9 insect cells | Thermo Fisher | Cat# 11496015 | |
| Strain, strain background (Trichoplusia ni) | High-Five insect cells | Thermo Fisher | Cat# B85502 | |
| strain, strain background (Escherichia coli) | DH10EMBacY | Geneva biotech | ||
| genetic reagent (Mouse) | Ncaph2tm1a(EUCOMM)Wtsi, ZP3-Cre |
Houlard et al., 2015
DOI:10.1038/ncb3167 |
Isolation of Mouse oocytes deleted for Ncaph2 | |
| cell line (Mouse) | ES-E14 mouse embryonic stem cells | https://web.expasy.org/cellosaurus/CVCL_C320 | RRID:CVCL_C320 | |
| cell line (Mouse) | E14-Ncaph2Halo/Halo | This paper | E14 cells homozygous Halo tag Cterminal NCAPH2 | |
| cell line (Mouse) | E14-Ncaph2Halo/Halo, Mcph1Δ/Δ | This paper | E14 cells homozygous Halo tag C-terminal NCAPH2, deleted for Mcph1 | |
| cell line (Mouse) | E14-Ncaph2GFP/GFP | This paper | E14 cells homozygous GFP tag C-terminal NCAPH2 | |
| cell line (Mouse) | E14-Ncaph2GFP/GFP Mcph1Δ | This paper | E14 cells homozygous GFP tag C-terminal NCAPH2, deleted for Mcph1 | |
| cell line (Mouse) | E14- Ncaph2Halo/Halo Mcph1GFP/GFP | This paper | E14 cells homozygous GFP tag C-terminal MCPH1 and Halo tag NCAPH2, | |
| cell line (Mouse) | E14- Ncaph2Halo/Halo Mcph1ΔCENGFP/ΔCENGFP | This paper | E14 cells homozygous GFP tag C-terminal MCPH1 deleted of central domain,and Halo tag NCAPH2, | |
| cell line (Mouse) | E14-SCC1Halo/Halo, Ncaph2GFP/GFP,WaplLox/Lox, Rosa26CreERT2-LoxSTOPTEV/ CreERT2-LoxSTOPTEV | This paper | See Figure 10 | |
| cell line (Mouse) | E14-SCC1Halo/Halo, Ncaph2GFP/GFP,WaplLox/Lox, Rosa26CreERT2-LoxSTOPTEV/ CreERT2-LoxSTOPTEVMcph1Δ/Δ | This paper | See Figure 10 | |
| transfected construct (mouse) | pUC19-NCAPH2 Halo TV | This paper | Targeting Halo tag C-terminal Ncaph2 | |
| transfected construct (mouse) | pUC19-NCAPH2 GFP TV | This paper | Targeting GFP tag C-terminal Ncaph2 | |
| transfected construct (mouse) | pUC19-MCPH1 GFP TV | This paper | Targeting GFP tag C-terminal MCPH1 | |
| transfected construct (mouse) | pUC19-MCPH1 ΔCEN TV | This paper | Targeting deletion of the central domain of MCPH1 | |
| transfected construct (mouse) | pUC19-SCC1 Halo TV | This paper | Targeting Halo tag C-terminal SCC1 | |
| transfected construct (mouse) | pUC19-Rosa26 STOPLoxTEV TV | This paper | Targeting the insertion of the STOP-Lox-TEV cassette at Rosa 26 | |
| transfected construct (mouse) | pUC19-WAPL TEV LOX TV | This paper | Targeting the TEV sites and the LoxP sites in Wapl | |
| antibody | NCAPH2 (rabbit polyclonal) | Produced on demand by Eurogentec | WB: (1/1000) | |
| antibody | SCC1 (mouse monoclonal) | Millipore | 53 A303 | WB: (1/1000) |
| antibody | SMC2 (rabbit monoclonal) | Cell Signaling Technology | D23C5 | WB: (1/500) |
| antibody | Lamin B1 (rabbit monoclonal) | Abcam | Ab133741 | WB: (1/1000) |
| antibody | MCPH1 (rabbit monoclonal) | Cell Signaling Technology | D38G5 | WB: (1/1000) |
| antibody | CREST (human autoantibody) | Immunovision | HCTO-100 | IF: (1/500) |
| antibody | H3PS10 (mouse monoclonal) | Millipore | 3 H10 | WB: (1/1000) IF: (1/2000) |
| antibody | ΔH2AX (mouse monoclonal) | Millipore | JBW301 | WB: (1/1000) IF: (1/500) |
| antibody | CDK1 (rabbit polyclonal) | Cell Signaling Technology | 77,055 | WB: (1/1000) |
| antibody | Phospho-CDK1 (rabbit polyclonal) | Cell Signaling Technology | 9,111 | WB: (1/1000) |
| antibody | WAPL (rabbit polyclonal) | J.M. Peters Lab | WB: (1/1000) | |
| antibody | GFP (rabbit polyclonal) | Abcam | Ab290 | WB: (1/1000) IF: (1/500) |
| antibody | PK-Tag (mouse monoclonal) | Biorad | MCA 1360 G | WB: (1/1000) |
| antibody | Cyclin B1 (rabbit monoclonal) | Cell Signaling Technology | 4138T | IF: (1/200) |
| antibody | NCAPD3 (rabbit polyclonal) | Bethyl Laboratories | A300-604A-M | WB: (1/1000) |
| antibody | AlexaFluor-488 secondary antibody anti mouse | Life Technology | A-11001 | Secondary antibody for IF |
| antibody | AlexaFluor-488 secondary antibody anti rabbit | Life Technology | A-11008 | Secondary antibody for IF |
| antibody | AlexaFluor-594 secondary antibody anti mouse | Life Technology | A-11005 | Secondary antibody for IF |
| antibody | AlexaFluor-594 secondary antibody anti rabbit | Life Technology | A-11012 | Secondary antibody for IF |
| antibody | mouse anti-CAP-D3 antibody | Santa Cruz | Sc-81597 | WB (1:1000) |
| antibody | goat DyLight 800 florescent anti-mouse secondary antibodies | Cell Signaling Technology | Cat #5,257 | WB (1:5000) |
| recombinant DNA reagent | Mouse Ncaph2 cDNA | Origene | MC200537 | Initial cDNA used for cloning in pRNA |
| recombinant DNA reagent | Mouse Mcph1 cDNA | Dharmacon | 5697978 | Initial cDNA used for cloning in pRNA |
| recombinant DNA reagent | Mouse SMC2 cDNA | Source Bioscience | IRAV p968E12162D | Initial cDNA used for cloning in pRNA |
| recombinant DNA reagent | pRNA-NCAPH2-GFP | Houlard et al., 2015 DOI:10.1038/ncb3167 | In vitro transcription of NCAPH2 mRNA for mouse oocyte injection | |
| recombinant DNA reagent | pRNA-Mad2 | Houlard et al., 2015 DOI:10.1038/ncb3167 | In vitro transcription of Mad 2 mRNA for mouse oocyte injection | |
| recombinant DNA reagent | pRNA-H2b-mCherry | Houlard et al., 2015 DOI: 10.1038/ncb3167 | In vitro transcription of H2b-mCherry mRNA for mouse oocyte injection | |
| recombinant DNA reagent | pRNA-MCPH1 | This paper | In vitro transcription of mouse MCPH1 mRNA for mouse oocyte injection | |
| recombinant DNA reagent | pRNA-MCPH1-Δ200 | This paper | In vitro transcription of mouse MCPH1 deleted of the N-terminal 200aa mRNA for mouse oocyte injection | |
| recombinant DNA reagent | pRNA-Fusion SMC2-NCAPH2 | This paper | In vitro transcription of the fusion SMC2-NCAPH2 mRNA for mouse oocyte injection | |
| recombinant DNA reagent | pRNA-TEV | Houlard et al., 2015 DOI:10.1038/ncb3167 | In vitro transcription of TEV mRNA for mouse oocyte injection | |
| recombinant DNA reagent | pSptCas9(BB)–2A-Puro | Addgene | 62,988 | Cloning of the SgRNA |
| recombinant DNA reagent | pUC19 | NEB | Cloning of the targeting construct for CRISPR/Cas9 targeting | |
| Recombinant DNA reagent | pLIB | Jan-Michael Peters lab, IMP | Addgene plasmid # 80,610 | |
| Recombinant DNA reagent | pLIB MCPH1 | Genscript | ||
| Recombinant DNA reagent | pET His6 MBP TEV LIC cloning vector | Scott Gradia lab, UC Berkeley | Addgene plasmid # 29,656 | |
| Recombinant DNA reagent | pET His6 MBP MCPH1 1–435 | This study | ||
| Recombinant DNA reagent | pET His6 MBP MCPH1 1–195 | This study | ||
| Recombinant DNA reagent | pET His6 MBP MCPH1 196–435 | This study | ||
| Recombinant DNA reagent | pET His6 MCPH1 1–435 MBP | This study | ||
| sequence-based reagent | GGTGGAAAGTAGTATATACC | This paper | Sg RNA used for: NCAPH2-GFP | |
| sequence-based reagent | GGTGGAAAGTAGTATATACC | This paper | Sg RNA used for: NCAPH2-Halo | |
| sequence-based reagent | GGTGTGCAATTCCTAGTGTG | This paper | Sg RNA used for: MCPH1 deletion Sg5' | |
| sequence-based reagent | AGCTGTTCCTTAGAACACGA | This paper | Sg RNA used for: MCPH1 deletion Sg3' | |
| sequence-based reagent | ACAGTGAGACATCTACAATG | This paper | Sg RNA used for: MCPH1-GFP | |
| sequence-based reagent | CATGGATTTCTCCGGTGAAT | This paper | Sg RNA used for: STOP-TEV | |
| sequence-based reagent | AATGGGTGCTTATAATTAGC | This paper | Sg RNA used for: WAPL-Lox-TEV Sg5' | |
| sequence-based reagent | ACAATGTCACAATGGCTCAT | This paper | Sg RNA used for: WAPL-Lox-TEV Sg3' | |
| sequence-based reagent | ATAATATGGAACCGTGGTCC | This paper | Sg RNA used for: SCC1-Halo | |
| sequence-based reagent | cgttgaggcttcttcctatg | This paper | Sg RNA used for: DELCEN-MCPH1 | |
| sequence-based reagent | AATGGGTGCTTATAATTAGC and ACAATGTCACAATGGCTCAT | This paper | Sg RNA used for: TEV sites in Wapl | |
| peptide, recombinant protein | 5FAM-MCPH1407-422 | Genscript | ||
| peptide, recombinant protein | MCPH1407-422 | Genscript | ||
| peptide, recombinant protein | MCPH1407-422pS417 | Genscript | ||
| commercial assay or kit | Click-iT EdU Alexa Fluor 488 Imaging kit | In vitrogen | C10337 | EdU fluorescent labeling |
| commercial assay or kit | Gibson assembly | NEB | E5510S | Cloning kit |
| commercial assay or kit | GFP-trap agarose beads | Chromotek | GTA-10 | GFP tagged protein purification |
| Commercial assay or kit | HiTrap Q HP | cytiva | Cat #17–0407 | |
| Commercial assay or kit | HiTrap Heparin HP | cytiva | Cat #17–0407 | |
| Commercial assay or kit | StrepTrap HP | cytiva | Cat #28–9075 | |
| Commercial assay or kit | Superose 6 Increase 10/300 GL | cytiva | Cat #29-0915-96 | |
| Commercial assay or kit | Superdex 200 Increase 10/300 GL | cytiva | Cat # 28990944 | |
| Commercial assay or kit | HiLoad 16/60 Superdex 200 | GE Healthcare | Cat# GE28-9893-35 | |
| Commercial assay or kit | EnzChek phosphate assay kit | Invitrogen | Cat# E6 | |
| Commercial assay or kit | 4%–12% NuPAGE Bis-Tris gels | Invitrogen | Cat #NW04125 | |
| Commercial assay or kit | Color Prestained Protein Standard, Broad Range 11–245 kDa | NEB | Cat # P7719 | |
| Commercial assay or kit | Pierce Silver Stain Kit | Thermo Scientific | Cat # 24,612 | |
| Commercial assay or kit | InstantBlue Coomassie Protein Stain | Abcam | Cat #ab119211 | |
| Chemical compound, drug | cellfectin II | Gibco, Thermo Fisher | Cat #10362100 | |
| Chemical compound, drug | FBS | Gibco, Thermo fisher | Cat #10082139 | |
| Chemical compound, drug | Pierce Protease Inhibitor Tablets | Thermo Scientific | Cat #A32965 | |
| Chemical compound, drug | Benzonase | millipore | Cat #E1014 | |
| Chemical compound, drug | HisPur Ni-NTA Resin | Thermo Scientific | Cat #88,221 | |
| Chemical compound, drug | Strep-tactin Sepharose resin | Iba-lifesciences | Cat # 2-1201-002 | |
| chemical compound, drug | HALO-PROTAC | Promega | CS2072A01 | In vivo degradation of Halo-NCAPH2 |
| chemical compound, drug | Halo-TMR | Promega | G8251 | Halo tagged protein detection |
| chemical compound, drug | Halo-JFX554 | Grimm et al., 2021 DOI:10.1021/jacsau.1c00006 | Halo tag detection by fluorescence | |
| chemical compound, drug | RO-3306 | Sigma | SML0569 | CDK1 inhibitor |
| chemical compound, drug | Lipofectamine 2000 | Thermofisher | 11668030 | E14 transfection reagent |
| chemical compound, drug | Q5 DNA polymerase | NEB | M0491L | PCR amplification |
| software, algorithm | CRISPOR | http://crispor.tefor.net/crispor.py | Guide RNA design | |
| software, algorithm | EasyFRAP | http://easyfrap.vmnet.upatras.gr | FRAP data analysis | |
| software, algorithm | Fiji 2.0.0-rc-49/1.52i | NIH Image | http://fiji.sc/ | Image analysis and quantification |
| Software | Image studio | Li-Cor |