Abstract
Fluconazole‐resistant Candida albicans is a big scary reality. The authors assessed the antifungal effects of magnetic iron‐oxide nanoparticles on fluconazole‐resistant colonising isolate of C. albicans and determined the expression of ERG11 gene, protein sequence similarity and ergosterol content. C. albicans isolates were characterised and fluconazole resistance is recognised using World Health Organization's WHONET software. Susceptibility testing of magnetic iron‐oxide nanoparticles against fluconazole‐resistant colonising isolate of C. albicans was performed according to Clinical and Laboratory Standards Institute guidelines. The expression patterns of ERG11 and protein sequence similarity were investigated. Ergosterol quantification has been used to gauge the antifungal activity of magnetic iron‐oxide nanoparticles. The findings indicated that 93% of C. albicans isolates were resistant to fluconazole. Magnetic iron‐oxide nanoparticles were presented activity against fluconazole‐resistant colonising isolate of C. albicans with minimum inhibitory concentration at 250–500 µg/ml. The expression level of ERG11 gene was downregulated in fluconazole‐resistant colonising isolate of C. albicans. The results revealed no differences in fluconazole‐resistant colonising isolate of C. albicans by comparison with ERG11 reference sequences. Moreover, significant reduction was noted in ergosterol content. The findings shed a novel light on the application of magnetic iron‐oxide nanoparticles in fighting against resistant C. albicans.
Inspec keywords: microorganisms, biochemistry, molecular biophysics, antibacterial activity, iron compounds, proteins, cellular biophysics, nanoparticles, drugs, genetics
Other keywords: albicans isolates, magnetic iron‐oxide nanoparticles, fluconazole‐resistant colonising isolate, fluconazole resistance, ERG11, candida albicans, protein sequence similarity, ergosterol content, WHONET, ergosterol quantification, susceptibility testing, antifungal activity, gene expression
1 Introduction
In recent decades, fungi cause lethal opportunistic infections, especially in people with severe underlying disorders. Of these fungal opportunistic infections, Candida species are the first and fourth leading causes of nosocomial bloodstream infections in European hospitals and the USA, respectively [1, 2]. Candida albicans is the most commonly opportunistic fungal infection worldwide [3]. Candida infections are resistant to the existing antifungal agents particularly the azoles [4, 5]. The underlying molecular mechanisms responsible for resistance are mostly shared by displaying intrinsically reduced susceptibility and those acquiring resistance during antifungal therapy [4, 6, 7]. The molecular mechanisms that cause drug resistance generally include altered drug affinity and target abundance, reduced intracellular drug levels caused by drug efflux transporters, formation of biofilms [8, 9] and development of ergosterol compensatory pathways [10].
Azole drugs target is a cytochrome P450 ‐dependent lanosterol 14α ‐demethylase (known as ERG11 in yeasts). ERG11, encoded by the ERG11 gene, catalyse C14‐demethylation of lanosterol [4, 5]. The free nitrogen atom of the azole ring binds to the ferric iron moiety of haem group of the enzyme, which disrupts the process of ergosterol biosynthesis and induces cell cycle arrest [4, 10].
Overexpression of ERG11 is known to occur among azole‐resistant clinical isolates of C. albicans [4, 5]. The increased expression of ERG11 is due to mutations in the zinc cluster transcriptional regulator Upc2p [4, 5, 11]. The formation of an isochromosome with two copies of the left arm of chromosome 5, in which ERG11 resides, or by duplication of the entire chromosome, leading to gene amplification [4]. It is widely acknowledged that azole‐resistant clinical isolates of C. albicans is one of the biggest issues in healthcare today. Facing increasing challenges in antibiotic resistance, rapid development of nanotechnology is presented with a dramatic impact on medicine to alleviate the crisis.
Magnetic iron‐oxide nanoparticles have been widely used for medical diagnosis and therapeutics [12, 13]. Recent data revealed that magnetic iron‐oxide nanoparticles have great promise in the treatment of infectious disease [14, 15, 16]. Here, we elucidate gene expression profiling of ERG11, protein sequence similarity and ergosterol content that led to the observed fluconazole‐resistant colonising isolate of C. albicans growth inhibition by magnetic iron‐oxide nanoparticles.
2 Materials and method
2.1 Ethics statement
Procedures involving human participants were in accordance with the ethical standards of the institutional and/or National Research Committee and with the 2008 Helsinki declaration. The study was approved 1397‐11‐16 (IR.IAU.YASOOJ.REC.1397.11) by the Islamic Azad University.
2.2 Fungal strains and growth conditions
C. albicans ATCC 90028 was used as the reference control. Colonising isolates of C. albicans were collected from cancer patients who admitted into the Shahid Jalil Hospital, Yasuj, Iran associated with the Yasuj University of Medical Sciences. Three clinical C. albicans isolate from vulvovaginal candidiasis patients (SN 1, SN 2 and SN 3) obtained from the stock collection of Microbiology Laboratory, Cellular and Molecular Research Centre, Yasuj University of Medical Sciences. C. albicans isolates were plated onto Sabouraud dextrose agar (Merck, Germany) plates. C. albicans isolates were identified by CHROMagar™ Candida (CHROMagar Microbiology, Paris, France), colony and microscopic appearance, Reynolds–Braude phenomenon and polymerase chain reaction (PCR) with the universal primers ITS1 (5′ TCC GTA GGT GAA CCT GCG G 3′) and ITS4 (5′ TCC TCC GCT TAT TGA TAT GC 3′) and nucleotide sequencing. The Clinical and Laboratory Standards Institute (CLSI) documents M27‐A3 and M27‐S4 were used to detect fluconazole resistance in C. albicans isolates [17, 18]. The World Health Organization's WHONET software program was used to analyse the susceptibility results.
2.3 Magnetic iron‐oxide nanoparticles susceptibility test
About 70 nm sized spherical magnetic iron‐oxide nanoparticles were provided by co‐precipitation method in the Education Research Centre, Yasuj University, Yasuj, Iran. Magnetic iron‐oxide nanoparticles susceptibility test was screened against fluconazole‐resistant colonising isolate of C. albicans via CLSI document M27‐A3. C. albicans ATCC 90028 was used as control strain.
U‐bottom 96‐well microtitre plates (Maxwell, China) were poured with 100 µl/well of the two‐fold dilution of the various concentrations of magnetic iron‐oxide nanoparticles ranging 0.03–2500 μg/ml or fluconazole (Sigma‐Aldrich, Germany) ranged from 0.03 to 64 μg/ml in Roswell Park Memorial Institute 1640 medium with L‐glutamine (Sigma‐Aldrich, St. Louis, MO, USA) buffered with 0.165 M morpholinophosphonyl sulphate at pH 7.0. Inoculum containing 0.5–5 × 103 CFU/ml of C. albicans was added in the wells. Following incubation for 2 h at 4°C, microtitre plates were incubated for 24 h at 35°C and then assayed minimum inhibitory concentrations (MICs) [17].
2.4 Isolation of RNA and complementary DNA (cDNA) syntheses
About ∼5 × 106 CFU/ml of fluconazole‐resistant colonising isolate of C. albicans was prepared and treated with various concentrations of magnetic iron‐oxide nanoparticles (two MIC, MIC, ½ MIC and ¼ MIC). RNA was isolated using RNeasy Mini Kit (Qiagen, Hilden, Germany) from treated C. albicans. RNA quantity of samples was measured by NanoDrop 2000/2000c spectrophotometer (Thermo Fisher Scientific, USA). The integrity and purity of the RNA samples were detected by formaldehyde‐containing agarose section headings gel. Total RNA was treated with deoxyribonuclease I (DNase I; SinaColon, Karaj. Iran). cDNA was synthesised using the random hexamer primers and M‐MuLVRNase H́ reverse transcriptase according to SinaColon first strand cDNA synthesis kit (SinaColon) [17, 19].
2.5 Oligonucleotide design
Oligonucleotide primer sequence for C. albicans 14α ‐demethylase [ERG11, relative semi‐quantitative reverse transcription‐PCR (RT‐PCR)] gene was designed using National Center for Biotechnology Information (NCBI)/Primer‐Basic Local Alignment Search Tool (BLAST) and analysed by the Oligo Analyser Tool (https://eu.idtdna.com/pages/tools/oligoanalyzer). The other primers were acquired from previous studies and obtained from the commercial company Macrogen, Inc. (Seoul, South Korea) (Table 1).
Table 1.
Primers used in this study
| Target gene | Primer name | Primer sequence | Size, bp | Reference |
|---|---|---|---|---|
| lanosterol 14α ‐demethylase | ERG11a | F 5′ TCCAGTTTTCGGTAAAGGGGT 3′ | 935 | this study (KF991530) |
| R 5′ TGGCTTTAGCAGCAGCAGTAT 3′ | ||||
| actin | ACTa | F 5′ ACCGAAGCTCCAATGAATCCAAAATCC 3′ | 516 | [19] |
| R 5′ GTTTGGTCAATACCAGCAGCTTCCAAA 3′ | ||||
| lanosterol 14α ‐demethylase | ERG11b | F 5′ TGGAGACGTGATGCTG 3′ | 204 | [20] |
| R 5′ AGTATGTTGACCACCCATAA3′ | ||||
| actin | ACTb | F 5′ GAGTTGCTCCAGAAGAACATCCAG 3′ | 199 | [21] |
| R 5′ TGAGTAACACCATCACCAGAATCC 3′ |
a Primer used in relative semi‐quantitative RT‐PCR.
b Primer used in relative quantitative real‐time RT‐PCR.
2.6 Relative semi‐quantitative RT‐PCR
The PCR kit (Ampliqon A180306, Odense, Denmark) was used for all amplification reactions according to the manufacturer's instruction. Control with no MuLVRNase H́ reverse transcriptase was added as the internal negative controls to ensure that the PCR products were not originated from genomic DNA. All reactions were performed in triplicate. The RT‐PCR reactions contained: 12.5 μl Taq 2× Master Mix, 1 μl (10 pmol/μl) each of forward primer and reverse primer, 3 μl (7 ng/μl) template cDNA and 7.5 μl PCR grade H2 O.
The Techne thermocycler (Bibby Scientific, USA) was programmed to perform a thermal cycling: 95°C for 5 min, 25 cycles of 95°C for 45 s, 55°C for 45 s, 72°C for 1 min and 72°C for 10 min. After amplification, PCR products were visualised under ultraviolet illumination using a gel documentation system (Bio‐Rad, USA) to verify amplicon quantity prior and gene expression or sequence analysis.
Relative quantitation of ERG11 gene expression (normalised to ACT) was calculated based on concentrations of PCR products as the fold changes in expression level of target gene = the ratio of target/reference in the treated sample relative to the ratio of target/reference in the untreated control sample. The expression levels of target gene were considered significantly up or downregulated if fold change≥2 or ≤0.5, respectively, and statistical difference with P value≤0.05 [17]. The PCR amplification products were analysed by Sanger sequencing (Macrogen). The sequence of nucleotide obtained for each gene was analysed using the BLAST (http://blast.ncbi.nlm.nih.gov/Blast.cgi). The obtained sequences were deposited to GenBank: BankIt – NCBI – National Institutes of Health (https://www.ncbi.nlm.nih.gov/WebSub/).
2.7 Relative quantitative real‐time RT‐PCR
Real‐time PCR was performed using SYBR™ Green quantitative PCR Master Mix (Fermentas, USA) on a Bio‐Rad MiniOpticonTM system (USA). Amplification conditions were as follows: 95°C for 5 min; 40 cycles of 95°C for 15 s, 60°C for 20 s and 72°C for 15 s. The relative expression levels of ERG11 gene were calculated by comparative Ct method (2−ΔΔCt formula) after normalisation with actin gene [19, 22].
2.8 Protein sequence similarity
Protein sequence similarity were analysed using Clustal Omega sequence alignment (https://www.ebi.ac.uk/Tools/msa/clustalo/) and Boxshade (https://embnet.vital‐it.ch/software/BOX_form.html) programes. Ten protein sequences of ERG11 were used for comparison, of which ten were obtained from GenBank, together with the two sequences newly obtained in this study (GenBank accession numbers QGV15867, QGV15868, AIQ80983, ACI15734, AIQ80971, AAF00603, ADI76624, ACN58340, BAC16518 and AEI60196).
2.9 Ergosterol quantification
About 25 mg of fluconazole‐resistant colonising isolate of C. albicans mass was added to various concentrations of magnetic iron‐oxide nanoparticles (two MIC, MIC, ½ MIC and ¼ MIC) and incubated for 24 h at 35°C. After centrifugation for 5 min at 1643g at 4°C, the cells were collected to extract lipids using an ethanolic solution of 25% potassium hydroxide. A mixture of sterile deionised water (1 ml) and n ‐heptane (Sigma‐Aldrich, 3 ml) was added, followed by agitation in a vortex for 3 min. The supernatant was spectrophotometrically read at 282 and 230 nm. The calibration curves were constructed with standard ergosterol. The results were expressed as the percentage of ergosterol in treated cell compared with untreated control [23].
2.10 Statistical analysis
One‐way analysis of variance was used to analyse data. Tukey's post‐hoc comparison was performed to compare gene expressions of the groups and ergosterol quantification. All statistics of the results are given as means±standard deviation (SD) of three independent experiments. Results were considered statistically significant when P < 0.05. Statistical analysis was performed using GraphPad Prism software (version 6; GraphPad Software Inc., CA, USA).
3 Results
A total of 12 (42.86%) colonising C. albicans isolates were obtained and identified from 28 cancer patients. Clinical C. albicans isolates were confirmed by microbiological and molecular methods. One new clinical isolate of C. albicans deposited at DNA Data Bank of Japan (DDBJ)/European Molecular Biology (EMBL)/GenBank under the accession number: MN336231. The results of fluconazole susceptibility test for clinical C. albicans isolates (colonised and vulvovaginitis) are shown in Table 2. Fluconazole resistance was observed in 93% (14/15) of clinical C. albicans isolates.
Table 2.
Fluconazole susceptibility testing results of isolates of C. albicans
| Code | Antibiotic name | Antibiotic class | Breakpoints | Number | %R | %I | %S | %R 95% CI | Geometric mean | MIC range |
|---|---|---|---|---|---|---|---|---|---|---|
| FLU_NM | fluconazole | antifungals | S < = 2 R > = 8 | 15 | 93 | 7 | 0 | 66.0–99.6 | 1614.588 | 4–16 |
CI: Confidence interval.
To test the susceptibility of nanoparticles as antifungal agents, we investigated 70 nm sized spherical magnetic iron‐oxide nanoparticles against fluconazole‐resistant colonising isolate of C. albicans (Table 3). Magnetic iron‐oxide nanoparticles elicited inhibitory effects to C. albicans. The MIC ranges of magnetic iron‐oxide nanoparticles were found to be 250–500 μg/ml in fluconazole‐resistant colonising isolate of C. albicans.
Table 3.
Results of susceptibility test of fluconazole and magnetic iron‐oxide nanoparticles against fluconazole‐resistant colonising isolate of C. albicans
| Isolates/antifungal | MIC values, μg/ml | |
|---|---|---|
| Fluconazole | Magnetic iron‐oxide nanoparticles | |
| C. albicans ATCC 90028 | 0.25 | 500 |
| Ca 1 | 16 | 250 |
| Ca 9 | 16 | 500 |
| Ca 11 | 16 | 250 |
| Ca 27 | 16 | 250 |
Ca: clinical C. albicans isolates.
We set out to identify pattern of expression of ERG11 gene in fluconazole‐resistant colonising isolate of C. albicans treated with magnetic iron‐oxide nanoparticles. We first used a panel of various concentrations of magnetic iron‐oxide nanoparticles (two MIC, MIC, ½ MIC and ¼ MIC), which allows integrative analyses of ERG11 gene expression with relative quantitative analysis. The expression of ERG11 was significantly (P ≤ 0.0001) downregulated in the fluconazole‐resistant colonising isolate of C. albicans treated with magnetic iron‐oxide nanoparticles but not in control (Fig. 1). The gene expression pattern of the ERG11 in fluconazole‐resistant colonising isolate of C. albicans mirrored the concentration‐dependent pattern, and this was significantly different between various concentrations of magnetic iron‐oxide nanoparticles based on MIC and untreated control. Relative with untreated control, the expression levels for two MIC, MIC, ½ MIC and ¼ MIC of the magnetic iron‐oxide nanoparticles were 0.35 ± 0.03, 0.54 ± 0.02, 0.82 ± 0.02 and 0.90 ± 0.01, respectively (P ≤ 0.0001). The box plots allow comparison of relative semi‐quantitation of ERG11 gene at various concentrations of magnetic iron‐oxide nanoparticles based on MIC (Fig. 2).
Fig. 1.

Expression of ERG11
(a) C. albicans ATCC 90028, (b) Fluconazole‐resistant colonising isolate of C. albicans treated with magnetic iron‐oxide nanoparticles at various concentrations based on MIC. Co: control negative for PCR, A1: ACT with two MIC concentration, E1: ERG11 with two MIC concentration, A2: ACT with MIC concentration, E2: ERG11 with MIC concentration, A3: ACT with ½ MIC concentration, E3: ERG11 with ½ MIC concentration, A4: ACT with ¼ MIC concentration, E4: ERG11 with ¼ MIC concentration, A5: ACT in untreated control, E5: ERG11 in untreated control and M: DNA molecular marker
Fig. 2.

Box plots of relative semi‐quantitation of ERG11
(a) C. albicans ATCC 90028, (b) Fluconazole‐resistant colonising isolate of C. albicans by RT‐PCR treated with various concentrations of magnetic iron‐oxide nanoparticles based on MIC
Real‐time RT‐PCR confirmed the significant decrease of ERG11 expression (P < 0.01 and 0.0001). Fig. 3 shows the relative quantification of ERG11 treated with various concentrations of magnetic iron‐oxide nanoparticles based on MIC using real‐time RT‐PCR. The range of fold changes in terms of ERG11 expression to untreated control were 0.09–0.19 in fluconazole‐resistant colonising isolate of C. albicans.
Fig. 3.

Relative quantitation of ERG11 gene in C. albicans ATCC 90028 and fluconazole‐resistant colonising isolate of C. albicans after treatment with various concentrations of magnetic iron‐oxide nanoparticles based on MIC (two MIC, MIC, ½MIC and 1/4MIC) by real‐time RT‐PCR. Data are means±SD of three independent experiments (*P < 0.01 and **P < 0.0001)
Sequences of ERG11 and ACT in C. albicans ATCC 90028 and fluconazole‐resistant colonising isolate of C. albicans were not found in the C. albicans database and sequences deposited at DDBJ/EMBL/GenBank under the following accession numbers: MN609775, MN609776, MN609777 and MN609778.
Comparison of the ten protein sequences of ERG11 showed per cent identity matrix of 99.05–100. The two sequences newly obtained in this study showed percent identity matrix of 100 and 99.59–100 for C. albicans ATCC 90028 (QGV15867) and fluconazole‐resistant colonising isolate of C. albicans (QGV15868), respectively. No significant differences were found in fluconazole‐resistant colonising isolate of C. albicans and by comparison with ERG11 reference sequences (Fig. 4).
Fig. 4.

Protein sequence similarity of ERG11 in C. albicans ATCC 90028 (QGV15867) and fluconazole‐resistant colonising isolate of C. albicans (QGV15868) after treatment with various concentrations of magnetic iron‐oxide nanoparticles were performed by online programmes Clustal Omega sequence alignment and Boxshade. Black shading represents amino acid identity and grey shading represents similarity
The magnetic iron‐oxide nanoparticles significantly (P < 0.01 and 0.0001) altered ergosterol content of fluconazole‐resistant colonising isolate of C. albicans in a concentration‐dependent manner. The magnetic iron‐oxide nanoparticles (two MIC, MIC, ½ MIC and ¼ MIC) caused 57, 50, 45 and 40% reduction in total ergosterol content, respectively (Fig. 5).
Fig. 5.

Percent ergosterol levels of ATCC 90028 and fluconazole‐resistant colonising isolate of C. albicans after treatment with various concentrations of magnetic iron‐oxide nanoparticles based on MIC (two MIC, MIC, ½MIC and 1/4MIC). Data are means±SD of three independent experiments (*P < 0.01 and **P < 0.0001)
4 Discussion
Owing to the emergence of azole‐resistant Candida species, it has been an urgency to discover and develop new antifungal agents. The application of antifungal nanoparticles in inhibiting pathogenic fungi is pretty interesting, given their distinctive advantages, including environmentally friendly, cost‐effective, little toxicity to host cells, reduced side effects and the ability to overcome drug resistance of pathogen [24, 25, 26, 27].
Nanoparticles showed strong activity against various microorganisms such as bacteria, viruses, parasites and fungi [24, 26]. In this study, we found that the magnetic iron‐oxide nanoparticles inhibit the in vitro growth of fluconazole‐resistant colonising isolate of C. albicans. The antimicrobial activity of magnetic iron‐oxide nanoparticles has been demonstrated in many microbes, including bacteria and several fungi [27, 28, 29, 30, 31]. This activity is attributed to special properties of magnetic iron‐oxide nanoparticles in their ability to produce reactive oxygen species (ROS), oxidative stress, singlet oxygen (1O2), superoxide radicals (O2−), hydrogen peroxide (H2 O2) or hydroxyl radicals (OH−) [24, 26]. Seddighi et al. [25] demonstrated that magnetic iron‐oxide nanoparticles effectively inhibit the growth of various Candida species such as C. albicans, Candida tropicalis and Candida glabrata. Niemirowicz et al. [32] evaluated the candidacidal efficiency of magnetic iron‐oxide nanoparticles coated with cathelicidin LL‐37 and ceragenin CSA‐13 against laboratory and clinical strains of C. albicans, C. glabrata and C. tropicalis. Interestingly, they confirm the high‐anti‐Candida activity of these well known antifungal agents mediated by their interaction with the fungal membrane. It is hypothesised that both magnetic iron‐oxide nanoparticles and cationic antimicrobial peptides (CAP) affect the cellular redox status of Candida leading to formation of ROS. Furthermore, Prodan et al. [33] found that the antimicrobial activity of iron‐oxide nanoparticles is dependent on the concentration of metallic ions in solution and on the microbial growth state, either planktonic or adherent of bacterial or fungal cell.
In this study, however, the magnetic iron‐oxide nanoparticles, which showed strong activity against C. albicans, obviously reduce the ERG11 gene expression in fluconazole‐resistant colonising isolate. Recently, the expression of ERG11 has received great attentions. Since the alternation in ERG11 depended on the specific resistance mechanism of C. albicans. Several nanoparticles such as selenium and gold have been proved to have inhibitory functions to the expression of ERG11 in C. albicans [34, 35]. In contrast, Zare et al. [22] demonstrated that biogenic tellurium nanoparticles effectively inhibit the squalene monooxygenase enzyme, which lead to increase in the ERG1 gene expression in C. albicans. Evidence demonstrated that the amino acid substitutions in the ERG11 result in decreased fluconazole susceptibility [5, 36]. Indeed, we aimed to find out whether the downregulation of the gene by nanoparticle was due to mutations or to some other contributing factors. In this study, we used a big part of ERG11 for detection of mutation. Clearly, there was no mutation in fluconazole‐resistant colonising isolate of C. albicans by comparison with ERG11 reference sequences (Fig. 4). It may seem that the expression level of ergosterol biosynthetic gene tested itself as potentially not affected by mutation or need to investigate the promoter and transcriptional factors of ERG11 [11]. Furthermore, the reduction of cellular ergosterol content has also shown great potential for antifungal activity magnetic iron‐oxide nanoparticles. Down expression of ERG11 could block the ergosterol biosynthesis pathway and lead to defects in cell membrane integrity and finally cell death [37].
5 Conclusion
In conclusion, this study revealed the strong inhibitory effect of magnetic iron‐oxide nanoparticles on fluconazole‐resistant colonising isolate of C. albicans. Moreover, this effect is mediated by the strong inhibitory functions to the expression of ERG11 as a probable target gene and ergosterol content. Our favourable findings shed a novel light on the application of magnetic iron‐oxide nanoparticles in fighting against resistant C. albicans. Further studies of the other genes and proteins involved in the biosynthesis of ergosterol are required to explore the mechanisms that could be targeted to inhibitory effect of magnetic iron‐oxide nanoparticles on fluconazole‐resistance C. albicans.
6 Acknowledgments
We thank the Islamic Azad University of Yasooj for financial support. The results of the present study are part of the Master thesis (10943546).
7 References
- 1. Lamoth F. Lockhart S.R. Berkow E.L. et al.: ‘Changes in the epidemiological landscape of invasive candidiasis’, J. Antimicrob. Chemother., 2018, 73, (suppl 1), pp. 4–i13 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2. Nami S. Mohammadi R. Vakili M. et al.: ‘Fungal vaccines, mechanism of actions and immunology: a comprehensive review’, Biomed. Pharmacother., 2019, 109, pp. 333 –344 [DOI] [PubMed] [Google Scholar]
- 3. Reyna‐Beltrán E. Iranzo M. Calderón‐González K.G. et al.: ‘The Candida albicans ENO1 gene encodes a transglutaminase involved in growth, cell division, morphogenesis, and osmotic protection’, J. Biol. Chem., 2018, 293, (12), pp. 4304 –4323 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4. Cowen L.E. Sanglard D. Howard S.J. et al.: ‘Mechanisms of antifungal drug resistance’, Cold Spring Harb. Perspect. Med., 2014, 5, (7), p. a019752 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5. Whaley S.G. Berkow E.L. Rybak J.M. et al.: ‘Azole antifungal resistance in Candida albicans and emerging non‐albicans Candida species’, Front. Microbiol., 2017, 7, p. 2173 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6. Perlin D.S. Shor E. Zhao Y. et al.: ‘Update on antifungal drug resistance’, Curr. Clin. Microbiol. Rep., 2015, 2, (2), pp. 84 –95 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7. Arendrup M.C. Patterson T.F: ‘Multidrug‐resistant Candida: epidemiology, molecular mechanisms, and treatment’, J. Infect. Dis., 2017, 216, (suppl 3), pp. S445 –S451 [DOI] [PubMed] [Google Scholar]
- 8. Wu S. Wang Y. Liu N et al.: ‘Tackling fungal resistance by biofilm inhibitors’, J. Med. Chem., 2017, 60, (6), pp. 2193 –2211 [DOI] [PubMed] [Google Scholar]
- 9. Perlin D.S. Rautemaa‐Richardson R. Alastruey‐Izquierdo A.: ‘The global problem of antifungal resistance: prevalence, mechanisms, and management’, Lancet Infect. Dis., 2017, 17, (12), pp. e383 –e392 [DOI] [PubMed] [Google Scholar]
- 10. Berkow E.L. Lockhart S.R.: ‘Fluconazole resistance in Candida species: a current perspective’, Infect. Drug Resist., 2017, 10, pp. 237 –245 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11. Flowers S.A. Barker K.S. Berkow E.L. et al.: ‘Gain‐of‐function mutations in UPC2 are a frequent cause of ERG11 upregulation in azole‐resistant clinical isolates of Candida albicans ’, Eukaryot. Cell, 2012, 11, (10), pp. 1289 –1299 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12. El‐Boubbou K.: ‘Magnetic iron‐oxide nanoparticles as drug carriers: clinical relevance’, Nanomedicine (Lond.), 2018, 13, (8), pp. 953 –971 [DOI] [PubMed] [Google Scholar]
- 13. Vangijzegem T. Stanicki D. Laurent S.: ‘Magnetic iron‐oxide nanoparticles for drug delivery: applications and characteristics’, Expert Opin. Drug Deliv., 2019, 16, (1), pp. 69 –78 [DOI] [PubMed] [Google Scholar]
- 14. Vallabani N.V.S. Singh S.: ‘Recent advances and future prospects of iron‐oxide nanoparticles in biomedicine and diagnostics’, 3 Biotech., 2018, 8, (6), p. 279 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15. Rodrigues G.R. López‐Abarrategui C. de la Serna Gómez I. et al.: ‘Antimicrobial magnetic nanoparticles based therapies for controlling infectious diseases’, Int. J. Pharm., 2019, 555, pp. 356 –367 [DOI] [PubMed] [Google Scholar]
- 16. Fatemi M. Mollania N. Momeni‐Moghaddam M. et al.: ‘The anti‐bacterial effects of magnetic iron‐oxide nanoparticles produced by biological method and the kinetic study of mortality of common strains in clinical infections’, Nova Biol. Reperta, 2019, 6, (1), pp. 30 –38 [Google Scholar]
- 17. Alizadeh F. Khodavandi A. Zalakian S.: ‘Quantitation of ergosterol content and gene expression profile of ERG11 gene in fluconazole‐resistant Candida albicans ’, Curr. Med. Mycol., 2017, 3, (1), pp. 13 –19 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18. Alizadeh F. Khodavandi A. Esfandyari S. et al.: ‘Analysis of ergosterol and gene expression profiles of sterol Δ5,6 ‐desaturase (ERG3) and lanosterol 14α ‐demethylase (ERG11) in Candida albicans treated with carvacrol’, J. Herbmed. Pharmacol., 2018, 7, (2), pp. 79 –87 [Google Scholar]
- 19. Khodavandi A. Harmal N.S. Alizadeh F. et al.: ‘Comparison between allicin and fluconazole in Candida albicans biofilm inhibition and in suppression of HWP1 gene expression’, Phytomedicine, 2011, 19, (1), pp. 56 –63 [DOI] [PubMed] [Google Scholar]
- 20. Lee M.K. Williams L.E. Warnock D.W. et al.: ‘Drug resistance genes and trailing growth in Candida albicans isolates’, J. Antimicrob. Chemother., 2004, 53, (2), pp. 217 –224 [DOI] [PubMed] [Google Scholar]
- 21. Lim C.S.Y. Wong W.F. Rosli R. et al.: ‘2‐Dodecanol (decyl methyl carbinol) inhibits hyphal formation and SIR2 expression in C. albicans ’, J. Basic Microbiol., 2009, 49, (6), pp. 579 –583 [DOI] [PubMed] [Google Scholar]
- 22. Zare B. Sepehrizadeh Z. Faramarzi M.A. et al.: ‘Antifungal activity of biogenic tellurium nanoparticles against Candida albicans and its effects on squalene monooxygenase gene expression’, Biotechnol. Appl. Biochem., 2014, 61, (4), pp. 395 –400 [DOI] [PubMed] [Google Scholar]
- 23. Santos J.R.A. Gouveia L.F. Taylor E.L.S. et al.: ‘Dynamic interaction between fluconazole and amphotericin B against Cryptococcus gattii ’, Antimicrob. Agents Chemother., 2012, 56, (5), pp. 2553 –2558 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24. Rudramurthy G.R. Swamy M.K. Sinniah U.R. et al.: ‘Nanoparticles: alternatives against drug‐resistant pathogenic microbes’, Molecules, 2016, 21, (7), p. 836 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25. Seddighi N.S. Salari S. Izadi A.R.: ‘Evaluation of antifungal effect of iron‐oxide nanoparticles against different Candida species’, IET Nanobiotechnol., 2017, 11, (7), pp. 883 –888 [Google Scholar]
- 26. Aderibigbe B.A.: ‘Metal‐based nanoparticles for the treatment of infectious diseases’, Molecules, 2017, 22, (8), p. 1370 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27. Parveen S. Wani A.H. Shah M.A. et al.: ‘Preparation, characterization and antifungal activity of iron‐oxide nanoparticles’, Microb. Pathog., 2018, 115, pp. 287 –292 [DOI] [PubMed] [Google Scholar]
- 28. Ismail R.A. Sulaiman G.M. Abdulrahman S.A. et al.: ‘Antibacterial activity of magnetic iron‐oxide nanoparticles synthesized by laser ablation in liquid’, Mater. Sci. Eng. C Mater. Biol. Appl., 2015, 53, pp. 286 –297 [DOI] [PubMed] [Google Scholar]
- 29. Arakha M. Pal S. Samantarrai D. et al.: ‘Antimicrobial activity of iron‐oxide nanoparticle upon modulation of nanoparticle–bacteria interface’, Sci. Rep., 2015, 5, p. 14813 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30. Javanbakht T. Laurent S. Stanicki D. et al.: ‘Relating the surface properties of superparamagnetic iron‐oxide nanoparticles (SPIONs) to their bactericidal effect towards a biofilm of Streptococcus mutans ’, PLoS One, 2016, 11, (4), p. e0154445 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31. Devi H.S. Boda M.A. Shah M.A. et al.: ‘Green synthesis of iron‐oxide nanoparticles using Platanus orientalis leaf extract for antifungal activity’, De Gruyter, 2019, 8, pp. 38 –45 [Google Scholar]
- 32. Niemirowicz K. Durnaś B. Tokajuk G. et al.: ‘Formulation and candidacidal activity of magnetic nanoparticles coated with cathelicidin LL‐37 and ceragenin CSA‐13’, Sci. Rep., 2017, 7, (1), p. 4610 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33. Prodan A.M. Iconaru S.L. Chifiriuc C.M. et al.: ‘Magnetic properties and biological activity evaluation of iron‐oxide nanoparticles’, J. Nanomater., 2013, 2013, pp. 1 –7 [Google Scholar]
- 34. Parsameher N. Rezaei S. Khodavasiy S. et al.: ‘Effect of biogenic selenium nanoparticles on ERG11 and CDR1 gene expression in both fluconazole‐resistant and ‐susceptible Candida albicans isolates’, Curr. Med. Mycol., 2017, 3, (3), pp. 16 –20 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35. Rahimi H. Roudbarmohammadi S. Delavari H. et al.: ‘Antifungal effects of indolicidin‐conjugated gold nanoparticles against fluconazole‐resistant strains of Candida albicans isolated from patients with burn infection’, Int. J. Nanomed., 2019, 14, pp. 5323 –5338 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36. Wang H. Kong F. Sorrel T.C. et al.: ‘Rapid detection of ERG11 gene mutations in clinical Candida albicans isolates with reduced susceptibility to fluconazole by rolling circle amplification and DNA sequencing’, BMC Microbiol., 2009, 9, p. 167 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37. Lv Q.Z. Yan L. Jiang Y.Y: ‘The synthesis, regulation, and functions of sterols in Candida albicans: well‐known but still lots to learn’, Virulence, 2016, 7, (6), pp. 649 –659 [DOI] [PMC free article] [PubMed] [Google Scholar]
