Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2022 Dec 1.
Published in final edited form as: Genes Cells. 2021 Oct 28;26(12):1014–1022. doi: 10.1111/gtc.12902

Generating a New Mouse Model for Nuclear PTEN Deficiency by a Single K13R Mutation

Takashi Kato 1,2, Atsushi Igarashi 1, Hiromi Sesaki 1,3, Miho Iijima 1,3
PMCID: PMC8678295  NIHMSID: NIHMS1749046  PMID: 34661323

Abstract

Many human diseases, including cancer and neurological abnormalities, are linked to deficiencies of PTEN, a dual phosphatase that dephosphorylates both lipids and proteins. PTEN functions in multiple intracellular locations, including the plasma membrane and nucleus. Therefore, a critical challenge to understand the pathogenesis of PTEN-associated diseases is to determine the specific role of PTEN at different locations. Toward this goal, the current study generated a mouse line in which lysine 13, which is critical for the nuclear localization of PTEN, is changed to arginine in the lipid-binding domain using the CRISPR-Ca9 gene-editing system. We found that PTENK13R mice show a strong decrease in the localization of PTEN in the nucleus without affecting the protein stability, phosphatase activity, and phosphorylation in the C-terminal tail region. PTENK13R mice are viable but produce smaller neurons and develop microcephaly. These data demonstrate that PTENK13R mice provide a useful animal model to study the role of PTEN in the nucleus in vivo.

Keywords: PTEN, Nuclear PTEN, Brain, Neuron, Mouse

(2) 2–3 sentence abbreviated abstract summarizing your article:

The current study generated a new mouse line that shows a strong decrease in the localization of PTEN in the nucleus without affecting the protein stability, phosphatase activity, and phosphorylation in the C-terminal tail region. The nuclear PTEN-deficient mice produce smaller neurons and develop microcephaly. Therefore, this mouse line provides a useful animal model to study the role of PTEN in the nucleus in vivo.

Introduction

A tumor suppressor, PTEN (phosphatase and tensin homolog deleted on chromosome ten), is often deleted or mutated in various human cancers (Li et al. 1997; Bonneau & Longy 2000; Baker 2007; Gil et al. 2007; Planchon et al. 2008; Salmena et al. 2008; Hopkins & Parsons 2014; Kreis et al. 2014; Leslie et al. 2016). The PTEN protein comprises four domains, including the phosphatidylinositol-4,5-bisphosphate (PIP2)-binding domain, the lipid/protein phosphatase domain, the C2 domain, and the C-terminal tail domain (Tamguney & Stokoe 2007; Song et al. 2012; Gericke et al. 2013). The phosphatase activity converts phosphatidylinositol-3,4,5-triphosphate (PIP3) into PIP2 and negatively controls intracellular signaling mediated by phosphatidylinositol-3’ kinase (PI3K) and AKT at the plasma membrane (Stambolic et al. 1998; Maehama et al. 2001; Luo et al. 2003). In addition to the plasma membrane, PTEN is located in other intracellular locations, including the nucleus, where PTEN regulates DNA repair, genome maintenance, and cell cycle progression (Chung et al. 2006; Baker 2007; Gil et al. 2007; Shen et al. 2007; Planchon et al. 2008; Song et al. 2011; Bassi et al. 2013; Kreis et al. 2014; Leslie et al. 2016).

The intracellular distribution of PTEN is regulated by post-translational modifications, including phosphorylation and ubiquitination (Kreis et al. 2014; Leslie et al. 2016). The C-terminal tail region of PTEN is subjected to phosphorylation. Phosphorylated serine and threonine residues (serine 380, threonine 382, threonine 383, and serine 385) in this region regulate the conformation of PTEN and the surface exposure of the membrane-binding region (Nguyen et al. 2014b; Nguyen et al. 2015b; Nguyen et al. 2015a). Substitution of these four serine and threonine residues with alanine (PTENA4) induces the accumulation of PTENA4 in the nucleus (Nguyen et al. 2015a). On the other hand, the substitution of lysine 13, which undergoes ubiquitination, with arginine dramatically decreases PTEN’s nuclear localization in cultured cells (Nguyen et al. 2015b; Kato et al. 2020). Combining the A4 and K13R mutations promotes a strong association of PTENK13R,A4 with the plasma membrane (Nguyen et al. 2015b).

To understand the physiological and pathophysiological role of nuclear PTEN in vivo, we have previously generated nuclear PTEN-deficient mice that carry mutations in the ubiquitination site (K13R) and the cluster of phosphorylation sites (D384V) (Igarashi et al. 2018; Kato et al. 2020; Igarashi et al. 2021; Kato et al. 2021). This nuclear PTEN-deficient mouse model decreased neuron size and induced microcephaly (Igarashi et al. 2018; Igarashi et al. 2021). In addition, PTENK13R,D384V mice have increased DNA damage and accelerate the formation of hepatocellular carcinoma when exposed to a carcinogen and hepatotoxin (Kato et al. 2020; Kato et al. 2021). However, PTENK13R,D384V mice carry the two mutations (K13R and D384V), and therefore it was unclear whether these phenotypes are derived from the K13R mutation or the D384V mutation.

To address this key question, in the current study, we introduced the single K13R mutation in the PTEN gene in mice using the CRISPR-Cas9 gene-editing system and generated PTENK13R mice. We found that the K13 mutation effectively blocks nuclear localization of PTEN in hepatocytes and cerebellar Purkinje neurons in vivo. PTENK13R mice decreased neuron size and developed microcephaly. These data show that PTENK13R mice are useful for studying nuclear PTEN functions in vivo.

Results

PTENK13R and PTENK13R,D384V are defective in nuclear localization in cultured cells

To compare the effects of various mutations on PTEN’s nuclear localization, we expressed GFP-tagged PTEN mutants in HCT116 cells and observed them using live-cell imaging with laser confocal microscopy (Fig. 1A). We have previously reported that PTEN-GFP is functional and displays intracellular localization equivalent to endogenous PTEN (Nguyen et al. 2014a; Nguyen et al. 2015a; Yang et al. 2015; Yang et al. 2017; Kato et al. 2020). The nuclear localization was quantified by determining the relative intensity of PTEN-GFP signals in the nucleus over that in the cytosol (Fig. 1B), as we reported (Kato et al. 2020). We found that wildtype PTEN is localized in both the cytosol and nucleus, consistent with previous observations. In contrast, PTENK13R was greatly absent in the nucleus (Fig. 1A and B). PTENA4 was mainly found in the nucleus while PTENK13R,A4 was located at the plasma membrane as reported (Yang et al. 2017) (Fig. 1A-C). PTEND384V exhibited a relatively small increase in the nucleus (Fig. 1A and B). PTENK13R,D384V was greatly absent in the nucleus and mainly found in the cytosol (Fig. 1A and B). Importantly, when we compared PTENK13R and PTENK13R,D384V, these PTEN mutants showed similar deficiencies in the nuclear localization (Fig. 1A and B). The phosphatase-dead mutant PTENR130G and GFP control localized in cytosol and nucleus (Fig. 1A and B). These data suggest that PTENK13R is effectively excluded from the nucleus.

Figure 1. Intracellular localization of PTEN-GFP mutants in HCT116 cells.

Figure 1.

Open in a new tab

(A) HCT116 cells were transfected with the indicated PTEN-GFP proteins and observed by live-cell imaging. (B) The signal intensity of PTEN in the nucleus was quantified relative to the cytosol in HCT116 cells. Values represent the mean ± SD (n =24–51). (C) Phosphatase activity of PTEN mutants purified from HEK293T cells was measured by the amount of phosphate released from PIP3 diC8 per minute using the malachite green assay. The bar represents the mean ± SD (n = 6). Statistical analyses were performed using ANOVA with post hoc Tukey test in (B and C).

PTENK13R has normal lipid phosphatase activity

Next, we measured the lipid phosphatase activity of PTEN. Wildtype and mutant PTEN-GFP proteins were immunopurified using GFP-Trap from HEK293T cells. The lipid phosphatase activity of purified PTEN was measured using a malachite green assay which detects phosphate released from a soluble analog of PIP3 (Nguyen et al. 2014a). We found that the phosphatase activity of PTENK13R is comparable to that of wildtype PTEN (Fig. 1C). In contrast, PTENA4 and PTENK13R,A4 increased activities (Fig. 1C). Importantly, the phosphatase activity also increased in PTEND384V and PTENK13R,D384V (Fig. 1C), likely due to their open conformation (Nguyen et al. 2015b). As a negative control, the phosphatase activity was not detected in enzymatically inactive PTENR130G (Fig. 1C). Thus, the K13R mutation does not affect the lipid phosphatase activity of PTEN.

PTENK13R mutant mice show microcephaly

We introduced the K13R single mutation into the PTEN gene in mice using the CRISPR-Cas9 genome editing system (Fig. 2A). Homozygous PTENK13R mice were born according to the Mendelian ratio and grew to normal body weight (Fig. 2B). The liver weight of PTENK13R mice, like PTENK13R,D384V mice (Igarashi et al. 2018; Igarashi et al. 2021), was comparable to that of wildtype mice (Fig. 2C). However, the brain weight was significantly decreased in PTENK13R mice, similar to PTENK13R,D384V mice (Fig. 2D).

Figure 2. PTENK13R mice show microcephaly and decrease neuron size.

Figure 2.

Open in a new tab

(A) PTENK13R mice were generated by changing lysine 13 to arginine in the PIP2-binding domain (PBD) using the CRISPR-Cas9 gene-editing system. (B-D) Body (B), liver (C), and brain (D) weights of PTENK13R and PTENK13R,D384V mice. Bars represent the mean ± SD (n = 3–6). (E) Sagittal frozen sections of the cerebellum cut in the midline were analyzed by immunofluorescence microscopy with antibodies to PTEN (green) and Car8 (red) in wildtype, PTENK13R, and PTENK13R,D384V mice at 6 weeks of age. Nuclear DNA is stained with DAPI (blue). (F and G) The fluorescent intensity of PTEN (F) and Car8 (G) in the nucleus relative to the cytosol was determined. Values are the mean ± SD (n = 199–241). (H) The area of Purkinje cell soma was quantified using Car8 staining. Values are the mean ± SD (n = 274–320). (I) The density of Purkinje cell soma is shown. Values are the mean ± SD (n = 3 mice). (J) Western blotting of cerebella dissected from wildtype, PTENK13R, and PTENK13R,D384V mice using antibodies to PTEN, phospho-PTEN, and GAPDH. (K) Band intensity of PTEN was quantified relative to GAPDH. (L) Band intensity of phospho-PTEN was determined relative to PTEN. Bars represent the mean ± SD (n = 3). Statistical analyses were performed using ANOVA with post hoc Tukey tests (B, C, D, F, G, H, I, K, and L).

PTENK13R mice decrease PTEN’s nuclear localization and soma size in Purkinje cells of the cerebellum

To determine the impact of the K13R mutation on PTEN’s nuclear localization in the brain, we examined the localization of PTEN in Purkinje cells of the cerebellum in PTENK13R mice. Wildtype and PTENK13R mice were fixed using the cardiac perfusion of paraformaldehyde. Frozen brain sections were subjected to immunofluorescence using antibodies to PTEN and a Purkinje cell marker, Car8, and observed by laser confocal microscopy. We found that the nuclear localization of PTEN was greatly decreased in PTENK13R Purkinje cells, albeit slightly less decreased compared to PTENK13R,D384V Purkinje cells (Fig. 2E and F). As a control, there were no differences in the localization of Car8 in PTENK13R and PTENK13R,D384V Purkinje cells (Fig. 2E and G). Western blotting showed the expression level of PTEN K13R and PTENK13R,D384V is comparable to that of wildtype PTEN (Fig. 2J and K). PTEN K13R was normally phosphorylated at the C-terminal region (Fig. 2J and L). Conversely, PTENK13R,D384V was decreased in the phosphorylation as we previously reported (Fig. 2J and L) (Igarashi et al. 2018).

To understand the underlying mechanism for microcephaly, we tested how PTENK13R affects the size of neurons. We measured the size of soma in Purkinje cells using immunofluorescence microscopy of Car8. We found decreases in the soma size in PTENK13R mice (Fig. 2H), similar to PTENK13R,D384V mice (Igarashi et al. 2018; Igarashi et al. 2021). Consistent with decreased soma size, the density of the soma was increased along the Purkinje cell layer of PTEN K13R mice (Fig. 2I), like PTENK13R,D384V mice (Igarashi et al. 2018; Igarashi et al. 2021). These data suggest that decreased neuron size likely contributes to microcephaly in PTENK13R mice.

PTENK13R mice show decreased nuclear localization of PTEN in the liver

We also tested whether the K13R mutation affects PTEN’s nuclear localization in other tissues. We examined the localization of PTEN in the liver of PTENK13R mice. Frozen liver sections were subjected to immunofluorescence using anti-PTEN antibodies followed by laser confocal microscopy. The nuclear localization of PTEN was greatly decreased in PTENK13R livers, similar to PTENK13R,D384V livers (Fig. 3A and B). Western blotting showed the expression level of PTENK13R is comparable to that of wildtype PTEN (Fig. 3C). This is in sharp contrast to PTENK13R,D384V, which showed a decrease in its expression level (Fig. 3C). Furthermore, PTENK13R was normally phosphorylated at the C-terminal tail (Fig. 3D). Conversely, PTENK13R,D384V was defective in the phosphorylation (Fig. 3E). Thus, unlike the K13R, D384V double mutations, the single K13R mutation more specifically decreased PTEN’s nuclear localization without affecting the protein expression level and the C-tail phosphorylation in livers.

Figure 3. PTENK13R mice exhibit normal PTEN level and C-terminal phosphorylation in livers.

Figure 3.

Open in a new tab

(A) Liver sections were analyzed by immunofluorescence microscopy using anti-PTEN antibodies in wildtype, PTENK13R, and PTENK13R,D384V mice. (B) The signal intensity of PTEN in the nucleus was quantified relative to the cytosol in livers. Values represents the mean ± SD (n = 176–250). (C) Western blotting of livers using antibodies to PTEN, phospho-PTEN, and GAPDH. (D) Band intensity of PTEN was quantified relative to GAPDH. (E) Band intensity of phospho-PTEN was determined relative to PTEN. Bars represent the mean ± SD (n = 3). Statistical analyses were performed using ANOVA with post hoc Tukey test in (B, D and E).

Discussion

A cluster of phosphorylation at C-terminal residues between 380 and 385 (Ser380, Thr382, Thr383, and Ser385) is known to regulate PTEN’s stability and activity through modifying the protein conformation (Nguyen et al. 2015b). D384 is located in this cluster and provides a negative charge similar to negatively charged phosphorylated serine and threonine. The effect of individual phosphorylations is additive, and the impact of phospho-defective mutations is the strongest when all four phosphorylation sites are substituted by alanine in PTENA4 (Nguyen et al. 2014a). Our data suggest that the D384V mutation reduces the phosphorylation at the C-terminus of PTEN in vivo. The reduction of the phosphorylation likely contributes to decreased PTEN protein level through compromised protein stability since an open conformation of PTEN makes it more susceptible to proteasomal degradation (Sun et al. 2014; Fragoso & Barata 2015). These characteristics of PTENK13R,D384V precluded unambiguously determining the physiological role of nuclear PTEN. Importantly, the solo K13R mutation does not affect its stability or phosphatase activity. We found that PTENK13R mice show essentially identical phenotypes as PTENK13R,D384V mice, with decreased neuron size and microcephaly. Therefore, this new mouse model provides an essential animal model to study the specific function of nuclear PTEN in vivo in mammals.

Previous studies have shown that a decreased level of PTEN in the brain increases brain size, leading to macrocephaly because of hyperactivation of PI3K signaling (Backman et al. 2001; Kwon et al. 2001; Marino et al. 2002; Groszer et al. 2006; Kwon et al. 2006; Endersby & Baker 2008; Knobbe et al. 2008; Cupolillo et al. 2016). In contrast, PTENK13R mice and PTENK13R,D384V mice have smaller neurons and brains. These data indicate that nuclear PTEN is required for the regulation of neuronal and brain size. Since PTENK13R mice and PTENK13R,D384V mice phenocopy each other, these brain phenotypes most likely result from nuclear PTEN-deficiency rather than decreases in PTEN level or phosphorylation. In the current study, we focused on Purkinje cells in the cerebellum. It would be important to examine other neurons in PTENK13R mice to test whether the effect of nuclear PTEN loss is unique to a specific group of neurons or globally impact most types of neurons in future studies.

In summary, PTENK13R mice are more specifically deficient in PTEN’s nuclear localization than the previous model, PTENK13R,D384V mice (Igarashi et al. 2018; Kato et al. 2020; Igarashi et al. 2021; Kato et al. 2021). Unlike PTENK13R,D384V mice, PTENK13R mice are wildtype regarding protein level, lipid phosphatase activity, and C-terminal phosphorylation. Therefore, PTENK13R mice provide a useful new model to study PTEN’s nuclear functions in vivo. We have previously reported that PTENK13R,D384V mice are susceptible to stress-induced hepatocarcinoma (Kato et al. 2020; Kato et al. 2021). It would be critical to test tumorigenesis using the new PTENK13R model to understand the function of nuclear localization of PTEN separating from its protein stability and phosphorylation.

Experimental Procedures

Mice

All of the work with animals was conducted according to the guidelines established by the Johns Hopkins University Committee on Animal Care and Use. To create PTENK13R mice, sgRNA (5′-AGATCGTTAGCAGAAACAAAAGG-3′) and homology-directed repair oligos (5′-ACAGGCTCCCAGACATGACAGCCATCATCAAAGAGATCGTTAGCAGAAACAGAAGGAGATATCAAGAGGATGGATTCGACTTAGACTTGACCTGTATCCA-3′) were purchased from Integrated DNA Technologies. Pronuclear injections of zygotes from B6SJLF1/J mice (Jackson Laboratory, stock# 100012) were performed at the Johns Hopkins University Transgenic Facility using a mix of sgRNA and homology-directed repair oligo in injection buffer (10 mM Tris-HCl, 0.1 mM EDTA filtered with 0.2-µm pore size). The embryos were cultured at 37°C in the CO2 incubator for 2 h and then transferred into the oviducts of pseudopregnant ICR females (25 embryos per mouse) (Envigo). Forty-two pups were obtained, and their genotypes were analyzed by DNA sequencing using the following primers: 5′-GCCAAGTCCAGAGCCATTTC-3′ and 5′-CGATCTAGAAATGCGCCCAG-3′. We identified 16 mice that carried the K13R mutation. These lines were backcrossed to C57BL/6J wildtype mice (Jackson Laboratory, stock# 000664) at least two generations before use. PTENK13R,D384V mice have been generated previously (Igarashi et al. 2018; Kato et al. 2020; Igarashi et al. 2021; Kato et al. 2021).

Cell culture

HEK293T cells were cultured in the DMEM medium (Sigma-Aldrich, D5796) containing 10% FBS (Sigma-Aldrich, F4135). HCT116 cells were maintained in the RPMI1640 medium (Gibco, 11875–093) containing 10% FBS and 1% penicillin/streptomycin (Gibco, 15140–122).

Live-cell imaging

Cells were seeded in 8-well chambered and were transfected with PTEN-GFP constructs using lipofectamine300 (Invitrogen, L3000015) as described in the manufacturer’s instruction. After overnight culture, the GFP signals were observed on LSM800 GaAsP laser scanning confocal microscope (Zeiss) (Yang et al. 2015).

Phosphatase activity

Wildtype and mutant variants of PTEN-GFP were expressed in HEK293T cells and immunopurified using GFP-Trap beads (ChromoTek) as described previously (Nguyen et al. 2015b; Yang et al. 2017). Enzymatic activity was determined by measuring the phosphate release rate from PIP3 diC8 using a malachite green phosphatase assay kit (Echelon) (Nguyen et al. 2015b; Yang et al. 2017). The activity was normalized relative to amounts of purified PTEN-GFP proteins.

Immunofluorescence microscopy

Mice were anesthetized by intraperitoneal injection of Avertin (200 mg/kg) and fixed by cardiac perfusion of ice-cold 4% paraformaldehyde in PBS, as previously described (Kageyama et al. 2014; Yamada et al. 2016). Tissues were dissected and further fixed in 4% paraformaldehyde in PBS for 2 h at 4°C. The samples were further incubated in PBS containing 30% sucrose overnight and frozen in OCT compound (Sakura Finetek) in a Tissue-Tek Cryomold. Frozen tissue blocks were sagittally sectioned using a cryostat (Leica, CM 3050S) and mounted on Superfrost Plus Microscope Slides (Fisher Scientific, 12–550-15). Sections were incubated with antibodies to Car8 (Frontier Institute, Car8-Go-Af780–1) and PTEN (Cell Signaling Technology, 9559) at 4°C overnight. After washing with PBS, the samples were incubated with fluorescently labeled secondary antibodies at room temperature for 1 h (Kageyama et al. 2014; Yamada et al. 2016). DAPI was used at 1 µg/ml. Samples were viewed by Zeiss LSM800 confocal scanning microscope equipped with 40× or 63× objectives. Quantification of the fluorescent signals was performed using NIH ImageJ software.

Western blotting

The cerebellum and liver were harvested from mice, flash-frozen in liquid nitrogen, and homogenized in RIPA buffer (Cell Signaling Technology, 9806) containing complete phosphatase inhibitor (Roche, 1697498001) and phosphatase inhibitor mixtures 2 and 3 (Sigma, P5726 and P0044). Lysates were centrifuged at 14,000 g for 10 min, and the supernatants were collected. Proteins were separated by SDS-PAGE and transferred onto Immobilon-FL (EMD Millipore, IPFL00010). After blocking in 3% BSA/PBS/Tween 20 for 1 h at room temperature, the blots were incubated with antibodies to PTEN (Cell Signaling Technology, 9559), phospho-PTEN (Ser380/Thr382/Thr383; Cell Signaling Technology, 9549), and GAPDH (Thermo Fisher, MA5–15738). Immunocomplexes were visualized using a PharosFX Plus Molecular Imager (Bio-Rad) with fluorescently labeled secondary antibodies (Invitrogen). Band intensity was quantified using NIH ImageJ software.

Acknowledgments

We thank past and present members of the Iijima and Sesaki labs for helpful discussions and technical assistance. This work was supported by NIH grants to MI (GM131768 and NS114458) and HS (GM123266) and a grant to MI from the Sol Goldman Pancreatic Cancer Research Center.

Abbreviation:

PTEN

Phosphatase and tensin homolog deleted on chromosome ten

PIP2

phosphatidylinositol-4,5-bisphosphate

PIP3

phosphatidylinositol-3,4,5-triphosphate

References

  1. Backman SA, Stambolic V, Suzuki A, Haight J, Elia A, Pretorius J, Tsao MS, Shannon P, Bolon B, Ivy GO & Mak TW (2001) Deletion of Pten in mouse brain causes seizures, ataxia and defects in soma size resembling Lhermitte-Duclos disease. Nat Genet 29, 396–403. [DOI] [PubMed] [Google Scholar]
  2. Baker SJ (2007) PTEN enters the nuclear age. Cell 128, 25–28. [DOI] [PubMed] [Google Scholar]
  3. Bassi C, Ho J, Srikumar T, Dowling RJ, Gorrini C, Miller SJ, Mak TW, Neel BG, Raught B & Stambolic V. (2013) Nuclear PTEN controls DNA repair and sensitivity to genotoxic stress. Science 341, 395–399. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Bonneau D & Longy M. (2000) Mutations of the human PTEN gene. Hum Mutat 16, 109–122. [DOI] [PubMed] [Google Scholar]
  5. Chung JH, Ostrowski MC, Romigh T, Minaguchi T, Waite KA & Eng C. (2006) The ERK1/2 pathway modulates nuclear PTEN-mediated cell cycle arrest by cyclin D1 transcriptional regulation. Hum Mol Genet 15, 2553–2559. [DOI] [PubMed] [Google Scholar]
  6. Cupolillo D, Hoxha E, Faralli A, De Luca A, Rossi F, Tempia F & Carulli D. (2016) Autistic-Like Traits and Cerebellar Dysfunction in Purkinje Cell PTEN Knock-Out Mice. Neuropsychopharmacology 41, 1457–1466. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Endersby R & Baker SJ (2008) PTEN signaling in brain: neuropathology and tumorigenesis. Oncogene 27, 5416–5430. [DOI] [PubMed] [Google Scholar]
  8. Fragoso R & Barata JT (2015) Kinases, tails and more: regulation of PTEN function by phosphorylation. Methods 77–78, 75–81. [DOI] [PubMed] [Google Scholar]
  9. Gericke A, Leslie NR, Losche M & Ross AH (2013) PtdIns(4,5)P2-mediated cell signaling: emerging principles and PTEN as a paradigm for regulatory mechanism. Advances in experimental medicine and biology 991, 85–104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Gil A, Andres-Pons A & Pulido R. (2007) Nuclear PTEN: a tale of many tails. Cell Death Differ 14, 395–399. [DOI] [PubMed] [Google Scholar]
  11. Groszer M, Erickson R, Scripture-Adams DD, Dougherty JD, Le Belle J, Zack JA, Geschwind DH, Liu X, Kornblum HI & Wu H. (2006) PTEN negatively regulates neural stem cell self-renewal by modulating G0-G1 cell cycle entry. Proc Natl Acad Sci U S A 103, 111–116. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Hopkins BD & Parsons RE (2014) Molecular pathways: intercellular PTEN and the potential of PTEN restoration therapy. Clin Cancer Res 20, 5379–5383. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Igarashi A, Itoh K, Yamada T, Adachi Y, Kato T, Murata D, Sesaki H & Iijima M. (2018) Nuclear PTEN deficiency causes microcephaly with decreased neuronal soma size and increased seizure susceptibility. J Biol Chem 293, 9292–9300. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Igarashi A, Kato T, Sesaki H & Iijima M. (2021) Nuclear PTEN deficiency and heterozygous PTEN loss have distinct impacts on brain and lymph node size. Biochem Biophys Res Commun 555, 81–88. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Kageyama Y, Hoshijima M, Seo K, Bedja D, Sysa-Shah P, Andrabi SA, Chen W, Höke A, Dawson VL & Dawson TM (2014) Parkin-independent mitophagy requires Drp1 and maintains the integrity of mammalian heart and brain. The EMBO journal 33, 2798–2813. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Kato T, Murata D, Anders RA, Sesaki H & Iijima M. (2021) Nuclear PTEN and p53 suppress stress-induced liver cancer through distinct mechanisms. Biochem Biophys Res Commun 549, 83–90. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Kato T, Yamada T, Nakamura H, Igarashi A, Anders RA, Sesaki H & Iijima M. (2020) The Loss of Nuclear PTEN Increases Tumorigenesis in a Preclinical Mouse Model for Hepatocellular Carcinoma. iScience 23, 101548. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Knobbe CB, Lapin V, Suzuki A & Mak TW (2008) The roles of PTEN in development, physiology and tumorigenesis in mouse models: a tissue-by-tissue survey. Oncogene 27, 5398–5415. [DOI] [PubMed] [Google Scholar]
  19. Kreis P, Leondaritis G, Lieberam I & Eickholt BJ (2014) Subcellular targeting and dynamic regulation of PTEN: implications for neuronal cells and neurological disorders. Front Mol Neurosci 7, 23. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Kwon CH, Luikart BW, Powell CM, Zhou J, Matheny SA, Zhang W, Li Y, Baker SJ & Parada LF (2006) Pten regulates neuronal arborization and social interaction in mice. Neuron 50, 377–388. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Kwon CH, Zhu X, Zhang J, Knoop LL, Tharp R, Smeyne RJ, Eberhart CG, Burger PC & Baker SJ (2001) Pten regulates neuronal soma size: a mouse model of Lhermitte-Duclos disease. Nat Genet 29, 404–411. [DOI] [PubMed] [Google Scholar]
  22. Leslie NR, Kriplani N, Hermida MA, Alvarez-Garcia V & Wise HM (2016) The PTEN protein: cellular localization and post-translational regulation. Biochem Soc Trans 44, 273–278. [DOI] [PubMed] [Google Scholar]
  23. Li J, Yen C, Liaw D et al. (1997) PTEN, a putative protein tyrosine phosphatase gene mutated in human brain, breast, and prostate cancer. Science 275, 1943–1947. [DOI] [PubMed] [Google Scholar]
  24. Luo J, Manning BD & Cantley LC (2003) Targeting the PI3K-Akt pathway in human cancer: rationale and promise. Cancer Cell 4, 257–262. [DOI] [PubMed] [Google Scholar]
  25. Maehama T, Taylor GS & Dixon JE (2001) PTEN and myotubularin: novel phosphoinositide phosphatases. Annu Rev Biochem 70, 247–279. [DOI] [PubMed] [Google Scholar]
  26. Marino S, Krimpenfort P, Leung C, van der Korput HA, Trapman J, Camenisch I, Berns A & Brandner S. (2002) PTEN is essential for cell migration but not for fate determination and tumourigenesis in the cerebellum. Development 129, 3513–3522. [DOI] [PubMed] [Google Scholar]
  27. Nguyen HN, Afkari Y, Senoo H, Sesaki H, Devreotes PN & Iijima M. (2014a) Mechanism of human PTEN localization revealed by heterologous expression in Dictyostelium. Oncogene 33, 5688–5696. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Nguyen HN, Yang JM, Afkari Y, Park BH, Sesaki H, Devreotes PN & Iijima M. (2014b) Engineering ePTEN, an enhanced PTEN with increased tumor suppressor activities. Proceedings of the National Academy of Sciences of the United States of America 111, E2684–2693. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Nguyen HN, Yang JM Jr., Rahdar M, Keniry M, Swaney KF, Parsons R, Park BH, Sesaki H, Devreotes PN & Iijima M. (2015a) A new class of cancer-associated PTEN mutations defined by membrane translocation defects. Oncogene 34, 3737–3743. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Nguyen HN, Yang JM, Miyamoto T, Itoh K, Rho E, Zhang Q, Inoue T, Devreotes PN, Sesaki H & Iijima M. (2015b) Opening the conformation is a master switch for the dual localization and phosphatase activity of PTEN. Sci Rep 5, 12600. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Planchon SM, Waite KA & Eng C. (2008) The nuclear affairs of PTEN. Journal of cell science 121, 249–253. [DOI] [PubMed] [Google Scholar]
  32. Salmena L, Carracedo A & Pandolfi PP (2008) Tenets of PTEN tumor suppression. Cell 133, 403–414. [DOI] [PubMed] [Google Scholar]
  33. Shen WH, Balajee AS, Wang J, Wu H, Eng C, Pandolfi PP & Yin Y. (2007) Essential role for nuclear PTEN in maintaining chromosomal integrity. Cell 128, 157–170. [DOI] [PubMed] [Google Scholar]
  34. Song MS, Carracedo A, Salmena L, Song SJ, Egia A, Malumbres M & Pandolfi PP (2011) Nuclear PTEN regulates the APC-CDH1 tumor-suppressive complex in a phosphatase-independent manner. Cell 144, 187–199. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Song MS, Salmena L & Pandolfi PP (2012) The functions and regulation of the PTEN tumour suppressor. Nature reviews. Molecular cell biology 13, 283–296. [DOI] [PubMed] [Google Scholar]
  36. Stambolic V, Suzuki A, de la Pompa JL, Brothers GM, Mirtsos C, Sasaki T, Ruland J, Penninger JM, Siderovski DP & Mak TW (1998) Negative regulation of PKB/Akt-dependent cell survival by the tumor suppressor PTEN. Cell 95, 29–39. [DOI] [PubMed] [Google Scholar]
  37. Sun Z, Huang C, He J, Lamb KL, Kang X, Gu T, Shen WH & Yin Y. (2014) PTEN C-terminal deletion causes genomic instability and tumor development. Cell Rep 6, 844–854. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Tamguney T & Stokoe D. (2007) New insights into PTEN. Journal of cell science 120, 4071–4079. [DOI] [PubMed] [Google Scholar]
  39. Yamada T, Adachi Y, Fukaya M, Iijima M & Sesaki H. (2016) Dynamin-Related Protein 1 Deficiency Leads to Receptor-Interacting Protein Kinase 3–Mediated Necroptotic Neurodegeneration. Am J Pathol 186, 2798–2802. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Yang J-M, Schiapparelli P, Nguyen H, Igarashi A, Zhang Q, Abbadi S, Amzel L, Sesaki H, Quiñones-Hinojosa A & Iijima M. (2017) Characterization of PTEN mutations in brain cancer reveals that pten mono-ubiquitination promotes protein stability and nuclear localization. Oncogene 36, 3673–3685. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Yang JM, Nguyen HN, Sesaki H, Devreotes PN & Iijima M. (2015) Engineering PTEN function: membrane association and activity. Methods 77–78, 119–124. [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES