Biosynthesised AgCl NPs using Bacillus sp. 1/11 and evaluation of their cytotoxic activity and antibacterial and antibiofilm effects on multi‐drug resistant bacteria

Abstract

Silver nanoparticles (AgNPs) have attracted the attention of researchers due to their properties. Biological synthesis of AgNPs is eco‐friendly and cost‐effective preferred to physical and chemical methods, which utilize environmentally harmful agents and large amounts of energy. Microorganisms have been explored as potential biofactories to synthesize AgNPs. Bacterial NP synthesis is affected by Ag salt concentration, pH, temperature and bacterial species. In this study, Bacillus spp., isolated from soil, were screened for AgNP synthesis at pH 12 with 5 mM Ag nitrate (AgNO₃) final concentration at room temperature. The isolate with fastest color change and the best ultraviolet‐visible spectrum in width and height were chosen as premier one. AgNO₃ and citrate salts were compared in terms of their influence on NP synthesis. Spherical Ag chloride (AgCl) NPs with a size range of 35–40 nm were synthesized in 1.5 mM Ag citrate solution. Fourier transform infrared analysis demonstrated that protein and carbohydrates were capping agents for NPs. In this study, antimicrobial and antitumor properties of the AgNP were investigated. The resulting AgCl NPs had bacteriostatic activity against four standard spp. And multi‐drug resistant strain of Pseudomonas aeruginosa. These NPs are also cytotoxic to cancer cell lines MCF‐7, U87MG and T293.

1 Introduction

Nanobiotechnology is a progressing science involving the production and consumption of nanoscale objects in biological systems. Nanoparticles (NPs) are zero‐dimensional materials and building blocks of nanotechnology, which involves clusters of atoms in the size range of 1–100 nm [1]. Owing to their increased surface to volume ratios, metal NPs have different thermal, optical, electronic, mechanical and chemical properties compared with their bulk counterparts. High conductivity, chemical resistance, antimicrobial activity and catalytic activity are special features of silver NPs (AgNPs) that have attracted attention from researchers. Harmful chemical reducing, capping agents and high‐energy utilisation for producing monodisperse NPs are disadvantages of chemical and physical methods [2, 3]. Furthermore, utilising toxic materials and non‐polar solvents in production processes can restrict the application of these NPs in medicine, so there is a need for a non‐toxic, clean and eco‐friendly method for NP synthesis. Biological techniques are safe, cost‐effective and produce NPs in natural conditions. Microorganisms which have reducing and stabilising agents in their extracts have been explored as potential biofactories for NP synthesis [4]. Although biological synthesis of metallic NPs is time‐consuming and produces polydisperse NPs, it could be optimised by changing environmental factors such as Ag salt concentrations, pH, temperature and microorganism species. Bacteria are preferred among microorganisms due to their ease of use and the ability to genetically manipulate them to produce specific agents for NP synthesis [5]. To synthesise AgNP by bacteria, broth media are required for bacterial growth, which may have reducing agents such as yeast extract and tryptone. These compounds can synthesise AgNP without the need for bacteria. Therefore, choosing the best method for bacterial extract preparation is an important step in bacteria‐mediated AgNP synthesis [6].

In this paper, a novel method for bacterial extract preparation suitable for NP synthesis was investigated, and then different bacterial isolates were investigated for NP synthesis. The optimal NP was characterised and its biological effects were investigated.

2 Material and methods

2.1 Synthesis of AgNP

Each bacterial isolate was cultured in culture medium for maximum nitrate reductase (NR) expression containing 15, 10, 3.5 and 3.5 g l⁻¹ glucose, tryptone, yeast extract and potassium nitrate, respectively [7]. The culture is incubated in rotatory shaker with 150 rpm at 37°C. The growth curves of each bacterial isolate were drawn, accompanied by spore staining.

Each bacterial culture was centrifuged (8500g, 20 min, 4°C) after 12 h in logarithmic phase before spore forming. The supernatant was discarded and 1 of bacterial biomass were suspended in 10 ml sterile distilled water and centrifuged after 36 h incubation (37°C, 150 rpm). The bacterial cell free supernatant adjusted to pH12 was used as bacterial extract and mixed by Ag nitrate (AgNO₃) and citrate.

2.2 Screening of Bacillus spp. for AgNP synthesis

Bacillus subtilis ATCC 6633, Halobacillus karajensis and ten Bacillus spp. isolated from soil located in Malayer, Hamedan city, Iran, 34°17′ latitude and 48°17′ longitude have chosen for AgNP synthesis screening [8]. Each bacterial extract adjusted to pH12 were subjected to 5 mM AgNO₃ final concentration in dark at room temperature. Colour changes of each sample was checked periodically and further investigated by ultraviolet–visible (UV–vis) spectroscopy by Spekol2000 instrument (350–600 nm) to choose the bacterial isolate by maximum absorbance and rapid colour changes as premier one.

2.3 Molecular identification of premier isolate

To do molecular identification [8], Bacillus isolate was cultured in Lysogeny Broth (LB) medium (37°C, 150 rpm) and the biomass was harvested by centrifugation (4500g, 10 min) after 18 h and used for DNA extraction. The extraction of genomic DNA was accomplished by polymerase chain reaction (PCR) template purification kit (Qiagen, Iran). The thermal cycle's amplification of 16S rDNA fragments was performed by forward (27F) and reverse (1492R) primers with 5′‐AGAGTTTGATCCTGGCTCAG‐3′ and 5′‐TACGGCTACCTTGTTACGACTT‐3′ sequences, respectively. The PCR included an initial denaturation at 95°C for 10 min, followed by 35 cycles of denaturation at 94°C for 60 s, annealing at 58°C for 30 s and extension at 72°C for 10 min. The PCR product sequenced by Sanger di‐deoxy method and aligned by BLASTn program on National Center for Biotechnology Information, followed by phylogenetic tree plotting using neighbour‐joining algorithms in mega7.

2.4 Optimisation of AgNP synthesis

Aliquots of premier bacterial extract were prepared for different pH (6–12), and then dispersed in test tubes containing different final concentrations of AgNO₃ (1–5 mM) and incubated in dark at room temperature. The results were investigated by UV–vis spectroscopy.

2.5 Ag salts effect on NP size

AgNO₃ and citrate final concentrations (1, 2, 3, 4, 5 for AgNO₃ and 0.5, 1, 1.5, 2 for Ag citrate) were subjected to bacterial extract with pH12 to make comparison between two salts.

2.6 Characterisation of AgNPs

Optical characterisation, shape and size dispersity of NPs were investigated by UV–vis spectroscopy and spectrum analysis at 350–600 nm range. The sizes of colloidal NP were further characterised by dynamic light scattering (DLS) performed by Germany Nanophox90‐246V. Transmission electron microscope (TEM) of NPs was done (Philips microscope) to get an insight to morphology and size dispersity. The elements ratios in bacterial extract were determined by energy dispersive X‐ray (EDX) analysis (VEGA3TESCAN). The crystalline structure and type of AgNPs were analysed by X‐ray diffraction (XRD) analysis (Rigaco XRD). Fourier transform infrared (FTIR) accomplished (TENSOR 27 spectrometers) to determine the effective and capping agents in bacterial extract, which are responsible for AgNP synthesis and stability.

2.7 Determination of reducing agents in bacterial extract

2.7.1 Antioxidant capability test

Free radical scavenging capacity of bacterial extract was assayed by 1,1‐diphenyl‐2‐picryl‐hydrazyl (DPPH) method [9]. DPPH is a stable free radical with an unpaired electron, which becomes deep purple when dissolved in methanol or ethanol and has maximum absorbance at ∼517 nm. When DPPH is subjected to a component releases hydrogen, its colour changes to yellow so the absorbance at 517 nm decreases. Different volumes of bacterial extract (25–500 μl in the final volume of 500 μl by methanol) mixed by 1 ml DPPH 0.1 mM and kept on ice in dark for an hour. Then, the absorbance in 517 nm was recorded [DPPH dissolved in methanol (0.1 mM) used as negative control and ascorbic acid by 40 mg/100 ml as positive control]. The antioxidant activity was calculated by the following equation:

$$\mathrm{AO}=\frac{\mathrm{AC}-\mathrm{AS}}{\mathrm{AC}}\times 100$$ (1)

which AO is antioxidant activity per cent of sample; Ac is the absorbance of DPPH (0.1 mM) in 517 nm as negative control and AS for sample absorbance in 517 nm.

2.7.2 NR enzyme assay

NR converts nitrate to nitrite by oxidation of nicotinamide adenine dinucleotide (NADH). The enzyme activity was assayed by Harley method [10]. The reagents used in this method were assay medium: containing 30 mM potassium nitrate and 5% propanol in phosphate buffer (0.1 M, pH 7.5), nitrite reagent medium: including 1% (w/v) sulphanilamide in 25% HCl (V/V) and 0.02% (W/V) N‐(1‐napthy) ethelenediamine dihydrochloride (NEED). The amount of 5 ml bacterial extract and 5 ml assay medium was added to five test tubes. Tubes a and b (duplicate) were placed in boiling water bath immediately after assay medium addition (5 min) to inactivate enzyme and evaluate the primary nitrite in sample (time zero). Three remained tubes (c, d, e triplicate) were kept an hour in dark at room temperature for enzyme activity assay. Test tubes placed in boiling water bath for 5 min and then all five tubes were cooled at room temperature. Sodium nitrite solution with different concentrations (0–250 nM) used for standard curve. The amount of 2.5 ml sulphanilamide and 2.5 ml NEED were added to each test tube (standard and samples) and mixed together completely. The absorption of samples measured at 540 nm after 20 min. The enzyme activity was calculated by the nitrite increase after 60 min for the amount of 10 ml sample (nmol nitrite/h/ml).

2.7.3 Carbohydrate analysis test

To find the amount of carbohydrate (including mono, oligo and poly saccharides) in bacterial extract, phenol–sulphuric acid method was performed [11]. Carbohydrates produce furfural derivatives in the reaction mixture with concentrated sulphuric acid (97%). The furfural can react to phenol and make a component, which has maximum absorption in 490 nm. Glucose solution with 10–70 μg/μl concentration was used for standard curve. The volume of 200 μl phenolic aqueous solution [5% (w/v)] was added to 400 μl bacterial extract. Then, 1 ml sulphuric acid was added immediately to the mixture and kept at room temperature for 10 min. The samples vortexed for 30 s and the absorption in 490 nm was recorded after 20 min.

2.7.4 Protein concentration assay

The concentration of protein in bacterial extract was determined by Bradford assay method [12]. Bradford reagent was prepared by 0.01, 4.7 and 8.5% (W/V) final concentration of Coomassie brilliant blue G‐250, ethanol and phosphoric acid, respectively. This protein reagent was red and its colour changed to blue after combination with protein and has maximum absorption in 595 nm. Bovine serum albumin (BSA) (1 mg ml⁻¹) is used as standard protein. About 100 μl of different concentrations of BSA (0.1–1 mg ml⁻¹) was prepared in test tubes and the amount of 5 ml Bradford reagent added to each concentration followed by pipetting and the mixture absorption was measured in 595 nm after 2 min.

2.7.5 Amino acid determination assay

The amount of aminoacids in bacterial extract was determined by ninhydrin method [13]. Ninhydrin assay medium consists of two parts: A: 5% ninhydrin solution in acetone and B: 1 ml of potassium cyanide (0.01 M in ethanol 60%V/V) diluted to 50 ml by acetone. To prepare ninhydrin–acetone–KCN assay medium, 10 ml of solution A diluted to 50 ml by solution B. The amount of 1–100 μg ml⁻¹ glycine in citrate buffer (0.2 M, pH5) used as stock solution for standard amino acid curve.

About 1 ml of ninhydrin–acetone–KCN assay medium was added to 2 ml of bacterial extract and each glycine concentration then placed in boiling water bath for 20 min. Tubes were cooled at room temperature and diluted to 10 ml by water followed by recording the absorption in 570 nm.

2.8 Unreacted Ag ion determination

The amount of Ag ion remains unreacted and does not change to NP, measured by Mohr method [14] which is used to check the amount of Ag ion in the solution based on titration by sodium chloride. This method is utilised in all pH ranges. The white precipitate of Ag chloride (AgCl) is a proof of remained Ag ion (reaction 1)

$${\mathrm{Ag}}_{(\mathrm{aq})}^{+}+{\mathrm{Cl}}_{(\mathrm{aq})}^{-}\to \mathrm{AgC}{\mathrm{l}}_{(\mathrm{S})}\mathrm{K}=1.8\times {10}^{-10}$$ (1)

To evaluate the Ag ion remained in bacterial extract, saturated sodium chloride (26% w/v) was added to NP colloid drop by drop and the white precipitate of AgCl was assessed.

2.9 Evaluation of AgNP concentration

If all Ag ions convert into NPs, the NP concentration can be calculated by the equation below: [15]

$$C=\frac{N_{\mathrm{T}}}{\mathrm{NV}{\mathrm{N}}_{\mathrm{A}}}$$ (2)

C is the molar concentration of NP; N_T is the number of Ag atoms added as Ag salt (Avogadro's number per mole); V is the volume of reaction; NA is the Avogadro's number and N is the number of atoms in each NP that can be calculated by the equation below:

$$N=\frac{D^3}{6M}{N}_{\mathrm{A}}$$ (3)

N is the number of atoms per NP; π is 3.14; ρ is the density of face‐centred cubic NPs equal to 10.5 g cm⁻³; D is the mean diameter of NPs obtained from TEM analysis in centimetre; M is the atomic mass of Ag equal to 107.868 g; and N _A is Avogadro's number.

2.10 Antimicrobial activity of AgNPs

The antibacterial activity of AgNPs was studied by agar well diffusion method [16]. Four bacterial strains including Staphylococcus aureus ATCC25923, Pseudomonas aeruginosa ATCC 27853, Escherichia coli ATCC 25922 and B. subtilis ATCC 6633, multi‐drug resistant (MDR) strain P. aeruginosa B52 isolated of burn and P. aeruginosa 48 isolated from sputum, adjusted to 0.5 McFarland turbidity were spread on Muller–Hinton (MH) agar medium. AgNPs were added to wells and incubated at 37°C. The inhibition zone was checked after 18–24 h.

2.11 Determination of minimum inhibitory concentration (MIC) of AgNPs

The MIC of AgNPs was determined by microdilution in microtitre plate method [17]. AgNP and bacterial extract were sterilised by filter (0.22 μm). The amount of 100 μl MH broth culture medium was added to each well and 100 μl AgNP added to first well (each experiment repeated for three times), then serially diluted (0.01– 0.00002 μg ml⁻¹). Four bacterial strains including S. aureus ATCC25923, P. aeruginosa ATCC 27853, E. coli ATCC 25922 and B. subtilis ATCC 6633, MDR strain P. aeruginosa B52 isolated of burn and P. aeruginosa 48 isolated from sputum inoculated in each well with ∼5 × 10⁵ CFU/ml and incubated for 18–24 h at 37°C. The absorption of each microplate was recorded in 600 nm by enzyme‐linked immunosorbent assay (ELISA) plate reader.

2.12 Investigation of minimum biofilm inhibitory concentration (MBIC) of AgNPs

The MBIC capacity of AgNPs was determined by microdilution in microtitre plate method [17]. The amount of 100 μl filter sterilised NP was added to first well and serially diluted (0.08– 0.0001 μg ml⁻¹). Each well contained 100 μl tryptic soy broth (TSB) and was enriched by 0.2% glucose. P. aeruginosa 48 and MDR isolate P. aeruginosa B52 inoculated in each well with ∼1–2 × 10⁸ CFU ml⁻¹ and incubated at 37°C for 24 h. The biofilm formation is investigated by TTC biofilm staining method [18] briefly; each well were vacated and washed three times with sterile distilled water. The amount of 170 μl TSB medium with 0.2% glucose (W/V) and 30 μl filter sterilised TTC solution (2% W/V) was added to each well and incubated 5 h at 37°C in dark. Each well content was transferred to new microplate and the absorption of which recorded at 490 nm by ELISA reader.

2.13 Determination of cell viability assay

To determine viable cells after NP treatment 3‐(4,5‐dimethylthiazol‐2‐yl)‐2,5diphenyltetrazolium bromide (MTT) test was accomplished [15]. Reductase enzymes in living cells specially NADH‐dependent ones in mitochondria reduce MTT into insoluble formazan crystals, which are soluble in dimethyl sulphoxide (DMSO) with maximum absorption in 570 nm.

Cancer cell lines MCF‐7, U87MG and transformed cells HEK293 were cultured in Dulbecco's modified eagle's medium enriched by 10% foetal BS and 1% antibiotics (penicillin and streptomycin) at 37°C in the presence of 5% carbon dioxide (CO₂). The number of each cell type was counted by neubauer slide and 2 × 10⁴ cells of each cell line were seeded in 96 well microplate. Culture medium added to each well up to 100 μl final volume. To check NP effect on cell growth, 100 μl diluted NPs by culture medium (0.08–0.0003 μg ml⁻¹) was added to each well and incubated at 37°C in the presence of 5% CO₂. The culture medium in each well was discarded after 24 h. MTT solution (1 mg ml⁻¹) in phosphate‐buffered saline (pH 7.4) was diluted by culture medium to 0.5 mg ml⁻¹ and 200 μl of which was added to each well and incubated for 2–4 h. Formazan crystals were dissolved in 100 μl DMSO and shaked for 20 min. The absorption was recorded in 570 nm by ELISA reader.

3 Results and discussion

3.1 Bacillus spp. screening for AgNP synthesis

The ability of Bacillus spp. to engage in AgNP synthesis was investigated. The rate of solution colour change to yellowish‐brown, its maximum wavelength absorption and the NR activity are important factors for AgNP production in bacterium, and were used to select bacterial isolates for AgNP production (Table 1). The Bacillus isolate 1/11 was distinguished from other isolates and selected as the premier isolate due to its rapid colour changes, maximum extinction peak and NR activity was selected as premier isolate (Fig. 1). Cell free extract was used as a control and no colour changes were observed.

Table 1.

Comparison between bacteria in important factors, affected AgNP production

Bacteria	NR enzyme production	OD435 (10 × a)	Shoulder in peak	NP production in 24 h	NP aggregation after 10 days
B. Subtilis	++	0.34	+	++	−
H. Karajensis	−	0.104	+	−	−
BY	−	0.303	+	+	+
4M1	−	0.603	+	+	+
2Q	++	0.87	+	+	+
1/5	++	0.59	+	+	+
1/6	+	1.96	+	++	+
1/10	+	0.932	+	++	−
1/11	+++	2.225	+	+++	++
2/2	+	0.31	+	+	++
2/8	++	0.31	+	+	−
2/9	­+	0.3	+	+	+

^a NP is diluted ten times and the UV–vis spectrum was analysed.

Fig. 1.

UV–vis spectrum comparison of bacterial isolates. Bacillus 1/11 isolate had maximum absorption in 440 nm in comparison with other isolates and selected as premier isolate for AgNP synthesis

3.2 Molecular identification of premier isolate

The premier Bacillus 1/11 isolate was sequenced by 16S rDNA amplification and aligned through BLASTn, which showed 99% resemblance to Bacillus thuringiensis. The phylogenetic tree was drawn by a neighbour‐joining algorithm. The GenBank accession number for the bacteria is KY404230 (Fig. 2).

Fig. 2.

Phylogenetic tree of premier Bacillus 1/11 isolate performed by neighbour‐joining algorithm (mega7)

3.3 Optimisation of AgNP synthesis

Bacterial AgNP synthesis is a time‐consuming process. Conditions such as pH, temperature and concentration of AgNO₃ affect the size and shape of NPs. Since the rate and amount of NP synthesis of the premier bacterial isolate were suitable, the considered conditions were optimised for AgNP synthesis. The AgNP synthesis by a premier isolate was investigated under different conditions. Yellowish‐brown colour changes and NP production were observed at pH 12 at all AgNO₃ concentrations. There were neither colour changes nor NP production at lower pH values.

The yellowish‐brown colour changes show AgNP synthesis with a maximum absorption of 380–450 nm, which is due to surface plasmon resonance (SPR). This phenomenon is related to energy equivalence between conductor electrons in the last layer of metal and energy of electromagnetic waves irradiated to NPs. The SPR peak in AgNP depends on its size, shape and environment. According to Mie theory, spherical NPs have one SPR peak while asymmetric particles and different shapes have one or more shoulders in their SPR peak [19].

As shown in Fig. 3 a, the amount of AgNP synthesis increases with increasing in pH and salt concentration. The UV–vis spectra in Fig. 3 show that there is rapid NP synthesis at 3, 4 and 5 mM AgNO₃ concentration. The final concentrations of 3 mM AgNO₃ and pH 12 were selected as the best conditions for AgNP synthesis with the premier isolate. The wide peak shows polydisperse NPs in size. There is a shoulder in the SPR peak demonstrating AgNP with different shapes and sizes [20].

Fig. 3.

Optimisation of AgNP synthesis

(a) UV–vis spectra of AgNP production by premier Bacillus 1/11 isolate in different (1, 2, 3, 4, 5 mM) final AgNO₃ concentrations and pH12 (10 × diluted),

(b) DLS analysis of AgNP at pH12 and 3 mM

3.4 Dynamic LS

AgNP synthesised in pH12 and 3 mM AgNO₃ was analysed by DLS method. The width of the histogram of DLS depends on the size dispersity of NPs. The more monodisperse NPs there are, the narrower peak is in the DLS spectrum. A polydispersity index (PDI) >0.7, <0.1 or between these two values indicate respective polydisperse, monodisperse and moderate dispersity for NPs. The surface medium diameter (SMD) and volume medium diameter (VMD) ratio shows the spherical shape of NP. The DLS histogram in Fig. 3 b shows a 0.14 PDI and 0.97 SMD/VMD, so the chosen AgNP is 150 nm, spherical and moderately dispersed in size.

3.5 Ag salt effects on NP size produced by the premier Bacillus 1/11 isolate

Different Ag salts such as AgNO₃ and Ag citrate affect the particle size produced by the Bacillus isolate. Citrate is a negatively charged ion which creates electrical and steric hindrance around NPs and prevents NP aggregation; therefore, makes stable NPs with smaller sizes [20]. The yellowish‐brown colour appearance was observed in all Ag citrate concentrations (Fig. 4 b). There was no NP synthesis in the controls (Ag citrate and water, bacterial extract and water). The rate of NP production and maximum extinction peak increased with increases in Ag citrate concentration (Fig. 4 a). There was a shoulder in the maximum peak absorption of NPs that increased with the Ag citrate concentration, which showed NPs with different sizes or shapes.

Fig. 4.

Ag salt effects on NP size produced by the premier Bacillus 1/11 isolate

(a) UV–vis spectrum comparison between NPs synthetised by different Ag citrate concentrations,

(b) Visual colour changes of AgNPs in different concentrations of Ag citrate

The effects of two different Ag salts on the size of NP were investigated by DLS analysis. The results are shown in Table 2.

Table 2.

Effect of Ag salts on NP size

Ag salt type	Ag salt concentration	Hydrodynamic radius
AgNO3	1	208
	2	149
	3	160
Ag citrate	0.5	131
	1	121
	1.5	85
	2	128

Various concentrations of AgNO₃ affect the NP size, but generally, Ag citrate acts as a capping agent and reduces the NP size in comparison with nitrate.

It could be concluded that the size of NP is a multifactor parameter; therefore, increasing or decreasing the Ag salt concentrations cannot exclusively affect the NP size in a regulated manner.

DLS analysis delineates that AgNPs with 1.5 mM Ag citrate concentration are spherical, moderately dispersed and 85 nm in size. This condition (1.5 mM Ag citrate final concentration and pH12) was chosen as the optimum condition for AgNP synthesis below 100 nm by the premier isolate (Fig. 5).

Fig. 5.

Visual observation, UV–vis spectrum and DLS analysis of AgNP synthetised by premier bacillus 1/11 isolate

3.6 Characterisation of AgNPs

3.6.1 Transmission EM

TEM images of NPs (Fig. 6) showed the spherical shape of NPs, which confirmed the results obtained from DLS analysis. The SMD/VMD ratio in DLS was ∼1 and indicated a spherical shape for the NPs. The particle size in TEM analysis is ∼35–40 nm (Fig. 6). DLS method measures hydrodynamic size of NP (NPs by surrounding water and other molecules), whereas TEM images show the actual radius of NP without surrounding [21]. So obtained size of NPs by TEM analysis is lower than DLS method.

Fig. 6.

TEM images of AgNP indicating spherical form of them. Size distribution histogram of NPs indicates 35–40 nm as dominant size

3.6.2 Energy DX

To evaluate the elements in the AgNP, EDX analysis was conducted. As shown in Fig. 7 a, there was Ag and chloride in sample indicating the existence of AgCl NP. The sodium element was related to a high pH for the sample. Carbon, nitrogen, oxygen and sulphur elements confirm the presence of carbohydrates, proteins and sulphur‐containing amino acids in the sample.

Fig. 7.

AgNp analysis by

(a) EDX,

(b) XRD and

(c) FTIR (extract is blue and NP is red)

3.6.3 X‐ray diffraction

The XRD analysis in Fig. 7 b determined the crystalline nature of the structure and type of AgNP. In this case, high peaks of 2θ in values of 27.9°, 32.3°, 46.3°, 55.0°, 57.6°, 67.6°, 74.6° and 76.9° refer to (1 1 1), (2 0 0), (2 2 0), (3 1 1), (2 2 2), (4 0 0), (3 3 1) and (4 2 0) planes, showing the AgCl NPs that were compared with standard AgCl NP peaks [6].

3.6.4 Fourier TIR

To investigate the probable mechanism in NP synthesis and factors influencing the stabilisation and capping the produced NPs in a colloidal state, FTIR analysis was performed. As shown in Fig. 7 c, distinct peaks at 3446 and 1648 cm⁻¹ revealed acidic O–H functional groups, a 1542 cm⁻¹ peak was related to amine type I and peaks at 1041 cm⁻¹ were related to methyl groups in protein. IR peaks at 1682 and 1742 cm⁻¹ were related to aldehyde functional groups and a 2923 cm⁻¹ peak demonstrated a carboxylic functional group in a bacterial extract. In comparison with the IR peak of NPs, minor changes in the absorption of these peaks (including 3446–3420, 1648–1650, 1542–1572, 1041–1023, 2923–2927 and 1682–1677 cm⁻¹) represent slight changes in binding groups around them. As a result, proteins and carbohydrates were found to be the major biomolecules in extracts responsible for NP synthesis and stabilisation.

3.7 Identification of reducing agents in bacterial extract

The concentration of reducing agents in bacterial extract is given in Table 3. Reductase enzymes, especially NADH‐dependent enzymes such as NR make electron shuttles and may transfer electrons to Ag ions. There have been reports of AgNP synthesis by bacteria in the presence of reducing agents as represented by NR and amino acids for AgNP synthesis by B. subtilis [10]. Peptides containing arginine, cysteine, glutamic acid, aspartic acid, lysine and methionine can reduce Ag ions to NPs [22]. Monosaccharaides are in linear forms at high pH values; the aldehyde functional group undergoes oxidation through Ag ion reduction and makes AgNP [23]. Various reducing agents and antioxidant activities in the bacterial extract may provide an appropriate condition for Ag ion reduction and AgNP synthesis.

Table 3.

Reducing agents in bacterial extract

Reducing agents in bacterial extract (pH12)	Concentration, mg ml−1
radical scavenging capacity	10%
protein	0.023 mg ml−1
nitrite production by NR	1.65 nM
amino acid	970 mg ml−1
carbohydrate	1293.3 mg ml−1

According to XRD analysis, the condition is suitable for AgCl NP synthesis. However, a small amount of Ag ions reduce to AgNPs. The exact mechanism of AgCl NP synthesis is still unclear. Carboxylic functional groups from amino acids are deprotonated and negatively charged at high pH values, so it can react by Ag cation and prevent its reduction by reducing groups. In the presence of chloride and suitable conditions for AgCl formation in colloid form, the chloride binds to Ag ion and makes AgCl NPs [24]. Furthermore, monosaccharaides with linear form at pH12 turn to carboxylic form by reducing Ag ions (to make a low amount of AgNPs) and then provide a surface for Ag ion attachment and AgCl NP synthesis.

3.8 Evaluation of AgNP concentration

To study the inhibitory effect of NPs on bacterial biofilm and cancer cells, it is necessary to evaluate AgNP concentration. So it was calculated by (2) and (3) formulas

$$N=\frac{\times 10.5{\left(40\times {10}^{-7}\right)}^3}{6\times 107.868}\times 6.023\times {10}^{23}=1.964\times {10}^6$$

The amount of atoms in each NP is determined as 1.964 × 10⁶ by above calculation

$$C=\frac{1.5\times {10}^{-3}\times 3\times 6.023\times {10}^{23}}{1.964\times {10}^6\times 1\times {10}^{-3}\times 6.023\times {10}^{23}}=2.3\times {10}^{-6}\mathrm{M}$$

The molar concentration of NP is 2.3 × 10⁻⁶ molar.

3.9 Antimicrobial activity of AgCl NPs

The antimicrobial activity of AgNP is related to biological effect of AgNP such as activating reactive oxygen species (ROS) production and releasing Ag ions from these NP [25]. Consequently, if all precursor Ag ions used for NP synthesis do not turn to NPs completely, it makes disorders in exclusive antimicrobial investigation of NPs. Hence, the titration of Ag ions performed to evaluate the amount of Ag ion remained unreacted. Therefore, the Ag ions turned to AgNP and the antimicrobial effects of AgNP are not dependent on remaining Ag ions. The antibiogram of NPs on each strain of bacteria and their zones of inhibition are shown in Table 4.

Table 4.

Zone of inhibition and MIC of AgNPs against bacterial strains

Bacteria	NP MIC, μg ml−1	Zone of inhibition, mm
P. aeruginosa ATCC 27853	0.01	16
E. coli ATCC 25922	0.005	15
P. aeruginosa B 52	0.005	11
S. aureus ATCC 25923	0.0025	16
B. subtilis ATCC 6633	0.0025	15
P. aeruginosa 48	0.001	16

According to the results, it was found that AgCl NPs had an inhibitory effect on growth of bacterial strains, especially the MDR P. aeruginosa B52 isolated from burn ulcers.

3.10 Determination of MIC of AgCl NPs

The MIC for NPs on each bacterium is shown in Table 4. P. aeruginosa ATCC 27853 is the most resistant and P. aeruginosa 48 had the least resistance against NPs.

3.11 Investigation of MBIC of AgCl NPs

The minimum concentration of AgCl NPs that inhibits biofilm formation against isolated Pseudomonas strains was investigated. The results showed that citrate/bacterial extract can inhibit biofilm formation in high concentrations and AgCl NPs inhibit the biofilm formation in P. aeruginosa 48 and MDR isolate P. aeruginosa B52 by 0.01 and 0.02 μg ml⁻¹ final concentration, respectively.

Biofilms are one of the most important problems associated with chronic diseases, which originated from catheters and other implanted devices in the body. One of the approaches that already exist for treatment is the physical removal of biofilm or the catheter, which are both expensive and painful for patients [25]. There have only been a few investigations about NP inhibition of bacterial biofilm formation. These studies include findings of an inhibitory effect of AgNP produced by B. licheniformis (with 260 nM) against biofilm formation of Staphylococcus epidermidis and P. aeruginosa and the 98% inhibition of biofilm formation on clinical isolated strains that have been reported [26]. The produced AgCl NP impeded the biofilm formation of MDR P. aeruginosa B52 isolated from burn ulcer. NPs prevent bacterial growth on the surfaces for a long period of time. Furthermore, Ag ions released from NPs deactivate critical enzymes and proteins for biofilm formation by binding to them so as to prevent bacterial biofilm formation [27].

3.12 Determination of cell viability assay of AgCl NPs

Cytotoxic activity of AgCl NPs was determined by MTT assays (Fig. 8). NP application in cancer cell treatment is a cost‐effective and compatible method in comparison with current chemotropic methods, which are toxic and have side effects [28]. The toxicity of NPs increases with decreasing NP size [15]. Bacterial NPs have cytotoxic effects on cervical cancer cells, MDA‐MB‐231 breast cancer and NIH‐3T3 D4 cancer cell lines also can create morphological changes in them [22].

Fig. 8.

Cytotoxic effects of AgCl NPs, (a1,2) AgNP and citrate/bacterial extract on MCF‐7, (b1,2) on U87MG and (c1,2) on T293 cancer cell lines (culture medium used for cell growth control)

The results showed that AgCl NPs have cytotoxic effects on three cell line types that increase with increased NP concentration. Also, the U87MG and T293 cell lines were more sensitive to AgCl NP than MCF‐7. Citrate/bacterial extract used as control have mortality on cancer and transformed cell lines in high concentrations. P ‐values (Table 5) below 0.05 demonstrate that there are significant differences between NPs and citrate/extract at up to 1/16 diluted concentration and NP cytotoxicity on all three cell lines is independent of citrate/extract.

Table 5.

P ‐value calculation between NP and citrate/extract

P ‐valuea	Concentration
	1/4	1/8	1/16	1/32	1/64	1/128	1/256	1/512	1/1024
MCF‐7	0.002	2.8 × 10−5	0.02	0.11	0.11	0.33	0.14	0.073	0.27
U87MG	8.55 × 10−5	0.00013	0.012	0.14	0.3	0.38	0.012	0.18	0.16
T293	1.26 × 10−5	2.54 × 10−5	4.18 × 10−5	0.08	0.08	0.35	0.44	0.47	0.43

^a P ‐value lower than 0.05 (≤0.05) is significant.

ROS production and oxidative stress are two probable mechanisms of cytotoxic effects of NP on eukaryotic cells. AgNP can interact with glutathione reductase enzyme, which binds to GSH and inhibits the activation of the antioxidant defence system and decrease GSH/GSSG ratio, resulting in the accumulation of ROS in the cells [2]. NPs lead to decreases in membrane permeability, reducing cell size, cell density and the increased activity of lactate dehydrogenase enzyme, caspase‐3 so it can induce apoptosis in cancer cells.

4 Conclusion

Bacterial AgNP synthesis is a time and energy consuming process [16]. In the present paper, for the first time, bacterial extracts were prepared in water without culture medium and without extra energy consumption. The AgCl NP was produced at the first moment of reaction. Environmental conditions such as pH and Ag salt concentration influenced the rate of NP synthesis by bacteria. NP synthesis was more rapid in alkaline condition and higher Ag salt concentration. The FTIR analysis showed the presence of proteins and carbohydrates contained carboxylic and O–H groups that are important factors for AgCl NP synthesis. Changing the Ag salt precursor can affect the particle size and inhibit agglomeration of NPs. The AgCl NPs that were produced had biological effects against some bacterial pathogens and cancer cell types.