LAIR-1 acts as an immune checkpoint on activated ILC2s and regulates the induction of airway hyperreactivity

Abstract

Background:

Type-2 innate lymphoid cells (ILC2s) are relevant players in type-2 asthma. They initiate eosinophil infiltration and airway hyperreactivity (AHR) through cytokine secretion. Leukocyte-associated immunoglobulin-like receptor 1 (LAIR-1) is an inhibitory receptor considered as an immune checkpoint in different inflammatory diseases.

Objective:

Here we investigated the expression of LAIR-1 and assessed its role in human and murine ILC2s.

Methods:

WT and LAIR-1 KO mice were intranasally challenged with IL-33 and pulmonary ILC2s were sorted to perform an ex-vivo comparative study, based on RNA sequencing and flow cytometry. We next studied the impact of LAIR-1 deficiency on AHR and lung inflammation using knock-out mice and adoptive transfer experiments in Rag2^−/− Il2rg^−/− mice. Knockdown antisense strategies and humanized mice were used to assess the role of LAIR-1 in human ILC2s.

Results:

We have demonstrated that LAIR-1 is inducible on activated ILC2s and downregulates cytokine secretion and effector function. LAIR-1 signaling in ILC2s was mediated via inhibitory pathways including SHP1/PI3K/AKT and LAIR-1 deficiency led to exacerbated ILC2-dependent AHR in IL-33 and Alternaria alternata models. In adoptive transfer experiments, we confirmed the LAIR-1-mediated regulation of ILC2s in vivo. Interestingly, LAIR-1 was expressed and inducible in human ILC2s and knockdown approaches of Lair1 resulted in higher cytokine production. Finally, engagement of LAIR-1 by physiological ligand C1q, significantly reduced ILC2-dependent AHR in a humanized ILC2 murine model.

Conclusion:

Our results unravel a novel regulatory axis in ILC2s with the capacity to reduce allergic AHR and lung inflammation.

Graphical Abstract

Capsule summary:

This study demonstrates for the first time the role of LAIR-1 as an inhibitory immune receptor on pulmonary ILC2s and highlights LAIR-1 capacity to downregulate allergic asthma.

Introduction

Type-2 innate lymphoid cells (ILC2s) are newly discovered tissue-resident immune cells belonging to the family of non-cytotoxic ILCs. Unlike B and T cells, ILC2s lack the expression of lineage markers and specific antigen receptors^1,2. Mainly residing in adventitial cuffs within collagen-rich regions, ILC2s are in tight interaction with resident structural cells that release non-specific alarmins including IL-33, IL-25 and thymic stromal lymphopoietin (TSLP), to trigger immune activation under stress conditions^3–6. In particular, necrosis and active necroptosis are the principal mechanisms for IL-33 secretion that is associated with increased pulmonary epithelial permeability^7,8. Pulmonary ILC2s are associated with adventitial stromal cells, known as a fibroblast-like subset implicated in alarmin secretion and matrix remodeling⁴. Due to their location, ILC2s are among the first immune responders to these endogenous danger signals, promoting their activation and proliferation. Activated ILC2s mimic T-helper 2 (Th2) cells in secreting copious amounts of classical Th2 effector cytokines including IL-5, IL-9 and IL-13^2,9. During the last decade, numerous studies have evidenced the role of ILC2s in different diseases such as type-2 diabetes mellitus^10,11, chronic rhinosinusitis¹², liver fibrosis¹³, but mainly in allergic asthma type-2 inflammation^14–16.

Allergic asthma is the most frequent type of asthma characterized by airway hyperreactivity (AHR) and Th2-mediated immune responses. Exposure to exogenous stimuli, including inhaled allergens, triggers specific symptoms ranging from chest pain, cough and wheezing to acute bronchoconstriction in life-threatening attacks^17,18. The inflammatory cascade is initiated with alarmin secretion in the lungs, which instructs a type-2 response associated with massive recruitment of eosinophils in response to IL-5^19,20. Representing key upstream players, ILC2s have become potential therapeutic target in asthma²¹. Novel strategies are considering the modulation of inhibitory and co-stimulatory receptors defining activated ILC2s, such as CD200R²², TIGIT²³, TNFR2²⁴, ICOS and ICOS-L²⁵. In this context, we have recently demonstrated the therapeutic potential of a novel programmed cell death protein 1 (PD-1) agonist in allergic asthma through the downregulation of ILC2s²⁶. Other inhibitory receptors are yet to be explored in ILC2s, such as the Leukocyte-associated immunoglobulin-like receptor 1 (LAIR-1).

LAIR-1, also known as CD305, was first discovered in 1997 and described as a novel inhibitory receptor having a single immunoglobulin-like domain and a cytoplasmic tail, equipped with two immuno-receptor tyrosine-based inhibitory motifs (ITIMs)²⁷. LAIR-1 is broadly expressed and inhibits the activation of different immune populations including B and T lymphocytes, Natural killers (NKs), dendritic cells (DCs) and monocytes^27–31. It was reported that LAIR-1 binds to collagens with high affinity through the conserved sequence of Gly-Pro-Hyp collagen repeats³² and a single residue arginine 65³³. Moreover, collagen was reported to induce and enhance the expression of LAIR-1³⁴. The first component of complement C1q also contains a collagen-like region (CLR) and is therefore considered as a functional ligand for LAIR-1 among other immune receptors^35–37. As an ITIM-containing receptor, LAIR-1 engagement mainly leads to Src homology phosphatase-1 (SHP1) recruitment, promoting the transduction of negative signaling^27,30,38. To date, studies have demonstrated a critical role for LAIR-1 in the immune imbalance defining autoimmune diseases and cancers. LAIR-1 crosslinking limits rheumatoid arthritis (RA)³⁴ and systematic lupus erythematosus (SLE) progression³¹, while it decreases immune cell cytotoxicity and improves oncogenic resistance in cancer^39,40.

In the present study, we highlighted for the first time two major findings. First, we demonstrated that LAIR-1 is inducible on pulmonary ILC2s and controls their activation mainly through signal transduction downstream of SHP-1. Second, we used the knockout mouse to assess the protective anti-inflammatory role of LAIR-1 in ILC2-dependent AHR. In a translational approach, we also demonstrated a major role for LAIR-1 in the regulation of human ILC2s both in vitro and in vivo utilizing a humanized mouse model. Therefore, our data clearly introduced LAIR-1 as an inhibitory receptor in ILC2s that could serve as a potential therapeutic target to treat ILC2-related disorders including asthma and allergic diseases.

Methods

Mouse experiments

All mice were bred in the animal facility of the Keck School of Medicine, University of Southern California (USC). Experimentation protocols were approved by the USC Institutional Animal Care and Use Committee and conducted in accordance with the principles of the Declaration of Helsinki. Wild-type (WT) C57BL/6, Lair1 knock-out (LAIR-1 KO) and Rag2/Il2rg double knockout (Rag2^−/− Il2rg^−/−) mice were purchased from Jackson Laboratory (Bar Harbor, ME). Six to eight-week-old aged- and sexed-matched mice were used in the study.

Tissue digestion and pulmonary ILC2 sorting

Mice were intranasally (i.n.) challenged on 3 consecutive days with 0.5 or 1 μg per mouse in 50 μL of carrier-free recombinant mouse (rm)-IL-33 (ThermoFisher) or PBS. On day 4, lungs were collected and processed as described previously^26,41. Briefly, lung tissue was cut into small pieces and incubated in type IV collagenase (400 U/ml; Worthington Biochemicals) at 37 °C for 60 min. To obtain single-cell suspension, lung tissue digest was passed through a 70-μm cell strainer (Falcon). In some experiments, blood, bone marrow, ear skin and visceral adipose tissue were collected and prepared for flow cytometry, as previously described^11,42. The following antibodies were used to identify and sort pulmonary ILC2s: APC-Cy7 anti-mouse CD45 (clone 30-F11), PE-Cy7 anti-mouse CD127 (clone A7R34) (both from BioLegend), PerCP-eFluor710 anti-mouse ST2 (clone RMST2-2; eBioscience), PE anti-mouse LAIR-1 (clone 113; ThermoFisher Scientific), and FITC anti-mouse lineage cocktail including TCR-γδ (clone eBioGL3; eBioscience), TCR-β (clone H57-597), CD3e (clone 145-2C11), CD45R (clone RA3-6B2), Gr-1 (clone RB6-8C5), CD11c (clone N418), CD11b (clone M1/70), Ter119 (clone TER-119), FcɛRI (clone MAR-1), CD5 (clone 53–7.3) and NKp46 (clone 29A1.4) (all from BioLegend). APC anti-mouse KLRG1 (clone 2F1/KLRG1; BioLegend), PE anti-mouse MAIR-V (clone TX70; BioLegend), APC anti-mouse CD200R (clone OX110; Invitrogen) and APC anti-mouse PD-L1 (clone 10F.9G2; BioLegend) were added for immunophenotyping experiments. When indicated, BV421 anti-mouse CD135 (Flt3; clone A2F10), APC anti-mouse LPAM-1 (Integrin α4β7; clone DATK32) and BV510 anti-mouse CD25 (clone PC61) (all from BioLegend) were used to identify ILC2 precursors in the bone marrow. Fluorescent live/dead fixable stains (ThermoFisher) were used in all experiments to exclude dead cells, according to manufacturer’s instructions. Pulmonary ILC2s were sorted on a FACSARIA III system (Becton Dickinson). The sort purity was always ≥95% and the percentage of LAIR-1⁺ ILC2s from WT mice was ~25–35%. Cells were cultured in RPMI (Gibco) supplemented with 10% heat-inactivated fetal bovine serum and 100 units per mL penicillin–streptomycin (GenClone).

RNA-sequencing (RNAseq)

Sorted ILC2s were incubated (5 × 10⁴/mL) with rm-IL-2 (10 ng/mL) and rm-IL-7 (10 ng/mL) for 24 h. Total RNA was isolated using MicroRNAeasy (Qiagen). In total, 10 ng of input RNA was used to produce cDNA for downstream library preparation. Samples were sequenced on a NextSeq 500 (Illumina) system. Raw reads were aligned, normalized and further analyzed using Partek Genomics Suite software, version 7.0 Copyright; Partek Inc. Normalized read counts were tested for differential expression using Partek’s gene-specific analysis (GSA) algorithm. RNA sequence data that support the findings of this study have been deposited in Genbank with the primary accession code GSE171819.

Intracellular staining and cytokine quantification

ILC2s were cultured in the presence of rm-IL-2 (10 ng/mL) and rm-IL-7 (10 ng/mL). When indicated, ILC2s were incubated with purified mouse C1q (10 μg/mL, Complement Technology) or with 15 μM of the SHP-1 inhibitor, known as Tyrosine Phosphatase Inhibitor 1 (TPI-1, MedChemExpress)^39,43. The BD Biosciences Cytofix/Cytoperm kit was used and followed by intracellular staining with PE anti-p65 (clone 532301, R&D Systems), BV421 anti-AKT (pS473) (clone M89-61, BD Biosciences), PE-Cy7 anti-BCL-2 (clone 10C4, eBioscience) and unconjugated anti-SHP-1 (clone SR41-02, ThermoFisher) followed by Alexa Fluor 647 goat anti-rabbit IgG secondary antibody (Jackson ImmunoResearh). Intranuclear staining was performed using the Foxp3 Transcription Factor Staining Kit (ThermoFisher) according to the manufacturer’s instructions and APC anti-mouse Ki67 (SolA15, ThermoFisher) was used to assess proliferation. The CellTrace Violet Cell Proliferation Kit (ThermoFisher) was also used in some experiments, according to manufacturer’s instructions. In parallel, the levels of IL-5, IL-6, and IL-13 were measured in supernatants using Legendplex multiplex kits (BioLegend) and data were analyzed via the LEGENDplex data analysis software v8.0. GM-CSF was quantified using ELISA kit from BioLegend.

Induction and assessment of AHR

Mice were intranasally (i.n.) challenged for 3 days with mouse rm-IL-33 (0.5 μg per mouse in 50 μL, BioLegend) to induce AHR or for 5 consecutive days with 100 μg of Alternaria alternata extracts (Greer Laboratories). Control mice were challenged with PBS and lung function was evaluated on the day following the last challenge. In some experiments, AHR was induced in Rag2^−/− Il2rg^−/− mice after an intravenous adoptive transfer of total pulmonary ILC2s (50 × 10³) sorted from IL-33-challenged WT and LAIR-1 KO mice. Lung function was assessed by direct measurement of lung resistance and dynamic compliance (cDyn) in restrained, tracheostomized, and mechanically ventilated mice using the FinePointe RC system (Buxco Research Systems) under general anesthesia. Mice were sequentially challenged with aerosolized PBS (baseline), followed by increasing doses of methacholine ranging from 5 to 40 mg/mL. Maximum lung resistance and minimum compliance values were recorded during a 3-min period after each methacholine challenge. AHR data were analyzed by repeated measurements of a general linear model.

Assessment of lung inflammation

To collect the bronchoalveolar lavage (BAL) fluid, lungs were washed with 3 ml ice-cold PBS. BAL supernatant was collected to quantify cytokines using Legendplex multiplex kits (BioLegend). Principal immune populations were identified in the BAL using the following antibodies: PE-Cy7 anti-mouse CD45 (clone 30-F11; BioLegend), APC-Cy7 anti-mouse CD11c (clone N418; BioLegend), PE anti-mouse Siglec-F (clone E50-2440; BD Biosciences), BV421 anti-mouse CD11b (clone M1/70; BD Biosciences), APC anti-mouse Gr-1 (clone RB6-8C5; BioLegend), FITC anti-mouse CD19 (clone 6D5; BioLegend), PerCP-Cy5.5 anti-mouse CD3 (clone 17A2; BioLegend). Lung tissue was processed and ILC2s were identified as described above, while the expression of C1q in CD11c⁺ cells was assessed using APC-Cy7 anti-mouse CD11c (clone N418; BioLegend) and FITC anti-C1q (clone JL-1; Invitrogen). When indicated, intracellular staining was performed to evaluate cytokine production using APC anti-mouse/human IL-5 (clone TRFK5; BioLegend) and PE anti-mouse IL-13 (clone eBio13A; eBioscience) after 4 h of in vitro incubation with 50 μg/mL PMA (Sigma-Aldrich), 500 μg/mL ionomycin (Sigma-Aldrich), and 1 μg/mL Golgi plug. Fluorescent live/dead fixable stains (ThermoFisher Scientific) were used to exclude dead cells, according to manufacturer’s instructions. CountBright Absolute Count Beads were used to count lung and BAL immune cells (Invitrogen). Acquisition was performed on a BD FACSCanto II (BD Biosciences) using the BD FACSDiva software v8.0.1. Data were analyzed with FlowJo software (TreeStar) version 10. In some experiments, one lobe per lung was collected for histology and stored in paraformaldehyde 4% buffered in PBS. Lungs were embedded in paraffin and cut into 4-μm sections for hematoxylin and eosin (H&E) staining or for trichrome staining. Histology pictures were acquired on a Leica DME microscope and Leica ICC50HD camera (Leica) and ImageJ was used for analysis.

Culture of human ILC2s and adoptive transfer

All human studies were approved by USC Institutional review board and conducted in accordance with the principles of the Declaration of Helsinki. Informed consent was obtained from all human participants. Human peripheral blood ILC2s were isolated from total PBMCs as previously described²⁶. Briefly, human fresh blood was first diluted 1:1 in PBS and transferred to SepMateTM-50 separation tubes (Stemcell Technologies) prefilled with 15 mL LymphoprepTM (Axis-Shield). Samples were centrifuged at 1200 × g for 10 min to collect PBMCs. The CRTH2 MicroBead kit (Miltenyi Biotec) was then used according to the manufacturer’s conditions in order to isolate CRTH2⁺ cells. The following antibodies were used to identify and sort human ILC2s: FITC anti-lineage, FITC anti-CD235a (clone HI264), FITC anti-FceRIa (clone AER-37), FITC anti-CD1a (clone HI149), FITC anti-CD123 (clone 6H6), FITC anti-CD5 (clone L17F12), APC-Cy7 anti-CD45 (clone HI30), PE anti-CD294 (CRTH2) (clone BM16), PE-Cy7 anti-CD127 (clone A019D5) (all from BioLegend). Purified ILC2s were cultured in complete RPMI media with recombinant human (rh)-IL-2 (20 ng/mL), rh-IL-7 (20 ng/mL) and rh-IL-33 (20 ng/mL) for 3 days. For knock-down experiments, 5 μM of Lair-1 antisense morpholino oligonucleotides AGACATGGCCCAGGTCCCAGCAGT or random control oligonucleotides (Gene Tools, LLC, Philomath, Ore) were added to the culture as free uptake oligonucleotides at T=0h and T=36h. When indicated LAIR-1 expression was assessed on freshly isolated or cultured ILC2s using Alexa Fluor 647 anti-human LAIR-1 (clone NKTA255, BioLegend). Intranuclear staining with eFluor450 anti-human Ki67 (clone 20Raj1, eBioscience) was performed to assess proliferation. Human IL-5, IL-6 and IL-13 were quantified in supernatants using Legendplex multiplex kits from BioLegend.

For adoptive transfer experiments, in vitro-cultured ILC2s (50 × 10³) were intravenously (i.v.) injected in Rag2^−/− Il2rg^−/− mice. To induce AHR, mice were intranasally challenged with 1 μg of rh-IL-33 for three consecutive days. On days 4 and 5, mice received 50 μg of purified human C1q (Complement Technology) or PBS via the intraperitoneal route (i.p.) as described before⁴⁴. The i.p route was chosen since C1q is a high molecular weight protein (410–462 kDa), and therefore has a limited diffusion via the intranasal route^45,46. On day 6, lung function was measured before BAL and lung collection for flow cytometry analysis.

Statistical analysis

Data are representative of at least two independent experiments and are presented as means ± SEM (except for RNAseq). Two-tailed Student’s t test was applied for comparisons between 2 groups. For multigroup comparisons, we used one-way ANOVA with the Tukey post hoc test. Data were analyzed with Prism Software (GraphPad Software Inc.). Error bars represent standard error of the mean. p value < 0.05 was considered to denote statistical significance (*p <0.05, **p < 0.01, ***p < 0.001).

Results

LAIR-1 is inducible on pulmonary ILC2s

LAIR-1 is broadly and constitutively expressed on different immune populations including monocytes, NK and B/T cells⁴⁷. To elucidate the expression of LAIR-1 on ILC2s, C57BL/6 WT mice were challenged for three consecutive days with rm-IL-33 or with PBS and lungs were collected at day 4 (Fig. 1A). Pulmonary ILC2 expression was assessed utilizing flow cytometry by gating on CD45⁺ lineage⁻ ST2⁺ CD127⁺ as described before²⁶(Fig. 1B). LAIR-1 was not expressed on naïve pulmonary ILC2s, while intranasal stimulation with IL-33 induced a LAIR-1⁺ ILC2 population (Fig. 1C, D; Fig E1, A⁴⁸). Similarly, LAIR-1 was not expressed on skin and adipose tissue resident ILC2s at the basal state however it was weakly expressed on bone marrow and blood ILC2s (Fig E1, B–H). To explore the particularities of this induced subset, we sorted both LAIR-1⁻ and LAIR-1⁺ ILC2s and established a differential expression profiling using RNAseq analysis. LAIR-1⁺ ILC2s presented a different transcriptional profile, as revealed by principal component analysis (PCA) (Fig. 1E). This analysis provides unsupervised information on the clustering of LAIR-1⁻ and LAIR-1⁺ ILC2 samples based on the highest variability in the overall dataset. LAIR-1 expression was associated with the upregulation of 950 genes and the downregulation of 875 genes (Fig. 1F). In particular, genes related to inflammation and ILC2 activation such as Il13, Il9 and Nfkbia were downregulated in LAIR-1⁺ ILC2s. Along with Lair1 gene induction, a battery of genes related to tissue remodeling, such as Loxl2, Col18a1, Cd9 and Ecm1, were among the most upregulated (Fig. 1G; Fig E1, I). In parallel, the trichrome histological staining suggested lung tissue remodeling and collagen deposition following repeated IL-33 challenges (Fig E2, A). C1q was reported as a potential natural ligand that engages LAIR-1 through a non-complement mechanism³⁶. Furthermore, both flow cytometry and transcriptional data suggested that C1q is mainly and constitutively expressed by antigen presenting cells (DCs and macrophages) in mouse and human lungs (Fig E2, B–E⁴⁹). To confirm the regulatory role of LAIR-1 axis, we treated both ILC2 subsets with C1q or PBS and assessed cytokine production (Fig. 1H). In line with the transcriptional data, LAIR-1⁺ ILC2s secreted less IL-5 and IL-13 in vitro. In addition, C1q significantly decreased IL-5 and IL-13 production in LAIR-1⁺ ILC2s, but not in LAIR-1⁻ ILC2s (Fig. 1I, J). Altogether, our data indicate that LAIR-1 is inducible on ILC2s, is functional, and participates in ILC2 downregulation.

Figure 1: IL-33 induces a LAIR-1⁺ population in pulmonary ILC2s.

(A-J) C57BL/6 WT mice were intranasally challenged for three consecutive days with 0.5 μg of rm-IL-33 or with PBS, and lungs were collected on day 4.

(B) Pulmonary ILC2s identified as CD45⁺ lineage⁻ CD127⁺ ST2⁺ cells.

(C) Representative flow cytometry plots showing LAIR-1 expression on ILC2s from PBS- and IL-33-challenged mice.

(D) LAIR-1 expression kinetics on ILC2s in response to in vivo IL-33 challenges, represented as percentages of LAIR-1⁺ ILC2s.

(E-J) LAIR-1⁻ and LAIR-1⁺ ILC2s were sorted from IL-33-challenged mice and incubated with rm-IL-2 (10 ng/mL) and rm-IL-7 (10 ng/mL) for 24 h.

(E) PCA plot showing the clustering of LAIR-1⁻ and LAIR-1⁺ ILC2 samples based on uncorrelated variables.

(F) Heatmap representation of total differentially regulated genes, generated with Gene-specific analysis (GSA) algorithm (counts <20; p-value ≤ 0.05; n = 3).

(G) Focused volcanoplot representing a list of relevant and significantly regulated genes in LAIR-1⁺ ILC2s as compared to LAIR-1⁻ ILC2s.

(H-J) LAIR-1⁻ and LAIR-1⁺ ILC2s were cultured with or without C1q at 10 μg/ml and supernatants were collected after 24 hours.

(I, J) Levels of IL-5 (I) and IL-13 (J) quantified using LEGENDplex immunoassay.

Data are presented as means ± SEM (one-way ANOVA; *p <0.05, **p < 0.01, ***p < 0.001).

Lack of LAIR-1 on pulmonary ILC2 increases effector function and Th2 cytokine secretion

To better assess the implication of LAIR-1 on ILC2s, we introduced the previously characterized LAIR-1 KO mouse⁵⁰, which has a targeted deletion of Lair1 gene. WT and LAIR-1 KO mice were intranasally challenged with rm-IL-33 for 3 consecutive days in order to compare the transcriptional profile of FACS-sorted ILC2s (Fig. 2A). The absence of LAIR-1 resulted in 1181 significantly modulated genes (counts <20; p-value ≤ 0.05), displayed as a heatmap for differential gene expression (Fig. 2B). Interestingly, 326 genes were consistently and commonly modulated in our 2 transcriptional analyses: i) LAIR-1⁻ vs LAIR-1⁺ ILC2s from WT mice and ii) LAIR-1 KO vs WT ILC2s. Relevant inflammatory genes including Il13, Il9, Tnfrsf8, Stat5b were upregulated in LAIR-1⁻ and LAIR-1 KO ILC2s, while mainly antioxidant and anti-inflammatory genes, such as Gclm, Prdx6, Nqo1, Dok2 and CD200r1 were consistently downregulated in comparison to LAIR-1⁺ and WT ILC2s (Fig. 2C). This further highlights a central anti-inflammatory role for LAIR-1 in activated ILC2s. To better explore the LAIR-1 mechanism of action, we performed pathway analysis using gene-level statistics to compute pathway-level scores. Interestingly, PI3K/AKT signaling, Th2 pathway and NF-κB activation were among the highly affected pathways (Fig. 2D). As ILC2s functionally mimic Th2 cells, we first compared the expression of cytokine related genes in activated WT and LAIR-1 KO ILC2s. A list of genes encoding Th2 cytokines, including Il5, Il13, Il9, and Csf2 were significantly upregulated in the absence of LAIR-1 (Fig. 2E). At the protein level, ILC2s from LAIR-1 KO mice exhibited higher production of IL-5, IL-13, IL-6 and GM-CSF (Fig. 2F–I), confirming the transcriptional data. Taken together, these results indicate that LAIR-1 axis can negatively regulate relevant inflammatory pathways and dampen cytokine production in activated ILC2s.

Figure 2: LAIR-1 deficiency increases ILC2 activation and cytokine production.

(A-I) WT and LAIR-1 KO mice were challenged intranasally for 3 consecutive days with 0.5 μg rm-IL-33. On day 4, pulmonary ILC2s were sorted and cultured with rm-IL-2 (10 ng/mL) and rm-IL-7 (10 ng/mL) for 24 h.

(B) Heatmap representation of total differentially regulated genes, generated with GSA algorithm (counts <20; p-value ≤ 0.05; n = 3).

(C) Venn diagram highlighting a list of commonly regulated genes in two bulk RNAseq: LAIR-1⁻ vs LAIR-1⁺ from WT mice and LAIR-1 KO vs WT ILC2s. Green list represents downregulated genes and red list represents upregulated genes in LAIR-1⁻ and LAIR KO ILC2s.

(D) Pathway enrichment analysis enriched for relevant up-regulated genes in LAIR-1 KO ILC2s.

(E) Differentially expressed cytokine and cytokine receptor genes plotted as the normalized counts in WT compared to LAIR-1 KO ILC2s. Red dots represent significantly upregulated relevant genes (p-value ≤ 0.05; n = 3).

(F-H) Levels of IL-5 (F), IL-13 (G), and IL-6 (H) quantified using LEGENDplex bead-based immunoassay.

(I) Level of GM-CSF quantified by ELISA.

Data are presented as means ± SEM (unpaired two-tailed Student’s t test; *p <0.05, **p < 0.01, ***p < 0.001).

Cell, mouse and human images are provided with permission from Servier Medical Art.

LAIR-1 mediates regulation of ILC2s utilizing SHP-1/PI3K/AKT signaling circuits

The PI3K/AKT pathway is a principal regulator of cell activation, differentiation, proliferation and survival⁵¹. According to our pathway analysis, PI3K/AKT was one of the mainly affected pathways in activated LAIR-1 deficient ILC2s. Consistently, several studies have highlighted a constitutive interaction between LAIR-1 and SHP-1^38,39, a phosphatase that directly inhibits the PI3K/AKT downstream signaling as well as NF-κB⁵² (Fig. 3A). To investigate these interactions in ILC2s, we assessed the effect of LAIR-1 on the expression of relevant downstream players at the transcriptional and the protein level. Interestingly, a list of genes related to PI3K pathway, NFκB activation, apoptosis and proliferation were significantly upregulated in LAIR-1 KO activated ILC2s compared to WT, while Ptpn6 that encodes SHP-1 was significantly downregulated (Fig. 3B). Using flow cytometry, we also observed a significantly lower expression of SHP-1 in LAIR-1 KO ILC2s as compared to WT ILC2s (Fig. 3C). The lack of LAIR-1 was also associated with higher expression of AKT, p65 which is a principal component of canonical NF-κB pathway, and the anti-apoptotic factor BCL-2 (Fig. 3D–F). Moreover, proliferation was improved as revealed by the ki67 intranuclear staining (Fig. 3G) and the CellTrace Violet staining (Fig E3, A). To further confirm the implication of SHP-1 in ILC2 activation, we used the specific inhibitor TPI-1 at 15 μM to modulate SHP-1 activity in vitro. Interestingly, SHP-1 inhibition in ILC2s led to an increased in vitro proliferation and enhanced IL-5 production (Fig E3, B, C). Moreover, the LAIR-1 ligand C1q increases the expression of SHP-1 in ILC2s (Fig E3, D). Altogether, these results support the involvement of LAIR-1/SHP-1 interactions in the control of ILC2 activation.

Figure 3: LAIR-1 signaling involves PI3K/AKT and NF-κB pathways.

(A-G) WT and LAIR-1 KO mice were challenged intranasally for 3 consecutive days with 0.5 μg rm-IL-33. On day 4, pulmonary ILC2s were sorted and cultured with rm-IL-2 (10 ng/mL) and rm-IL-7 (10 ng/mL) for 24 h.

(A) Predicted LAIR-1 downstream signaling cascade.

(B) Heat map representation of differentially regulated genes involved in LAIR-1 signaling pathways. GSA algorithm was used to test for differential expression of genes in WT vs LAIR-1 KO ILC2s (counts <20; p-value < 0.05; n = 3).

(C-F) Representative histogram (left) with the corresponding MFI quantification (right) of SHP-1 (C); p65 (D); AKT (E) and BCL-2 (F) expression in WT and LAIR-1 KO ILC2s.

(G) Representative flow cytometry plots of Ki67 intranuclear staining and corresponding quantification (right) presented as the percentage of proliferative ILC2s.

Data are presented as means ± SEM (unpaired two-tailed Student’s t test; *p <0.05, **p < 0.01).

LAIR-1 regulates lung function and inflammation in ILC2-dependent AHR

Given the regulatory role of LAIR-1 in pulmonary ILC2s, we next hypothesized that this receptor may reduce AHR and lung inflammation. WT and LAIR-1 KO mice received via the intranasal route either IL-33 or PBS for 3 consecutive days. One day after the last challenge, lung function was assessed by direct measurement of lung resistance and dynamic compliance (cDyn) in anesthetized tracheostomized mice using the FinePointe RC system (Buxco Research Systems), followed by BAL collection and lung tissue sample analysis. Although IL-33 significantly increased lung resistance in both genotypes; lung resistance in LAIR-1 KO mice was significantly higher than in WT mice (Fig. 4A). Consistently, results of dynamic compliance showed lower response in LAIR-1 KO compared to WT mice (Fig. 4B). This suggested that LAIR-1 reduces IL-33-induced AHR. The principal immune populations in the BAL were identified and quantified by flow cytometry (Fig E4, A–E). In agreement with AHR, the total number of immune cells (CD45⁺) in the BAL of IL-33-challenged mice was significantly higher in LAIR-1 KO compared to WT mice (Fig. 4C). Eosinophilia, known as a main feature in type-2 asthma, was significantly higher in LAIR-1 KO mice than in WT mice, as well as the number of inflammatory CD11b⁺ DCs (Fig. 4D, E; Fig E4, A). In the lungs, ILC2 count was higher in LAIR-1 KO mice following IL-33 challenge, as was the percentage of IL-5⁺ IL-13⁺ ILC2s (Fig. 4F, G; Fig E5, A). The exacerbated lung inflammation in LAIR-1 deficient mice was also confirmed by histology (Fig. 4H). Expectedly, the lack of LAIR-1 improved ILC2s viability confirming our previous in vitro data (Fig E5, B), however it had no significant effect on the expression of other receptors including MAIR-V, KLRG1, PD-L1 and CD200R (Fig E5, C–H). Altogether, these results reveal that LAIR-1 dampens IL-33-induced lung inflammation and reduces AHR.

Figure 4: LAIR-1 deficiency exacerbates ILC2-dependent AHR and lung inflammation.

(A-H) WT and LAIR-1 KO mice were challenged for 3 consecutive days with 0.5 μg rm-IL-33. On day 4, AHR and lung inflammation were assessed.

(A) Lung resistance and (B) dynamic compliance; n = 5.

(C) Total number of CD45⁺ cells in the BAL.

(D, E) Total number of eosinophils (D) and CD11b⁺ DCs (E) in the BAL.

(F) Total number of pulmonary ILC2s gated as CD45⁺ lineage⁻ ST2⁺ CD127⁺ cells.

(G) Percentage of IL-5⁺ and IL-13⁺ ILC2s identified by intracellular staining.

(H) H&E staining of lung sections (scale bars 50 μm).

(I-M) WT and LAIR-1 KO mice were challenged for 3 consecutive days with 0.5 μg rm-IL-33. On day 4, pulmonary ILC2s were sorted and adoptively transferred into Rag2^−/− Il2rg^−/− mice via the intravenous route (i.v.). Recipient mice were then challenged intranasally for 3 consecutive days with 0.5 μg rm-IL-33 before the assessment of AHR and lung inflammation.

(J) Lung resistance; n = 4.

(K) Total number of eosinophils in the BAL.

(L) Gating of lineage⁻ cells from live CD45⁺ cells.

(M) Total number of pulmonary ILC2s gated as CD45⁺ lineage⁻ ST2⁺ CD127⁺ cells.

Data are presented as means ± SEM (one-way ANOVA; *p <0.05, **p < 0.01, ***p < 0.001).

To address LAIR-1 specific implication in ILC2-dependent asthma, we adoptively transferred activated WT or LAIR-1 KO ILC2s in Rag2^−/−Il2rg^−/− mice that lack all lymphoid cells. Recipient mice were then challenged with IL-33 for 3 consecutive days. On day 4, AHR, BAL eosinophils and pulmonary ILC2 numbers were assessed (Fig. 4I). As expected, in the absence of any adoptive transfer, Rag2^−/−Il2rg^−/− mice did not develop AHR in response to IL-33. Consistent with the previous observations in LAIR-1 KO mice, we observed here that mice receiving LAIR-1 KO ILC2s displayed significantly higher lung resistance and increased eosinophil recruitment as compared to those receiving WT ILC2s (Fig. 4J, K). In addition, the percentage of CD45⁺ lineage negative cells and consequently the number of LAIR-1 KO ILC2s in the lungs were significantly higher (Fig. 4L, M). Therefore, these models overall confirm our previous results and underline the protective role of LAIR-1 in IL-33-induced AHR and pulmonary inflammation through the regulation of ILC2s.

LAIR-1 downregulates Alternaria alternata-induced AHR and limits lung inflammation

We next investigated whether LAIR-1 conserves its immunoregulatory role in a clinically relevant AHR model induced by the fungal allergen Alternaria alternata, known to be associated with type-2 inflammation^53,54. WT and LAIR-1 KO mice were intranasally challenged with Alternaria alternata extracts (100 μg per mouse) for 5 consecutive days, followed by AHR and lung inflammation assessment (Fig. 5A). Consistent with the IL-33 model, lung resistance was higher in LAIR-1 KO mice as compared to WT mice (Fig. 5B). This was associated with an increased number of CD45⁺ cells in the BAL (Fig. 5C). In particular, LAIR-1 KO mice displayed significantly higher numbers of eosinophils, T cells and B cells, but similar recruitment of neutrophils and CD11c⁺ cells (Fig. 5D–H). We further addressed whether LAIR-1 is inducible in ILC2s and regulates their activation in response to a widespread fungal allergen. Interestingly, our results revealed that mice exposure to Alternaria alternata induces LAIR-1 expression on about 30–40% of pulmonary ILC2s (Fig. 5I). In parallel, the lack of LAIR-1 was associated with an increased number of pulmonary ILC2s as well as an increased percentage of IL-5⁺IL-13⁺ ILC2s (Fig. 5J, K). Taken together, these results confirm the inhibitory role of LAIR-1 in a clinically relevant asthma model and demonstrate LAIR-1 capacity to control type-2 immune response.

Figure 5: LAIR-1 deficiency significantly increases Alternaria alternata-induced pulmonary inflammation.

(A-K) WT and LAIR-1 KO mice were challenged intranasally for 5 consecutive days with 100 μg of Alternaria alternata extracts. On day 6, AHR and lung inflammation were assessed.

(B) Lung resistance measured in response to increasing concentrations of methacholine, n=4.

(C) Total number of CD45⁺ cells in the BAL.

(D-H) Total number of eosinophils (D), neutrophils (E), CD11c⁺ cells (F), T cells (G) and B cells (H) in the BAL.

(I) Percentage of LAIR-1⁺ ILC2s in the lungs.

(J) Total number of pulmonary ILC2s.

(K) Percentage of IL-5⁺ and IL-13⁺ ILC2s.

Data are presented as means ± SEM (unpaired two-tailed Student’s t test; *p <0.05, **p < 0.01).

LAIR-1 is inducible and controls the effector function of human ILC2s

ILC2s are now considered as relevant immune players in human type-2 asthma^55–57, despite their low percentage among PBMCs (Fig E6). To assess the translational potential of our data, we explored whether LAIR-1 is expressed and if it modulated human ILC2 activation, as demonstrated in mouse. To this end, we assessed the expression of LAIR-1 on freshly sorted and on cultured ILC2s. Human ILC2s were identified and sorted as CD45⁺ lineage⁻ CD127⁺ CRTH2⁺ cells (Fig. 6A, B). Interestingly, we first observed that LAIR-1 was expressed on circulating ILC2s at the basal state (T=0h) and was significantly induced in response to rh-IL-33 (T=72h) (Fig. 6C). Since LAIR-1 was remarkably expressed on human ILC2s, we performed functional tests using specific LAIR-1 antisense morpholino oligonucleotides to address the effect of a transient knockdown of Lair1 gene on human ILC2 activation in response to IL-33. As a validation of our approach, we observed a significant decrease in LAIR-1 expression on morpholino-treated ILC2s (Fig. 6D). Then, we demonstrated that morpholino treatment along with IL-33 stimulation increases ILC2 proliferation, as revealed after 72 hours of culture using the ki67 intranuclear staining (Fig. 6E). In parallel, the quantification of cytokine levels in the supernatant showed that specific Lair1 antisense morpholino is able to induce a significant upregulation in IL-5, IL-6 and IL-13 production as compared to control sequences (Fig. 6F–H). We lastly tested the effect of LAIR-1 engagement on human ILC2s in vivo using a humanized mouse model. Briefly, Rag2^−/−Il2rg^−/− mice that lack lymphoid cells were reconstituted with human peripheral blood ILC2s and intranasally challenged for three consecutive days with PBS or rh-IL-33 to induce AHR. On days 4 and 5, mice received PBS or human C1q, a potential physiological ligand for LAIR-1, via the intraperitoneal route (i.p.). On day 6, we assessed AHR and lung inflammation (Fig. 6I). Strikingly, lung resistance in C1q-treated mice was significantly reduced as compared to control mice (Fig. 6J). In line with lung resistance, C1q-treated mice showed abrogated lung inflammation associated with decreased eosinophilia and fewer number of human ILC2s (Fig. 6K, L). Taken together, these results indicate that LAIR-1 is highly implicated in the control of human ILC2 activation, suggesting a promising therapeutic approach against type-2 asthma.

Figure 6: LAIR-1 is expressed and functional on human ILC2s.

(A-H) Human ILC2s were sorted from PBMCs and cultured in the presence of rh-IL-2, rh-IL-7 and rh-IL-33, with LAIR-1 morpholino antisense oligonucleotides or control oligonucleotides.

(B) Gating strategy of human ILC2s identified as CD45⁺ lineage⁻ CD127⁺ CRTH2⁺ cells.

(C) Representative histogram of LAIR-1 expression on human ILC2s and corresponding quantification (right).

(D, E) Effect of morpholino treatment on LAIR-1 expression presented as MFI (D) and Ki67⁺ ILC2s percentage (E).

(F-H) Levels of IL-5 (F), IL-6 (G) and IL-13 (H).

(I-L) In vitro cultured human ILC2s were adoptively transferred into Rag2^−/− Il2rg^−/− mice. Recipient mice were intranasally challenged with 1 μg of rh-IL-33 or PBS for 3 consecutive days and intraperitoneally (i.p) injected with human C1q or PBS on days 4 and 5. Measurement of lung function and inflammation followed on day 6.

(J) Lung resistance; n = 4.

(K) Total number of eosinophils in the BAL gated as CD45⁺ SiglecF⁺ CD11c⁻ cells.

(L) Total number of human ILC2s in lungs gated as CRTH2⁺ CD127⁺ cells.

Data are presented as means ± SEM (paired two-tailed Student’s t test in D to H; one-way ANOVA test for multiple comparisons; *p <0.05, **p < 0.01, ***p < 0.001).

Discussion

The present study is the first to elucidate the expression, the signaling pathways and the inhibitory potential of LAIR-1 axis in ILC2s in the context of allergic asthma. We demonstrated that the transmembrane glycoprotein inhibitory receptor LAIR-1, is inducible on mouse ILC2s upon activation. LAIR-1 deficiency increases type-2 cytokine production in association with an upregulation of PI3K/AKT signaling. We further evidenced the protective role of LAIR-1 in ILC2-dependent asthma. Interestingly, LAIR-1 is expressed and inducible on human ILC2s and downregulates their activation both in vitro and in vivo, suggesting a new potential target in allergic asthma.

LAIR-1 is a broadly expressed immune receptor, playing an inhibitory role on the majority of immune cells^27,47,58. In neutrophils, LAIR-1 is lost during differentiation and is only expressed upon stimulation on mature cells³⁰. No study has investigated yet the conditions under which ILC2s could express LAIR-1. Here we demonstrated that ILC2s precursors in the bone marrow as well as circulating ILC2s display a weak expression of LAIR-1, while tissue resident ILC2s do not express it. In agreement with recent studies highlighting the flexible nature of activated ILC2s^1,59,60, pulmonary ILC2s could express LAIR-1 only upon stimulation. This suggests that LAIR-1 is induced on highly activated ILC2s to dampen their functions and its expression could necessitate a special inflammatory microenvironment. Besides the downregulation of genes related to inflammation, LAIR-1⁺ ILC2s highly express genes related to extracellular matrix generation and tissue remodeling. For instance, the gene encoding LOXL2, an enzyme that promotes collagen crosslinking^39,61, was highly upregulated in LAIR-1⁺ ILC2s. In parallel, several studies have reported airway remodeling and collagen deposition in different asthma models^62–64.Therefore, ILC2s may help providing an optimal microenvironment for LAIR-1 expression while sustaining bidirectional modulatory interactions with collagen-producing lung cells⁶.

Lacking antigen specific receptors, secretion of type-2 cytokine represents the main contribution for ILC2s in the orchestration of the immune response. Our data demonstrated, at the transcriptional and the protein levels, that LAIR-1 controls Th2 cytokine production in ILC2s, along with SHP-1 activation and the downregulation of PI3K/AKT as well as NF-κB signaling pathways. Therefore, we suggest here that the recruitment of SHP-1 phosphatase by LAIR-1 intracellular domain mediates an inhibitory cascade in ILC2s, leading to decreased cytokine production and proliferation. Previous studies showed that following LAIR-1 engagement, ITIM phosphorylation is a key event driving the suppression of main immune pathways, including interferon-α production in plasmacytoid DCs (pDCs)^31,35 and TCR signaling in T cells⁶⁵. Interestingly, a recent study has also demonstrated that LAIR-1/SHP-1 interaction triggers CD8⁺ T cell exhaustion in lung tumors³⁹. Therefore, our findings support previous studies and decrypt the relevant mechanisms associated with LAIR-1 activity in pulmonary ILC2s.

A balance between activating and inhibitory signals is required to avoid inappropriate immune responses. Due to its broad inhibitory role, LAIR-1 acts as an immune checkpoint and is involved in cancer, autoimmune and infectious diseases. In particular, the development of RA is associated with an imbalanced expression of LAIR-1 on T cells and osteoclasts^66,67. Furthermore, a decreased LAIR-1 expression on B cells and pDCs worsens SLE progression^31,47. LAIR-1 also suppresses neutrophil inflammatory functions in viral bronchiolitis^68,69. Although LAIR-1 crosslinking has become a promising therapeutic strategy against several diseases, only one study has investigated LAIR-1 involvement in allergic contexts and reported that LAIR-1 reduces cytokine production by DCs and limits T cell proliferation in allergic contact dermatitis model⁷⁰. Here we investigated the implication of LAIR-1 in allergic asthma for the first time, using IL-33 and Alternaria alternata models. Our data support a protective role for LAIR-1 in allergic airway inflammation, as LAIR-1 deficiency is associated with exacerbated AHR and eosinophilia. Using adoptive transfer experiments, we demonstrated that LAIR-1 can suppress ILC2-dependent asthma primarily through ILC2 inhibition.

Human cohorts have confirmed the involvement of ILC2s in asthma progression and severity^71,72. Although mouse asthma models are very useful to elucidate immunological mechanisms, we further validate our data in human ILC2s to be more clinically relevant. Interestingly, circulating ILC2s from healthy donors express LAIR-1. Similarly to mice, this expression is significantly inducible in response to IL-33, suggesting a critical role for LAIR-1 in ILC2 homeostasis and regulation. Due to the absence of specific LAIR-1 inhibitors and agonists to date, we used the morpholino gene silencing technique as well as C1q, in order to modulate LAIR-1 activity in vitro and in vivo, respectively. A transient knockdown of Lair1 in ILC2s led to increased proliferation and secretion of type-2 cytokines in response to IL-33, revealing a remarkable inhibitory role in human ILC2s. C1q was used in different human studies for its capacity to mediate immunosuppressive effect through LAIR-1 engagement^35,65,73. It was also reported as a potent inhibitor in ovalbumin-induced allergic asthma model⁴⁴. Since C1q is one of the main components of the total protein serum content^37,74, it is very plausible that circulating ILC2s are highly exposed and may be regulated by C1q. To further develop our translational approach, we developed here a humanized mouse model reconstituted with human ILC2s and treated with human C1q after IL-33 challenge. Interestingly, C1q significantly reduces AHR and eosinophilia mainly through the regulation of ILC2s. Existing single cell RNAseq⁴⁹ shows that luminal macrophages and activated DCs are the major sources of C1q in lungs of healthy and asthmatic patients (Fig E2, E). As ILC2s localize with DC subsets in lungs^4,75, this might suggest the existence of unrecognized regulatory axis mediated by C1q/LAIR-1 interactions in allergic asthma.

Based on diverse experimental strategies, this study provides evidence for the implication of LAIR-1 in mouse and human ILC2s, and consequently in ILC2-dependent asthma. Therefore, our findings could be associated with clinical implications via the therapeutic modulation of LAIR-1 in allergic asthma.

Clinical implication:

LAIR-1 engagement may serve as potential therapeutic target for the treatment of ILC2-related diseases such as allergic asthma.

Abbreviations

AHR

Airway hyperreactivity

BAL

Bronchoalveolar lavage

DC

Dendritic cell

GSA

Gene specific analysis

IL-

Interleukin-

ILC2

Type-2 innate lymphoid cell

ITIM

Immuno-receptor tyrosine-based inhibitory motif

KO

Knock-out

LAIR-1

Leukocyte-Associated Ig-like Receptor-1

NK

Natural killer

PBMC

Peripheral blood mononuclear cell

pDC

Plasmacytoid dendritic cell

RA

Rheumatoid arthritis

RNAseq

RNA-sequencing

SHP-1

Src homology phosphatase-1

SLE

Systematic lupus erythematosus

Th2

T-helper 2

WT

Wild-type