Abstract
Our present study aims to investigate the value of LRRN4 in the progression and prognosis of COAD patients. All COAD and adjacent sample data was downloaded from TCGA database. Survival analysis was performed according to Kaplan-Meier method. The real-time quantitative PCR and immunohistochemistry analysis were conducted for validation in cell lines and tissues. The GSEA was conducted to find functional KEGG pathways. Multivariate Cox regression proportional hazard mode was used to determine whether LRRN4 expression was an independent prognostic factor. The LRRN4 expression in COAD samples were significantly higher than that in adjacent samples, which was consistent with our experiments in cell lines and tissues. Along with the increase of TNM Stage, LRRN4 expression had an increasing tendency. The COAD patients with high LRRN4 expression showed undesirable prognoses. Additionally, the TGF-β signaling pathway, WNT signaling pathway and other 25 pathways were significantly activated in the high LRRN4 expression group. In conclusion, high LRRN4 expression was closely related to the onset of COAD and it was a poor prognostic factor for COAD patients.
Keywords: Colon adenocarcinoma, LRRN4, prognosis, biomarker
Introduction
Colon adenocarcinoma (COAD), is the dominant type of colon cancer (Mutch, 2007), which is one of the most common gastrointestinal tumors around the world (Arnold et al., 2017). As lots of factors affect the development of COAD, for example, alcohol, obesity and so on, the prevalence of COAD is high and growing annually (Islami et al., 2018; Siegel et al., 2019). In addition, COAD is a highly invasive adenocarcinoma and has great heterogeneity (Kalyan et al., 2018; Sun et al., 2016;Yang et al., 2019), which brings great challenges to the early diagnosis and treatment of COAD patients. The early detection of colon cancer would help improve overall survival after comparing the patients diagnosed at different stages (Lee et al., 2020). The progression of COAD is usually a multi‐stage process (Mutch, 2007), which reminds both COAD patients and researchers that it is important to take actions to prevent and diagnose early. Thus, there is no doubt that early detection and diagnosis is quite necessary for patients. With the development of medical technology, possible biomarkers identification is a promising tool for COAD diagnosis and prognosis. Accordingly, our team had spared no efforts to look for the reliable biomarkers in colon cancer before, and we have reported several miRNAs and genes (Li et al., 2020; Min et al., 2019). Besides, some other previous studies have demonstrated that aberrant gene expressions, such as TROP2 (Zhao and Zhang, 2018), HIF‐1 (Sun et al., 2020), played a crucial role in the onset of COAD. However, more specific biomarkers of COAD are still urgently needed.
LRRN4 (leucine rich repeat neuronal 4), a newly identified member of leucine rich repeat neuronal protein family (NLRR), has been reported to be expressed in various tissues. At present, LRRN4 has been investigated mainly in the central nervous system (CNS) (Bando et al., 2005) and the peripheral nervous system (PNS) (Bando et al., 2012). A recent study revealed that the aberrantly low expression of LRRN4 was closely associated with the dilated cardiomyopathy (Li et al., 2017), which reminded us that aberrant LRRN4 expression might also play a role in other diseases. To the best of our knowledge, LRRN4 has not been studied in cancers, but several other members of NLRR have been reported in some cancers. For example, the expression of LRRN1 was upregulated in gastric cancer tissues and LRRN1 was related to the poor prognosis (Liu et al., 2019). Not only that, NLRR1 was reported to be an extracellular negative regulator of ALK signaling in neuroblastoma (Satoh et al., 2016). In another study, NLRR1, NLRR3 and NLRR5 were found to have different biological functions among the neuroblastoma subsets (Hamano et al., 2004). However, LRRN4 has not been well explored in COAD yet. Collectively, the role of LRRN4 in COAD progression and prognosis should be well explored in the future for getting more information of LRRN4 and COAD.
Herein, based on the COAD-related data downloaded from The Cancer Genome Atlas (TCGA) database, we proposed to investigate the value of LRRN4 in the progression and prognosis of COAD patients, for convenience to supply alternative biomarkers for COAD patients and to understand the mechanism behind COAD.
Material and Methods
TCGA data
All data were downloaded from The Cancer Genome Atlas (TCGA, https://tcga-data.nci.nih.gov/tcga/) database. The mRNA expression data and corresponding clinical information of 456 COAD patients were obtained, including 456 COAD cancer tissues and 41 paired adjacent tissues. Among which, 433 COAD samples with complete survival information were used for further analysis. According to the median of LRRN4 expression, all cancer samples were divided into high and low LRRN4 expression COAD specimens. Detailed clinical information of 433 patients was showed in Table 1. Besides, 179 rectum adenocarcinoma (READ) patients’ mRNA and clinical information data was also downloaded.
Table 1 -. Clinical characteristics of patients with colon adenocarcinoma based on the TCGA database.
| Clinical characteristics | Total (n=433) | Percent(%) | |
|---|---|---|---|
| Age | Median[Min,Max] | 68[34,90] | |
| Gender | Male | 233 | 53.82 |
| Female | 200 | 46.18 | |
| TNM Stage | Stage I | 73 | 16.86 |
| Stage II | 165 | 38.12 | |
| Stage III | 123 | 28.41 | |
| Stage IV | 61 | 14.09 | |
| Unknown | 11 | 2.54 | |
| T Stage | T1 | 11 | 2.54 |
| T2 | 75 | 17.32 | |
| T3 | 296 | 68.36 | |
| T4 | 50 | 11.55 | |
| Tis | 1 | 0.23 | |
| N Stage | N0 | 254 | 58.66 |
| N1 | 102 | 23.56 | |
| N2 | 77 | 17.78 | |
| M Stage | M0 | 320 | 73.90 |
| M1 | 61 | 14.09 | |
| MX | 45 | 10.39 | |
| Unknown | 7 | 1.62 | |
| Race | American indian or alaska native | 1 | 0.23 |
| Asian | 11 | 2.54 | |
| Black or african american | 56 | 12.93 | |
| white | 209 | 48.27 | |
| Unknown | 156 | 36.03 | |
| History of colon polyps | NO | 238 | 54.97 |
| YES | 128 | 29.56 | |
| Unknown | 67 | 15.47 | |
| Disease type | Adenomas and Adenocarcinomas | 369 | 85.22 |
| Epithelial Neoplasms | 3 | 0.69 | |
| Mucinous and Serous Neoplasms | 61 | 14.09 | |
| BMI | Median[Min,Max] | 27.13[14.72,271.86] | |
| Vital status | Alive | 338 | 78.06 |
| Dead | 95 | 21.94 |
Colon adenocarcinoma patients
COAD tissues and adjacent tissues were collected from 15 patients diagnosed by two pathologists in Beijing Friendship Hospital from May 2020 to Dec 2020. The clinical validations were approved by the Ethics Committee of Beijing Friendship Hospital according to the Declaration of Helsinki (ethic code: 2017-P2-013-03), and informed consents were signed by all patients. The clinical information of patients were shown in the Table S1.
Survival analysis
Base on the Kaplan-Meier method, the overall survival (OS) probability of high and low LRRN4 expression group was estimated using survival package and survminer package (https://CRAN.R-project.org/package=survminer) in R language. The OS probability difference between different groups were determined by log-rank.
Cell culture
Human colonic mucosa cell line NCM460 and colon cancer cell line SW480 were purchased from Chinese Academy of Sciences (Shanghai, China), and verified by the Single Tandem Repeat (STR) profiling method. Both cell lines were cultured in complete DMEM medium, consisting of DMEM (Gibco, MA, USA) and 10% fetal bovine serum (Gibco, MA, USA). The cells were maintained in 37 ℃ saturated humidified environment with 5% CO2.
RNA extraction and the real-time quantitative PCR
For total RNA extraction and quantification, Trizol reagent (Cat# 15596-026, Invitrogen, Grand Island, CA, USA) and Nanodrop lite (Thermo, USA) were used. For reverse transcription, complementary DNA (cDNA) was obtained by TIANScript RT kit (Cat# KR104-02, TIANGEN, Beijing, China). The real-time quantitative PCR amplification was performed by SuperRealPreMix Plus kit (Cat# FP205, TIANGEN, Beijing, China), and GAPDH was an internal control. The primers of LRRN4 and GAPDH are listed in Table 2. All samples were analyzed by the LightCycler480 (Roche, USA) in biological triplicates for 40 cycles. The data of real-time quantitative PCR analysis was calculated by the 2-△△Ct method.
Table 2 -. Primer sequences.
| Genes | Forward Primer (5’-3’) | Reverse Primer (5’-3’) | Product length (bp) | Tm(℃) (◦C) |
|---|---|---|---|---|
| LRRN4 | CGTGGGACCGCAGCATAAGC | CCTTCCTCCTCCTCACTGTAGTCG | 133 | 60 |
| GAPDH | GCAAATTCCATGGCACCGTC | AGCATCGCCCCACTTGATTT | 110 | 60 |
Immunohistochemistry (IHC) analysis
IHC validation was conducted as described (Zeng et al., 2017). Antibody against LRRN4 was purchased from Abcam (ab133372, 1:100, Shanghai, China), and Goat anti-Rabbit IgG (H+L) -HRP were obtained from Bioworld (Cat#BS13278, 1:1000, Nanjing, China).
Gene set enrichment analysis (GSEA)
Based on the gene set c2.cp.kegg.v7.0.symbols from Molecular Signatures Database (MSigDB), GSEA was performed using software GSEA (version: #4.0). The KEGG pathways with P value <0.05 were considered as significant enrichment.
Statistical analysis
The LRRN4 expression in cancer samples, adjacent to normal samples and samples with various clinicopathological characteristics were compared using Wilcoxon rank-sum test. The influence of LRRN4 expression and different clinicopathological characteristics (Age, Sex, Stage, etc.) on OS was determined by the Multivariate cox regression proportional hazard mode. The difference was considered to be statistically significant if P value ≤0.05. R software (version 3.5.2.) was used for all statistical analysis.
Ethics
All procedures followed were in accordance with the Ethics Committee of Beijing Friendship Hospital according to the Declaration of Helsinki (ethic code: 2017-P2-013-03).
Data availability
The datasets used and analysed in the present research were downloaded from The Cancer Genome Atlas (TCGA, https://tcga-data.nci.nih.gov/tcga/) database.
Results
High LRRN4 expression was closely associated with the occurrence of COAD
In order to explore the relationship between LRRN4 expression and the onset of COAD, LRRN4 expression in COAD samples was compared with that in adjacent samples. The results showed that the expression of LRRN4 in COAD samples (N = 41) was significantly higher than that in paired adjacent samples (P = 6e-06) (Figure 1A). In addition, the expression of LRRN4 in all COAD samples (N = 433) was also significantly higher than that in adjacent samples (P=6.2e-10) (Figure 1B). Moreover, the LRRN4 expression was also significantly higher in READ samples when compared with adjacent samples (Figure 1C). The same tendency was also observed in GEPIA database (http://gepia.cancer-pku.cn/) (Figure 1D). These results suggested that high LRRN4 expression was closely associated with the onset of COAD.
Figure 1 -. The expression levels of LRRN4 in COAD and adjacent normal samples. (A) Box plot of LRRN4 expression in paired COAD and adjacent normal samples. (B) Box plot of LRRN4 expression in all COAD samples and adjacent normal samples. (C) LRRN4 expression in READ samples and adjacent samples. (D) In GEPIA database, LRRN4 expression in COAD samples and normal samples.
The association between LRRN4 expression and clinicopathological characteristics
To investigate the association between LRRN4 expression and clinicopathological characteristics, 433 COAD samples were analyzed using Wilcoxon rank-sum test. The results showed that along with the increase of TNM Stage, LRRN4 expression had a growing tendency. There was a significantly statistical difference in Stage I vs. Stage III, Stage II vs. Stage IV and Stage I vs. Stage IV (P value < 0.05, Figure 2A). LRRN4 expression was not significantly related to Sex and Age (P value > 0.05, Figure 2B and 2C).
Figure 2 -. The association between LRRN4 expression and clinicopathological characteristics. (A) The box plot of LRRN4 expression levels in different TNM stages. (B) The box plot of LRRN4 expression levels in different genders. (C) The box plot of LRRN4 expression levels in different ages.
High LRRN4 expression COAD patients showed poor prognosis
To explore the effect of LRRN4 expression on the prognosis of COAD patients, a survival analysis was conducted on high and low LRRN4 expression patients in the TCGA database. Compared with low LRRN4 expression patients, highly LRRN4 expressing patients had a poorer OS (p = 0.007, HR=0.57, 95%CI: 0.38-0.85) (Figure 3A).
Figure 3 -. The prognosis of COAD patients in high LRRN4 expression group was poor. (A) Kaplan Meier survival curve of patients with high and low LRRN4 expression. P value was determined by log-rank test. X-axis: time; y-axis: survival probability; color: various groups. (B) Multivariate cox regression analysis forest plot. Compared with reference samples, samples with Hazard ratio greater than 1 had a higher risk of death, and samples with a Hazard ratio less than 1 had a lower risk of death.
To confirm whether LRRN4 expression was an independent prognostic indicator, a multivariate Cox regression analysis, including Age, Sex, Stage and LRRN4, was conducted. The results showed that LRRN4 expression was still significantly correlated with the OS of COAD patients. High LRRN4 expression samples had a higher risk of death, which indicated that high LRRN4 expression was a poor prognostic factor (HR=1.19, 95%CI: 1.04-1.4, P = 0.011) (Figure 3B).
LRRN4 was upregulated in colon cancer cell lines and clinical COAD tissues
To validate our results obtained from the public dataset, experiments were conducted for detecting the LRRN4 expression level in colon cancer cell lines and clinical COAD tissues. The results suggested that the relative mRNA expression of LRRN4 (Figure 4A, P value <0.001) was high in colon cancer cell lines, which was consistent with the analysis of IHC. As shown in Figure 4B, pathologically incomplete intestinal gland was in tumor region, and IHC analysis indicated that LRRN4 was upregulated in COAD tissues, compared to the corresponding normal tissues. Thus, our findings showed that the upregulation of LRRN4 might be involved in the progression of COAD.
Figure 4 -. LRRN4 was upregulated in colon cancer cell lines and COAD patients. (A) the relative mRNA expression level of LRRN4 in colon cancer cell lines. *** P < 0.001. (B) representative IHC images of LRRN4 expression in COAD patients.
Signaling pathways related to LRRN4 expression based on GSEA
In TCGA database, GSEA enrichment analysis was used to identify the signaling pathways significantly activated in high LRRN4 expression samples relative to low LRRN4 expression samples. P value <0.05 was taken as criteria to screen significantly enriched KEGG pathways. The results showed that VASCULAR_SMOOTH_MUSCLE_CONTRACTION, CALCIUM_SIGNALING_PATHWAY, HEDGEHOG_SIGNALING_PATHWAY, ARRHYTHMOGENIC_RIGHT_VENTRICULAR_CARDIOMYOPATHY_ARVC, DILATED_CARDIOMYOPATHY, PROXIMAL_TUBULE_BICARBONATE_RECLAMATION and other 21 pathways were significantly activated in high LRRN4 expression samples relative to low LRRN4 expression samples (Table S2). The top six most significantly enriched pathways are displayed in Figure 5A-5F.
Figure 5 -. The GSEA results of LRRN4 expression.
Discussion
In the present study, we have firstly investigated the role of LRRN4 in the development and prognosis of COAD patients, utilizing a series of bioinformatic analyses and experimental validation. High LRRN4 expression was closely related to the onset of COAD. Not only that, highly LRRN4 expressed COAD patients showed relatively undesirable prognosis, compared with low LRRN4 expression COAD patients.
Firstly, the association between LRRN4 expression with the onset of COAD was investigated. According to the analyses of COAD related data, LRRN4 expression in COAD tissues was significantly higher than that in both paired adjacent samples and all adjacent samples, which has also been successfully validated from mRNA and protein level. Our findings showed that high LRRN4 expression was closely associated with the occurrence of COAD. As far as we know, this is the first time LRRN4 has been studied in COAD. LRRN4, as a member of LRRN family, was mainly reported in regulation of cardiac diseases (Brody and Lee, 2016; Moc et al., 2015), central nervous system (CNS) (Bando et al., 2005) and the peripheral nervous system (PNS) (Bando et al., 2012). For instance, a recent study reported that the aberrantly low expression of LRRN4 was closely associated with the dilated cardiomyopathy (Li et al., 2017), which reminded us that aberrant LRRN4 expression might also play a role in other diseases. In our study, aberrantly high LRRN4 expression was associated with the onset of COAD, which seemed to play a role in a similar way. Additionally, some other members of the LRRN family were reported in some cancer studies. LRRN1 was involved in gastric cancer (Liu et al., 2019) and neuroblastoma (Hamano et al., 2004; Satoh et al., 2016). Moreover, it has been documented that regulatory signals of the enteric innervation might be related to the pathogenesis of colorectal cancer (Sitohy and El-Salhy, 2002). Since the role of LRRN4 in nervous system, we suspected that LRRN4 might influence the onset of COAD in an indirect way, which still needs lots of further researches in the future.
Additionally, the correlation between LRRN4 expression and various clinicopathological characteristics was investigated in all COAD samples. We found that along with the increase of TNM Stage, LRRN4 expression had a growing tendency. But there was no significant association between LRRN4 expression and sex, age. TNM staging was usually evaluated after the operation and it was a crucial prognostic factor (Mokhtari and Zakerzade, 2017), which indicated that TNM stage was an important aspect for COAD prognosis. Subsequently, via survival analyses, highly LRRN4 expressing COAD patients were found to have a poorer OS, compared with low LRRN4 expression patients. Through the multivariate Cox regression analysis, LRRN4 expression was still an independent prognostic indicator for the prognosis of COAD. Collectively, high LRRN4 expression was a poor prognostic factor for COAD.
Based on the GSEA enrichment analysis, we have identified 27 signaling pathways that were significantly activated in high LRRN4 expression samples relative to low LRRN4 expression samples. Among which, several pathways caught our attention, such as TGF-β signaling pathway, gap junction, WNT signaling pathway and so on. TGF-β pathway was previously evidenced to be involved in primary tumor progression and in promoting metastasis in many human cancers including colorectal cancer (Akbari et al., 2014; Akhurst, 2017; Korkut et al., 2018). In this study, the TGF-β pathway was significantly activated in the high LRRN4 expression group, which was consistent with former studies. Regarding gap junction, it has been reported that along with the progression of colorectal neoplasia, some functional gap junctions were gradually lost (Kanczuga-Koda et al., 2010), while the mechanism behind the gap junction pathway in COAD were still not clear. A recent study has revealed that the activity of Wnt/β-catenin signaling could be regulated by certain genes or microRNAs, which would further regulate the progression of colorectal cancer, including COAD (Han et al., 2011; Shao et al., 2019). Consequently, there is a complicated regulation network influenced by the LRRN4 expression, which was still not clear and deserves further efforts.
Conclusions
We have firstly investigated the role of LRRN4 in COAD based on the bioinformatic analyses of COAD related data in TCGA database and further experimental validation. We found that high LRRN4 expression was probably related to the onset of COAD and highly LRRN4 expresseing COAD patients had undesirable OS. LRRN4 might be a promising prognostic biomarker in COAD patients, which deserves further exploration.
Acknowledgements
This study was supportd by the Beijjng Natural Science Foundation - Haidian Original Innovation Joint Fund (No. L182048).
Supplementary material
The following online material is available for this article:
References
- Akbari A, Amanpour S, Muhammadnejad S, Ghahremani MH, Ghaffari SH, Dehpour AR, Mobini GR, Shidfar F, Abastabar M, Khoshzaban A, et al. Evaluation of antitumor activity of a TGF-beta receptor I inhibitor (SD-208) on human colon adenocarcinoma. Daru. 2014;22:47. doi: 10.1186/2008-2231-22-47. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Akhurst RJ. Targeting TGF-beta signaling for therapeutic gain. Cold Spring Harb Perspect Biol. 2017;9:a022301. doi: 10.1101/cshperspect.a022301. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Arnold M, Sierra MS, Laversanne M, Soerjomataram I, Jemal A, Bray F. Global patterns and trends in colorectal cancer incidence and mortality. Gut. 2017;66:683–691. doi: 10.1136/gutjnl-2015-310912. [DOI] [PubMed] [Google Scholar]
- Bando T, Morikawa Y, Hisaoka T, Komori T, Miyajima A, Senba E. Expression pattern of leucine-rich repeat neuronal protein 4 in adult mouse dorsal root ganglia. Neurosci Lett. 2012;531:24–29. doi: 10.1016/j.neulet.2012.10.009. [DOI] [PubMed] [Google Scholar]
- Bando T, Sekine K, Kobayashi S, Watabe AM, Rump A, Tanaka M, Suda Y, Kato S, Morikawa Y, Manabe T, et al. Neuronal leucine-rich repeat protein 4 functions in hippocampus-dependent long-lasting memory. Mol Cell Biol. 2005;25:4166–4175. doi: 10.1128/MCB.25.10.4166-4175.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Brody MJ, Lee Y. The role of Leucine-rich repeat containing protein 10 (LRRC10) in dilated cardiomyopathy. Front Physiol. 2016;7:337. doi: 10.3389/fphys.2016.00337. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hamano S, Ohira M, Isogai E, Nakada K, Nakagawara A. Identification of novel human neuronal leucine-rich repeat (hNLRR) family genes and inverse association of expression of Nbla10449/hNLRR-1 and Nbla10677/hNLRR-3 with the prognosis of primary neuroblastomas. Int J Oncol. 2004;24:1457–1466. [PubMed] [Google Scholar]
- Han Y, Zhang PJ, Chen T, Yum SW, Pasha T, Furth EE. Connexin43 expression increases in the epithelium and stroma along the colonic neoplastic progression pathway: Implications for its oncogenic role. Gastroenterol Res Pract. 2011;2011:561719. doi: 10.1155/2011/561719. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Islami F, Goding Sauer A, Miller KD, Siegel RL, Fedewa SA, Jacobs EJ, McCullough ML, Patel AV, Ma J, Soerjomataram I, et al. Proportion and number of cancer cases and deaths attributable to potentially modifiable risk factors in the United States. CA Cancer J Clin. 2018;68:31–54. doi: 10.3322/caac.21440. [DOI] [PubMed] [Google Scholar]
- Kalyan A, Kircher S, Shah H, Mulcahy M, Benson A. Updates on immunotherapy for colorectal cancer. J Gastrointest Oncol. 2018;9:160–169. doi: 10.21037/jgo.2018.01.17. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kanczuga-Koda L, Koda M, Sulkowski S, Wincewicz A, Zalewski B, Sulkowska M. Gradual loss of functional gap junction within progression of colorectal cancer - a shift from membranous CX32 and CX43 expression to cytoplasmic pattern during colorectal carcinogenesis. In Vivo. 2010;24:101–107. [PubMed] [Google Scholar]
- Korkut A, Zaidi S, Kanchi RS, Rao S, Gough NR, Schultz A, Li X, Lorenzi PL, Berger AC, Robertson G, et al. A pan-cancer analysis reveals high-frequency genetic alterations in mediators of signaling by the TGF-beta superfamily. Cell Syst. 2018;7:422-437.e7. doi: 10.1016/j.cels.2018.08.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lee CH, Tseng PL, Tung HY, Cheng SC, Ching CY, Chang SC, Wu SF. Comparison of risk factors between colon cancer and rectum cancer in a single medical center hospital, Taiwan. Arch Med Sci. 2020;16:102–111. doi: 10.5114/aoms.2019.89407. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Li R, Fang J, Huo B, Su YS, Wang J, Liu LG, Hu M, Cheng C, Zheng P, Zhu XH, et al. Leucine-rich repeat neuronal protein 4 (LRRN4) potentially functions in dilated cardiomyopathy. Int J Clin Exp Pathol. 2017;10:9925–9933. [PMC free article] [PubMed] [Google Scholar]
- Li X, Wei R, Wang M, Ma L, Zhang Z, Chen L, Guo Q, Guo S, Zhu S, Zhang S, et al. MGP promotes colon cancer proliferation by activating the NF-kappaB pathway through upregulation of the calcium signaling pathway. Mol Ther Oncolytics. 2020;17:371–383. doi: 10.1016/j.omto.2020.04.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Liu B, Zhang Y, Fan Y, Wang S, Li Z, Deng M, Li C, Wang J, Ma R, Wang X, et al. Leucine-rich repeat neuronal protein-1 suppresses apoptosis of gastric cancer cells through regulation of Fas/FasL. Cancer Sci. 2019;110:2145–2155. doi: 10.1111/cas.14042. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Min L, Zhu S, Chen L, Liu X, Wei R, Zhao L, Yang Y, Zhang Z, Kong G, Li P, et al. Evaluation of circulating small extracellular vesicles derived miRNAs as biomarkers of early colon cancer: A comparison with plasma total miRNAs. J Extracell Vesicles. 2019;8:1643670. doi: 10.1080/20013078.2019.1643670. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Moc C, Taylor AE, Chesini GP, Zambrano CM, Barlow MS, Zhang X, Gustafsson AB, Purcell NH. Physiological activation of Akt by PHLPP1 deletion protects against pathological hypertrophy. Cardiovasc Res. 2015;105:160–170. doi: 10.1093/cvr/cvu243. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Mokhtari M, Zakerzade Z. EPCAM expression in colon adenocarcinoma and its relationship with TNM staging. Adv Biomed Res. 2017;6:56. doi: 10.4103/2277-9175.205529. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Mutch MG. Molecular profiling and risk stratification of adenocarcinoma of the colon. J Surg Oncol. 2007;96:693–703. doi: 10.1002/jso.20915. [DOI] [PubMed] [Google Scholar]
- Satoh S, Takatori A, Ogura A, Kohashi K, Souzaki R, Kinoshita Y, Taguchi T, Hossain MS, Ohira M, Nakamura Y, et al. Neuronal leucine-rich repeat 1 negatively regulates anaplastic lymphoma kinase in neuroblastoma. Sci Rep. 2016;6:32682. doi: 10.1038/srep32682. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Shao Q, Xu J, Deng R, Wei W, Zhou B, Yue C, Zhu M, Zhu H. SNHG 6 promotes the progression of colon and rectal adenocarcinoma via miR-101-3p and Wnt/beta-catenin signaling pathway. BMC Gastroenterol. 2019;19:163. doi: 10.1186/s12876-019-1080-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Siegel RL, Miller KD, Jemal A. Cancer statistics, 2019. CA Cancer J Clin. 2019;69:7–34. doi: 10.3322/caac.21551. [DOI] [PubMed] [Google Scholar]
- Sitohy B, El-Salhy M. Changes in the colonic enteric nervous system in rats with chemically induced colon dysplasia and carcinoma. Acta Oncol. 2002;41:543–549. doi: 10.1080/02841860214957. [DOI] [PubMed] [Google Scholar]
- Sun Y, Zheng ZP, Li H, Zhang HQ, Ma FQ. ANRIL is associated with the survival rate of patients with colorectal cancer, and affects cell migration and invasion in vitro. Mol Med Rep. 2016;14:1714–1720. doi: 10.3892/mmr.2016.5409. [DOI] [PubMed] [Google Scholar]
- Sun Y, Li M, Liu G, Zhang X, Zhi L, Zhao J, Wang G. The function of Piezo1 in colon cancer metastasis and its potential regulatory mechanism. J Cancer Res Clin Oncol. 2020;146:1139–1152. doi: 10.1007/s00432-020-03179-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Yang C, Zhang Y, Xu X, Li W. Molecular subtypes based on DNA methylation predict prognosis in colon adenocarcinoma patients. Aging (Albany NY) 2019;11:11880–11892. doi: 10.18632/aging.102492. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zeng M, Zhu L, Li L, Kang C. miR-378 suppresses the proliferation, migration and invasion of colon cancer cells by inhibiting SDAD1. Cell Mol Biol Lett. 2017;22:12. doi: 10.1186/s11658-017-0041-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zhao P, Zhang Z. TNF-alpha promotes colon cancer cell migration and invasion by upregulating TROP-2. Oncol Lett. 2018;15:3820–3827. doi: 10.3892/ol.2018.7735. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
The datasets used and analysed in the present research were downloaded from The Cancer Genome Atlas (TCGA, https://tcga-data.nci.nih.gov/tcga/) database.





