Effect of green GO/Au nanocomposite on in‐vitro amplification of human DNA

Abstract

Recently nanomaterials have attracted interest for increasing efficiency of polymerase chain reaction (PCR) systems. Here, the authors report on the usefulness of green graphene oxide/gold (GO/Au) nanocomposites for enhancement of PCR reactions. In this study, green GO/Au nanocomposite was prepared with Matricaria chamomilla extract as reducing/capping agent for site‐directed nucleation of Au^o atoms on surface of GO sheets. The as‐prepared green GO/Au nanocomposites were then characterised with UV–VIS spectrophotometer and scanning electron microscopy. Later, the effect of these nanocomposites was studied on end‐point and real‐time PCR employed for amplification of human glyceraldehyde‐3‐phosphate dehydrogenase gene. The results indicated that GO/Au nanocomposite can improve both end‐point and real‐time PCR methods at the optimum concentrations, possibly through interaction between GO/Au nanocomposite and the materials in PCR reaction, and through providing increased thermal convection by the GO surface as well as the Au nanostructures. In conclusion, it can be suggested that green GO/Au nanocomposite is a biocompatible and eco‐friendly candidate as enhancer of in‐vitro molecular amplification strategies.

1 Introduction

Polymerase chain reaction (PCR) is a technique for amplification of DNA fragments with a specific sequence in molecular biology [1]. Some applications include diagnosis of genetic diseases, gene cloning, genetic fingerprint identification, gene expression analysis, diagnosis of hereditary diseases and nucleic acid testing for the diagnosis of infectious diseases [2, 3, 4, 5, 6, 7, 8]. Due to this immense importance of PCR in molecular biology, a variety of approaches are exploited to enhance the efficiency of PCR reactions, especially for amplification of hard‐to‐amplify templates. In recent years, one of the strategies used to increase the efficiency of the PCR system is application of nanomaterials due to their exceptional features [9, 10] originated by their large surface‐to‐volume ratios in compared with bulk materials [11]. As a result, nanomaterials can readily interact with the materials present in PCR reaction, and thus, they are capable of modulating PCR cycles [12] primarily by affecting thermal convection. Thus, thermally‐conductive nanomaterials are considered as potential candidates for enhancing the efficiency of PCR reactions. Among these nanomaterials, graphene oxide (GO) has been proven to improve PCR efficiency [13]. GO is a member of the nano‐carbon family with a two‐dimensional (2D) structure, which is constructed of hexagonal networks of carbon atoms that are aligned with covalent bonds [14, 15]. In other words, graphene is a layer of carbon atoms that are arranged in 2D, therefore the thickness is equal to the diameter of the carbon atoms and the light can easily pass through it [16]. Structural features of graphene make it suitable material for application in sensors [17]. Other highly considered features of graphene are its thermal and electrical conductivity, mechanical strength and high flexibility [18, 19, 20]. It was also shown that the size and surface charge of GO have significant effects on the PCR reactions [21]. Other nanomaterials that have been widely used in molecular biology, especially in the PCR reaction, are gold nanoparticles (AuNPs) [22, 23] which can be easily produced and handled using simple protocols. The most significant features of these nanomaterials are their thermal stability and conductivity, and also attractive surface properties [24, 25]. For instance, AuNPs have shown to interact with primers, single‐stranded template and DNA polymerase, which can affect PCR reactions through increased thermal cycling and direct effects on the local concentration of reaction components [26]. Therefore, with regards to some reported positive effects of GO and AuNPs on PCR efficiency, herein we aimed to investigate the behaviour of green GO/Au nanocomposite in both qualitative and quantitative PCR reactions. We have hypothesised that application of green GO/Au nanocomposite can increase the PCR efficiency due to its compatibility with the biological components of PCR reaction, especially DNA polymerase enzyme.

2 Materials and methods

2.1 Materials

Chloroauric acid (HAuCl₄ •4H₂ O) was purchased from Sigma‐Aldrich. GO was purchased from Sigma‐Aldrich. DNA was isolated from human cells. The primer sequences were synthesised by Bioneer (South Korea). GeneRuler 100 bp Plus DNA Ladder and 6x DNA loading dye were purchased from Fermentas. DNAse/RNAse‐free Millipore Milli‐Q water was used in all experiments. PCR mastermix was purchased from Cinnagen inc. (Iran) and real‐time PCR mastermix was provided by Ampliqon A/S. Agarose and Tris‐acetate‐EDTA buffer were supplied by Cinnagen Inc. (Iran).

2.2 Methods

2.2.1 Preparation of green GO/Au nanocomposites

The preparation of GO/Au nanocomposites was based on the reduction of Au (III) complex by aqueous extract of Matricaria chamomilla. In this way, 250 µl of HAuCl₄ solution (1 mM) was added to 460 µl of GO aqueous suspension. Then, this suspension was mixed and incubated at room temperature (RT) for 1 h to allow adsorption of Au ions onto the hydroxyl groups present on GO surface. Then, the extract was added drop‐wise and the suspension was left shaking at RT for 5 h. Finally, the resultant nanocomposite was washed five times with distilled water using centrifugation at 7500 rpm for 5 min [27, 28]. The prepared GO/Au nanocomposite was characterised by UV–VIS spectrophotometer (CECIL) and scanning electron microscopy (SEM) (MIRA3 FEG‐SEM, Tescan).

2.3 PCR amplification study

Pair of primers was designed using GenScript Primer Design tool (https://www.genscript.com/tools/pcr‐primers‐designer) for amplification of human glyceraldehyde‐3‐phosphate dehydrogenase (GAPDH) gene (GenBank accession number: AC006064.10). Specificity of the designed primers was analysed using Primer‐BLAST (https://www.ncbi.nlm.nih.gov/tools/primer‐blast/), and also OligoAnalyzer 3.1 (https://eu.idtdna.com/calc/analyzer) was used for checking potential of the designed primers for dimer and secondary structure formation. Sequence of the selected primers is shown in Table 1.

Table 1.

Selected primers used for the amplification of human GAPDH gene

Name	Sequence (5′→3′)	Tm	GC%	Length
forward	TGTTCCAATATGATTCCACCCA	57	41	22
reverse	GGCAGAGATGATGACCCTTT	57	50	20

End‐point PCR reaction mixture (final volume of 20 µl) included master mix (10 µl), forward and reverse primers (1 µl each), human DNA (2 µl) and various concentrations of green GO/Au nanocomposite (6 µl). including 0, 1/2, 1/4, 1/8, 1/16, 1/32, 1/64, 1/128, 1/256 and 1/512 ratios. The cycling program consisted of a primary denaturation for 3 min at 94°C (1 cycle); secondary denaturation for 30 s at 94°C, annealing for 30 s at 56°C and extension for 30 s at 72°C (35 cycles) and an additional extension step at 72°C for 10 min. PCR products were resolved using 1% agarose gel electrophoresis.

The real‐time PCR reaction was performed using MIC Thermocycler (MIC Inc.) in a final volume of 12 µl containing 6 µl SYBRR Green master mix (2X), 1 µl of each primer and 1 µl of human DNA. The reaction was supplemented with 4 µl of various concentrations of the nanocomposite ranging from 0–1/512 ratio. The cycling program was as follows: initial denaturation at 95°C for 15 min (1 cycle), followed by 40 cycles of denaturation at 95°C for 20 s, annealing at 60°C for 30 s and extension at 72°C for 30 s. The data were recorded and analysed by biomolecular systems software.

3 Results and discussion

Green GO/Au nanocomposite was prepared with Matricaria chamomilla extract as reducing/capping agent for site‐directed nucleation of Au^o atoms on surface of GO sheets. The as‐prepared nanocomposite was characterised with UV–VIS spectrophotometer and SEM. To confirm co‐presence of GO and AuNPs in structure of the nanocomposite, UV–VIS spectra were recorded for GO and the GO/Au nanocomposite in the 200–700 nm range. According to the recorded spectra, a peak in 209 nm corresponded to the characteristic absorption of GO and peak in 533 nm confirmed the presence of AuNPs, indicating AuNPs assembled on GO (Fig. 1).

Fig. 1.

UV–VIS spectra of GO and green Go/Au nanocomposite. A colour change was observed after formation of the as‐prepared nanocomposite. Also, a characteristic peak in 209 nm was observed for GO which was attenuated after formation of the GO/Au nanocomposite; whereas, a characteristic peak at 533 nm confirmed the presence of AuNPs in structure of the nanocomposite

SEM images of green GO/Au nanocomposite were obtained using a MIRA3 FEG‐SEM (Tescan). Fig. 2 shows the nanograph of GO and green GO/Au nanocomposite. Green AuNPs with diameter of ∼25 nm, as measured with Digimizer image analysis software, were observed on the surface of GO. Previous studies showed that GO surface, due to possessing of hydroxyl groups, has a main role in the site‐directed nucleation and growth of AuNPs [27].

Fig. 2.

SEM graphs of

(a) Green GO/Au nanocomposite, (b) GO. The figure shows attachment of spherical AuNPs on GO surface

To investigate the effect of the green GO/Au nanocomposite on PCR, a specific region of human GAPDH gene was amplified in the absence or presence of various concentrations of the green GO/Au nanocomposite, followed by agarose gel electrophoresis for the end‐point PCR. The results showed amplification of GAPDH gene in the presence of GO/Au nanocomposite, where some concentration was capable of producing more amplicons as evident from the sharper electrophoretic bands. However, in some concentrations, an inhibition of PCR reaction was detected. Indeed, the concentrations 1/128, 1/256 and 1/512 (green GO/Au nanocomposite to DNAse‐RNAse free water ratio, v/v) enhanced the amplification; with the most efficiency was observed for 1/128. Whereas, the ratios 1/2, 1/4 and 1/8 completely inhibited the reaction; a reduced amplification was observed for concentration 1/64 and the reaction was not affected by the concentrations 1/16 and 1/32 (Fig. 3).

Fig. 3.

Effect of serial concentrations of green GO/Au nanocomposite (the nanocomposite to DNAse/RNAse free water ratio, v/v) on end‐point PCR. M: size marker, 1: control, 2: blank, 3–11 indicate the serial dilutions of GO/Au nanocomposite: 1/2, 1/4, 1/8, 1/16, 1/32, 1/64, 1/128, 1/256 and 1/512, respectively. The concentrations 1/128, 1/256 and 1/512 enhanced the amplification; with the most efficiency was observed for 1/128. Whereas, the ratios 1/2, 1/4 and 1/8 completely inhibited the reaction; a reduced amplification was observed for concentration 1/64 and the reaction was not affected by the concentrations 1/16 and 1/32

Beside the study of effect of the as‐prepared nanocomposite on end‐point PCR reactions, a quantitative PCR (real‐time PCR) was run containing the serial concentrations of the nanocomposite. In real‐time PCR experiments, threshold cycle (Ct) and melting curve (MC) were investigated before and after exposure to the nanocomposite. The data analysis indicated that in some concentrations both Ct and MC were affected by the nanocomposite (Fig. 4).

Fig. 4.

Effect of serial concentrations of green GO/Au nanocomposite (the nanocomposite to DNAse/RNAse free water ratio, v/v) on real‐time PCR. Similar to the end‐point PCR, some concentrations of the nanocomposite could decrease the Ct and improve MC, which indicates improvement of real‐time PCR reactions for amplification of the human GAPDH gene

According to the results, some concentrations of the nanocomposite could improve the real‐time PCR reaction used for amplification of the human GAPDH gene; where, the ratios 1/128 and 1/256 had most significant effect with approximately 10 units decrease in the Ct of the control reaction. Nevertheless, some reactions possessed unfavourable effects on the reaction (Table 2).

Table 2.

Ct values of the control and the test real‐time PCR reactions obtained from the amplification of human GAPDH gene

Reaction	Nanocomposite ratio in the reaction	Ct	ΔCta
control	0	29.17	0
test 1	1/4	nab	—
test 2	1/8	25.12	4.05
test 3	1/16	na	—
test 4	1/32	24	5.17
test 5	1/64	23.97	5.20
test 6	1/128	19.54	9.63
test 7	1/256	19.50	9.67
test 8	1/512	22.46	6.71

^a ΔCt = Ct_control  − Ct_test.

^b na: no amplification.

According to our results, exposure of both end‐point and real‐time PCR reactions to green GO/Au nanocomposite resulted in improvement of efficiency of amplification of human GAPDH DNA. These results are in agreement with the studies reporting similar effects of other nanomaterials on PCR; AuNPs, carbon nanomaterials – such as graphene nanoflakes and nanotubes – and quantum dots are capable of enhancing the specificity of PCR [10].

In the previous studies, some mechanisms involved in the enhancement of PCR reactions have been suggested. For example, AuNPs can mimic the function of single‐stranded DNA binding protein (SSB), where they maintain the single‐stranded DNA apart and prevent their unfavourable re‐annealing that facilities DNA polymerisation. Also, AuNPs are capable of shortening the reaction time due to their thermal conductivity by increasing the heating/cooling rates; the heat may help to match the primer and the template. In addition, interactions between AuNPs and polymerase can be used to modulate and optimise PCR process [29]. A study reported that the GO with concentration of 12–60 µg/ml was determined to be optimum for enhanced PCR specificity. ssDNA that has one unpaired phosphate backbone can easily bind on GO surface because of non‐specific hydrogen bonding and can be analogue to SSBs, thus it can increase the efficiency and specificity of PCR. In the replication of DNA within cells, after that double‐stranded DNA was opened by helicase, multiple SSBs are bound to ssDNA to inhibit re‐annealing of ssDNA. Similar to AuNP, GO can act as SSB and inhibit re‐annealing of amplified DNA during the annealing step and help DNA melting during the denaturing step [30, 31].

Taken together, our study describes that green GO/Au nanocomposite would improve the PCR output through all mechanisms aforementioned separately for both AuNPs and GO, indicating its cumulative advantageous features. Further, due to the application of green chemistry for preparation of the nanocomposite it would be considered as biocompatible and eco‐friendly PCR nanoenhancer that has not already reported in the previous studies.

4 Conclusion

In this study, we investigated the effect of green GO/Au nanocomposite on amplification of human GAPDH gene by PCR method as in‐vitro DNA amplification strategy. The results showed that this green GO/Au nanocomposite in optimal concentrations can improve the PCR reactions. Due to the biocompatibility and eco‐friendliness of the green GO/Au nanocomposite, it can be safely used in PCR reactions as novel nanoenhancer. Also due to the similarities in the reaction mixtures between PCR and non‐PCR based strategies, future studies can be focused on the application of the developed green GO/Au nanocomposite in non‐PCR in‐vitro DNA amplification methods to enhance their efficiency, particularly in the isothermal amplification techniques.