Skip to main content
NCBI home page
Toxicology Research logoLink to Toxicology Research
. 2021 Oct 14;10(6):1092–1103. doi: 10.1093/toxres/tfab094

The modulatory effect of bee honey against diethyl nitrosamine and carbon tetrachloride instigated hepatocellular carcinoma in Wistar rats

Tarek Kamal Abouzed 1,✉, Ehab B Eldomany 2, Shymaa A Khatab 3, Adil Aldhahrani 4, Wael M Gouda 5, Ahmed M Elgazzar 6, Mohamed Mohamed Soliman 7, Mohmed Atef Kassab 8, Samir Ahmed El-Shazly 9, Fayez Althobaiti 10, Doaa Abdallha Dorghamm 11
PMCID: PMC8693075  PMID: 34992771

Abstract

 

Hepatocellular carcinoma (HCC) is a serious threat to human health that has attracted substantial interest. The purpose of this study was to investigate the modulatory effect of bee honey against induced HCC by diethylnitrosamine/carbon tetrachloride (DEN/CCl4) in rats. HCC was induced by a single intraperitoneal dose of DEN (200 mg/kg B.W). Two weeks later, CCl4 (1 ml/kg) was intraperitoneally injected (three times a week). Bee honey was administered orally at 2 g/rat before and after the induction of HCC. The results showed that bee honey administration significantly increased body weight, decreased liver weight, and relative liver weight compared to those in the HCC-induced group. Moreover, a significant decrease in serum alpha-fetoprotein (AFP) as well as AST, ALT, GGT, ALP activities were observed in bee honey administration rats compared with those in HCC-induced group. Also, the hepatic MDA was significantly decreased; in addition, SOD, CAT, and GPx activities were significantly increased in groups treated with bee honey compared with those in the HCC group. The hepatic histopathology alterations caused by DEN/CCl4 injection were ameliorated by bee honey treatment. Likewise, the mRNA expression levels of tumor necrosis factor-alpha (TNF-α), transforming growth factor (TGF-β1), intracellular adhesion molecule-1 (ICAM-1), vascular cellular adhesion molecule-1 (VCAM-1), glypican (GP-3), thioredoxin (TRX), and glutaredoxin (GRX) were downregulated, and caspase-3 was upregulated by bee honey treatment compared with untreated HCC-induced group. In conclusion, bee honey has remarkable beneficial effects against HCC induced in rats through its antioxidant, anti-inflammatory, antifibrotic, and antimetastatic effects.

Practical Applications

The current study confirmed that honey has the potential to act as an antimetastatic factor. Bee honey supplementation either before or after combined injection of DEN/CCl4 exhibited inhibitory and ameliorative effects against DEN/CCl4-induced HCC through its antioxidant, antiproliferative, anti-metastatic, antifibrotic, and apoptosis properties. To our knowledge, this is the first study to describe the molecular mechanisms underlying honey’s effects against DEN/CCl4-induced HCC in rats.

Keywords: HCC, bee honey, antioxidant, antifibrotic, anti-metastatic

Graphical abstract

graphic file with name tfab094ga.jpg

Open in a new tab

Introduction

Hepatocellular carcinoma (HCC) is a form of cancer with one of the highest mortality rates. It is also one of the leading causes of death worldwide [1, 2]. It occurs in patients suffering from chronic liver diseases such as cirrhosis caused by hepatitis B and C virus infection [3]. There are numerous risk factors that contribute to the development of HCC, including hepatic viral infection, alcohol consumption, smoking tobacco, exposure to chemical toxins [4].

HCC accounts about 14.8% of all cancer deaths in Egypt, being particularly fatal in males (17.3% of male cancer deaths, 11.5% of female ones) [5]. Nitrosodiethylamine (DEN) is a common environmental carcinogen that is widespread in cheese, soybeans, packaged food, alcoholic beverages, cigarette products, and cosmetics [6–8]. Studies on experimental animals have highlighted DEN as a hepatocarcinogenic agent [9]. DEN is usually employed to induce HCC, whereas CCl4 is introduced to increase the intensity of carcinogenesis [10]. Oxidative stress is the result of the production of reactive oxygen species, which consequently leads to cellular injury associated with the pathological process of DEN-induced HCC [11]. DEN typically causes malignant liver tumors through rapid hepatocyte destruction; however, DEN itself takes a long time to cause HCC, but tumor promoters such as CCl4 shorten the period required for the production of liver carcinoma [12]. The principal cancer treatment is chemotherapy, but it can damage both cancerous tissues and normal cells [13]. Liver transplantation is commonly used in the treatment of HCC patients, but it is associated with a high probability of tumor recurrence following transplantation, which reduces its efficacy [14]. The development of molecular-targeted therapies and the evaluation of their efficacy in HCC can help to resolve these problems [15].

Bees are called Apis in Latin and use nectar collected from plants to produce honey, during the production of honey, many biological substances from the bees are added. Honey is stored by bees for the winter. Their wings fan the honey, evaporating the water and preventing the honey from fermenting [16].

Bee honey possessess numerous pharmacological and biological properties, including anti-inflammatory, antioxidant, antihypertensive, hypoglycemic, and antibacterial effects [17]. Flavonoids, tocopherols, catalase, ascorbic acid, and phenolic compounds present in bee honey act synergistically to exert antioxidant effects [18]. Against this background, the current investigation was established to assess honey bee nectar’s capacity to suppress and ameliorate the impacts of DEN/CCl4-induced HCC in albino rats through affecting the expression of TNF-α, TGF-β1, ICAM-1, VCAM-1, caspase3, glypican (GP-3), thioredoxin, and glutaredoxin genes.

Material and Methods

Materials

Bee honey was obtained from a private farm in Desouk City, Kafrelsheikh Governate, Egypt. N-Nitrosodiethylamine (NDEA) and carbon tetrachloride (CCl4) were purchased from Sigma-Aldrich Co. (St. Louis, MO, USA). Trizol and cDNA synthesis kit were supplied by INTRON Biotechnology, Inc. QuantiFast SYBR Green PCR Master Mix was obtained from QIAGEN (Hilden, Germany). AST and ALT commercial kits were obtained from Biodiagnostics (Cairo, Egypt). γGT kit, ALP kit were obtained from Biosystems(Spain). Lipid peroxide, catalase, and GPX kits were obtained from Biodiagnostics Co. (Cairo, Egypt).

Animals

In this investigation, 75 male Wistar albino rats with an average body weight of 120–150 g were obtained from the Egyptian Organization of Biological Products and Vaccines (Agouza, Giza, Egypt). The rats were acclimated to the laboratory conditions for 1 week in well-ventilated plastic cages (temperature 22–25°C and 12/12-h photoperiod). The animals were supplied with a standard commercial diet (El-Nasr Co., Cairo, Egypt) and free water ad libitum throughout the experiment. The investigation was performed in accordance with the Guidelines for the Care and Use of Laboratory Animals of Kafr-Elsheikh University.

Preparation of DEN and CCl4

For the preparation of DEN and CCl4, DEN was dissolved in normal saline (.9%), while CCl4 was dissolved in olive oil at a ratio of 1:1.

Experimental design

Following the period of acclimation, the rats were randomly divided equally into five groups as follows:

Group (1) Control untreated rats received .5 ml of normal saline orally by gastric intubation.

Group (2) Rats were treated with bee honey (2 g/rat) orally via a stomach tube daily [19].

Group (3) Rats were injected intraperitoneally with one dose of DEN (200 mg/kg b.w., I.P.) [20]. Two weeks later, CCl4 was injected subcutaneously (three times a week for 6 weeks) at a dose of 1 ml/kg [21].

Group (4) Rats were pretreated daily with bee honey (2 g/rat) orally by stomach intubation for 3 weeks and then injected with DEN/CCl4 as previously mentioned, after which they received bee honey again for up to 16 weeks.

Group (5) Rats were injected intraperitoneally with DEN/CCl4 as previously mentioned to elicit HCC, followed by treatment with bee honey for 16 weeks.

Sampling

The rats were anesthetized with thiopentone sodium (50 mg/kg b.w., I.P.) [22]. Blood was taken from each animal’s retro-orbital venous plexus in clean and dry centrifuge tubes. After allowing the samples to clot, they were centrifuged at 3000 rpm for 20 min. For biochemical study, the obtained sera were transferred to clean dry Eppendorf tubes and stored at −80°C. The liver was collected from each rat after decapitation and weighed. The hepatic tissue was separated into two parts; the first part was taken directly, immersed in liquid nitrogen, and then stored at −80°C until total RNA extraction, quantitative real-time polymerase chain reaction (qPCR), and evaluation of lipid peroxidation and antioxidant status. The other part was immersed in formalin (10%) for histopathological analysis.

Biochemical assessment

ALT, AST [23], and ALP [24] activities were assayed using quantitative colorimetric kits (Bio-diagnostic Co., Giza, Egypt). Serum GGT level was measured in accordance with a previously reported procedure [25]. The amount of serum alpha fetoprotein (AFP) was measured in accordance with a previous report [26] using the ELISA sandwich technique. All procedures were carried out as directed by the manufacturer.

Assessment of hepatic oxidative/antioxidant status

Liver homogenates were used to analyze the level of MDA [27]. Catalase and SOD activities were measured following the methods reported previously [28, 29], while glutathione peroxidase (GPX) activity was measured in accordance with another report [30].

Histopathological examination

Liver tissues were fixed in 10% buffered formalin solution, dehydrated in various alcohols, cleared in xylene, and embedded in paraffin blocks. Hematoxylin and eosin staining was used to stain sections with a thickness of 5 μm [31]. A digital camera computer interface (Nikon Digital Camera, Japan) was used to photograph histological changes in the liver under a light microscope. Five fields per sample for five rats from each group were used to calculate the percentage of degenerative changes in hepatocytes. The degenerative changes were calculated semi-quantitatively using a five-point scale as follows: 0 scale = lower than 10%, 1+ scale = 10–25%, 2+ scale = 25–50%, 3 + = 50–77%, and 4+ scale = more than 75%) positive cells [20].

Gene expression by qPCR

Trizol reagent was used to remove RNA from the liver tissue of both control and treated rats. RNase-free water was used to dissolve the RNA pellet. Nanodrop 2000c (Thermo Scientific, USA) was used to assess the RNA concentration. Complementary DNA was generated using the HiSenScriptTM[−]kit by mixing 10 μl of 2 × RT reaction solution, 1 μl of enzyme, and 1 μg of total RNA, and made up to a final volume of 20 μl using RNase free water. The mixture was incubated for 30 min at 50°C and then for 10 min at 85°C.

SYBR Green qPCR was used to assess the mRNA expression in hepatic tissue. The primers were synthesized by Macrogen Co. (Seoul, South Korea), as described in Table 1.

Table 1.

sense and antisense primers sequences in qPCR

  Sense Antisense
TNF-α GACCCTCACACTCAGATCATCTTCT TTGTCTTTGAGATCCATGCCATT
ICAM-1 AAACGGGAGATGAATGGTACCTAC TGCACGTCCCTGGTGATACTC
VCAM-1 GACTGG CAGCTGACCTATGTC AGTCTGATGAATCAACATCGTAGC
TGF B-1 TCACTTGTTTTGGTGGATGC TTCTGTCTCTCAAGTCCCCC
Caspase 3 GGTATTGAGACAGACAGTGG CATGGGATCTGTTTCTTTGC
GP3 GTGCTGGAACGGACAAGAG TTCTTCATCCCATTCCTTGC
TRX TTCCTTGAAGTAGACGTGGATGAC AGAGAACTCCCCAACCTTTTGAC
GRX CGTGGTCTCCATGGAATTTGTG AAGACCCGAGGAACTGTTCTTG
− actin β TGTTGTCCCTGTATGCCTCT TAATGTCACGCACGATTTCC
Open in a new tab

The mRNA expression levels in liver tissue were calculated using qPCR with SYBR Green. Denaturation was performed for 10 min at 92 °C, followed by 40 cycles of 92°C for 15 s, 60°C for 30 s, and 72°C for 30 s. The differences in gene expression between the groups were analyzed using △△Ct method and normalized to β-actin, to calculate the relative mRNA levels.

Statistical analysis

One-way analysis of variance was used to calculate the differences among the groups, followed by a Bonferroni test (GraphPad Software Inc., San Diego, CA, USA). Statistical significance was defined as a value of P ≤ .05. The data are presented as mean ± SD.

Results

Impact of bee honey on body weight and liver weight

The administration of bee honey alone did not show any change of body weight, liver weight, and relative liver weight when compared with those of untreated control animals. Meanwhile, rats injected with DEN/CCl4, shown significant decrease (P ≤ .05) of body weight in comparison with the control untreated rats and rats that received bee honey alone. Furthermore, the liver weight and relative liver weight were significantly increased (P ≤ .05) in untreated HCC group when compared with those of the control untreated rats and bee honey alone treated group.

Interestingly, Bee honey administration before and after injection of DEN/CCl4 displayed a significant increase of body weight (P ≤ .05), and significant decrease (P ≤ .05) of liver weight and relative liver weight when compared with those of untreated HCC-induced group as shown in Table 2.

Table 2.

Effect of bee honey administration on body weight and liver weight in the different study groups

  Control Control+Bee honey HCC Bee honey +HCC HCC + Bee honey
Body weight 490.7 ± 14.1a 500.3 ± 13.28a 198.5 ± 12.79d 443.2 ± 20.7b 365.5 ± 15.83c
Liver weight 12.37 ± .60c 12.07 ± .49c 23.18 ± 1.05a 14.69 ± .82c 17.99 ± 1.05b
Relative liver weight 2.53 ± .11d 2.45 ± .14d 7.93 ± .53a 3.41 ± .26c 4.99 ± .31b
Open in a new tab

Data were presented as mean ± SEM. Significant difference vs. control, control+bee honey, HCC (hepatocarcinoma), bee honey +HCC, and h HCC + bee honey groups. Means in the same raw with different superscript letters are significantly different (P < .05) (Bonferroni’s multiple range post hoc test)

Liver function assays

DEN/CCl4 administration induced significant elevations in serum ALT, AST, ALP, and γGT levels (P ≤ .05) compared with those in control untreated rats and those receiving bee honey only. Supplementation of honey before and after the injection of DEN/CCl4 to induce HCC resulted in significant declines (P ≤ .05) of all liver function biomarkers to nearly normal levels in comparison with those in the untreated HCC-induced animals, as shown in Fig. 1.

Figure 1.

Figure 1

Open in a new tab

Ameliorative effects of bee honey on the serum biochemical parameters in different study groups (A) alanine transaminase (ALT), (B) aspartate aminotransferase (AST), (C) gamma glutamyl transferase (γGT), and (D) alkaline phosphatase (ALP). Data were presented as mean ± SEM *significantly different at P < .05, ** significantly different at P < .001, *** significantly different at P < .0001, and ≠ nonsignificant using ANOVA followed by Bonferroni’s as a post hoc test.

Serum alpha fetoprotein (AFP)

AFP level was significantly elevated (P ≤ .05) in the HCC group when compared with the normal untreated and honey only-treated groups. Supplementation of honey either before or after the injection of DEN/CCl4 to induce HCC resulted in a significant decline (P ≤ .05) of the serum AFP level compared with that of the untreated HCC group, as shown in Fig. 2.

Figure 2.

Figure 2

Open in a new tab

Ameliorative effects of bee honey on the serum α-fetoprotein (AFP) level in different studied groups. Data were presented as mean ± SEM *significantly different at P < .05, ** significantly different at P < .001, *** significantly different at P < .0001, and ≠ nonsignificant using ANOVA followed by Bonferroni’s as a post hoc test.

Effect of bee honey on hepatic oxidative stress and antioxidant status

DEN/CCl4 injection induced a significant increase of hepatic MDA level (P ≤ .05) and significant decline (P ≤ .05) the activity of catalase, SOD, and GPX enzymes compared with those in the control untreated rats and bee honey-treated group. However, Rats are administered bee honey before and after the combined injection of DEN/CCl4, were shown a significant decline hepatic MDA level (P ≤ .05) and significant increase the activity of catalase, SOD, and GPX compared with the those in the untreated HCC-induced group, as shown in Fig. 3.

Figure 3.

Figure 3

Open in a new tab

Ameliorative effects of bee honey on the hepatic (A) malondialdehyde (MDA), (B) catalase, (C) superoxide dismutase (SOD), and (D) glutathione peroxidase (GPX) activities.). Data were presented as mean ± SEM *significantly different at P < .05, ** significantly different at P < .001, *** significantly different at P < .0001, and ≠ nonsignificant using ANOVA followed by Bonferroni’s as a post hoc test.

Histopathological findings

The control group had normal histoarchitecture of liver tissue, as seen in Fig. 4. Meanwhile, the liver tissue of the untreated HCC rats had a neoplastic lesion within the hepatic parenchyma, necrosed hepatocytes inside the neoplastic lesion, and an elevated nuclear/cytoplasmic ratio with nuclear atypia, prominent nucleoli, and intracytoplasmic inclusion body, vesicular nucleus, blood sinusoid dilatation, and vacuolar dilation. Pretreatment with bee honey resulted in the absence of tumor masses or other dysplastic nodules, mild necrosis of hepatocytes, as well as minor dilation of blood sinusoids and hepatocyte vacuolar degeneration. After treatment with bee honey, the cellular histology of HCC improved, with few hepatic changes such as coagulative and vacuolar hepatocyte degeneration, and mild congestion. Furthermore, the degenerative hepatocytes percentage significantly increased (P ≤ .05) in DEN/CCl4-treated rats in comparison with those in the control and control receiving bee honey. Furthermore, pretreatment and post-treatment with bee honey significantly decreased (P ≤ .05) the degenerative hepatocyte percentage compared with that in the untreated HCC group, as shown in Fig. 5.

Figure 4.

Figure 4

Open in a new tab

Photomicrograph of liver tissue (A) control group showing, normal hepatic parenchyma with the central vein (V), normal blood sinusoid (arrowheads), and the hepatocyte with large spherical vesicular nuclei (arrows). (B) Control+bee honey group showing, the same architecture as a control group; (C) HCC group showing the focal area of lymphoid stroma (thick arrow), congested central vein (arrow head), vacuolar degeneration of hepatocyte with necrosis in some area (thin arrow), (D) HCC group showing sever necrosis (thick arrow), vacuolar degeneration (thin arrows), and dilated blood sinusoids (arrow heads). (E and F) Bee honey before HCC induction group showing, mild congestion of central vein (V), dilated blood sinusoids (arrow heads) with normal hepatic cords (thin arrow), small focal area of lymphoid stroma (thick arrow). (G and H) bee honey after HCC induction group showing, sever congestion of blood vessels (V), pseudo glandular form (thick arrow), hepatocytes with large vacuoles (thin arrows), area of degeneration and necrosis (asterisk) and dilated blood sinusoids (arrow heads).H&E stain.

Figure 5.

Figure 5

Open in a new tab

The degenerative hepatocyte percentage in different study groups. The score of the degenerated hepatocyte, Control(0 scale), control+bee honey (0 scale), HCC (+2 scale), bee honey +HCC (0 scale), and HCC + bee honey (+1 scale). Data were presented as mean ± SEM *significantly different at P < .05, ** significantly different at P < .001, *** significantly different at P < .0001, and ≠ nonsignificant using ANOVA followed by Bonferroni’s as a post hoc test.

Gene expression in liver tissues

qRT-PCR was used to evaluate gene expression levels, with normalization to β-actin mRNA. DEN/CCl4 administration produced the significant upregulation of TNF-α, ICAM-1, VCAM-1, TGF-β1, Casps3, GP3, Trx-1, and Grx mRNA expression in comparison with the levels in control untreated rats. Meanwhile, the administration of honey before and after the injection of DEN/CCl4 significantly downregulated the gene expression to nearly the same levels as in normal rats, upon comparison to untreated HCC-induced animals. The gene expression profiles are shown in Figs 6 and 7.

Figure 6.

Figure 6

Open in a new tab

Ameliorative effects of bee honey on (A) TNF-α, (B) ICAM-1, (C) VCAm-1, and (D)TGF-β1 gene expressions in liver tissues. The mRNA expression levels were measured by qRT-PCR and normalized to β-actin. The primers were listed in (Table 1). Data were presented as mean ± SEM *significantly different at P < .05, ** significantly different at P < .001, *** significantly different at P < .0001, and ≠ nonsignificant using ANOVA followed by Bonferroni’s as a post hoc test.

Figure 7.

Figure 7

Open in a new tab

Ameliorative effects of bee honey on (A) Caspase 3, (B) GP3, (C) TRX, and (D) GRX gene expression in liver tissues. The mRNA expression levels were measured by qRT-PCR and normalized to β-actin. The primers were listed in (Table 1). Data were presented as mean ± SEM *significantly different at P < .05, ** significantly different at P < .001, *** significantly different at P < .0001, and ≠ nonsignificant using ANOVA followed by Bonferroni’s as a post hoc test.

Discussion

The purpose of this study was to assess bee honey’s prophylactic and therapeutic effects on HCC induced by DEN/CCl4 in albino rats. Bee products are considered to be potential sources of natural antioxidants [32]. Our results revealed that body weight was greatly reduced in the DEN/CCl4-treated group, which may have been due to a loss of appetite [33]. Meanwhile, the body weights were improved in the groups treated with honey either before or after DEN/CCl4 injection, which is consistent with a previous report [34]. In addition, the liver weight and liver weight relative to the body weight were increased by DEN/CCl4 treatment, which may have been due to neoplastic/dysplastic nodules, or hyperplasia and hypertrophy [35]. Pre- or post-treatment with bee honey improved the liver weight and relative liver weight of HCC rats.

During DEN/CCl4 exposure, hepatocytes release reactive oxygen species, which gradually free stress-specific enzymes into the blood, as demonstrated by marked increases of ALT, AST, LDH, bilirubin, and ALP, suggesting liver cell damage [36]. Our findings indicated that the hepatoprotective effects of bee honey on liver function biomarkers may have been due to honey containing organic therapeutic biomolecular agents including kaempferol, quercetin, chrysin, luteolin, apigenin, and vanillic acid, which are extremely beneficial I n the treatment of hepatic and biliary diseases [37]. Alpha fetoprotein (AFP) adjusts tumor growth and cell differentiation, through AFP receptors, and it has been shown to facilitate the proliferation of human hepatoma cells [38]. AFP level in the blood has been used as a diagnostic tool and considered to be a basic HCC marker [39]. In the present study, DEN/CCl4 injection increased AFP level, which is associated with the onset of HCC and is consistent with previous reports [40–44] describing an increase of AFP in DEN-treated rats. Our findings indicated that the treatment with honey caused a significant decrease of AFP in comparison with that of HCC-induced rats. This is in line with a previous report that revealed that honey alone or in combination with other anticancer medications significantly reduced AFP levels in rats relative to those in rats with DEN/CCl4-induced HCC [45]. The ameliorative impact of honey may be due to its anticancer activity, which may be attributable to the inhibition of DNA synthesis or a decrease in the levels of matrix metalloproteinases (MMP-2 and MMP-9), which are associated with angiogenesis, apoptosis, and cytotoxicity [46].

In the current study, DEN/CCl4 treatment caused an increase in MDA and decreases in catalase, SOD, and GPX levels when compared with the findings in controls. These changes are corroborated by previous findings [45] showing that DEN/CCl4 treatment resulted in oxidative stress due to an increase in MDA and a decrease in glutathione (GSH) content. MDA is widely used as an index of oxidative stress in patients suffering from liver injury [47]. Honey treatment was associated with a significant decline in the MDA level and increases in the levels of catalase, SOD, and GPx. These findings agree with a previous study [48] showing that the administration of honey to rats treated with lipopolysaccharide and CCl4 induced a decline of lipid peroxides with a significant increase in GPx activity.

Honey’s antioxidant properties are due to it containing glucose oxidase, catalase, ascorbic acid, carotenoid derivatives, organic acids, amino acids, and proteins [49]. This is apart from the phenolic material, which acts as a hydrogen donor in the scavenging of free radicals [50]. Phenolic compounds have a pro-oxidative effect, causing oxidative stress by enabling the development of hydrogen peroxide, conferring resistance against oxidative damage to cells. Therefore, honey’s hepatoprotective activity may be attributable to its antioxidative and/or pro-oxidative properties [51].

The modulatory effect of bee honey was confirmed by the histopathological findings, with the results here revealing that pretreatment with bee honey ameliorated the pathological changes that occurred upon DEN/CCl4 injection, and restored the status nearly to normal. In addition, post-treatment with bee honey improved the pathological changes induced by DEN/CCl4, which is consistent with the findings of Mohmed et al. [45], who reported that honey alone or in combination with cisplatin against DEN/CCl4 improved the cell architecture, which may have been due to antioxidant and antiproliferative effects of honey.

The inflammatory cytokines are crucial in the pathogenesis of liver injury, where the exposure to various stimulants such as in viral infection or toxin exposure produces a variety of cytokines [52], such as TNF-α [53], the interleukin family (IL-6, IL-1β) [54], and chemokines (e.g. VCAM-1, ICAM-1, and MCP-1) [55].

In the current investigation, DEN/CCl4 administration induced the significant upregulation of TNF-α gene expression. However, in the HCC-induced group treated with honey, there was significant downregulation of TNF-α gene expression. TNF-α inhibition and deletion reduced the tumor incidence in a rat model of DEN-induced HCC by promoting apoptosis and decreasing hepatocyte proliferation, indicating that TNF-α upregulation promotes tumor growth and poor prognosis in HCC [56]. Therefore, one of the molecular aspects of the hepatoprotective effects of honey is anti-proliferative activity via the downregulation of TNF-α gene expression.

ICAM-1 is involved in numerous phases of the metastatic process [57, 58]. VCAM-1 and ICAM-1 exhibit upregulated expression in the liver throughout metastatic invasion [59]. Based on these previous observations, our results revealed that honey treatment inhibits the metastatic activity of hepatic cancer cells through downregulating the increased VCAM-1 and ICAM-1 gene expression levels in DEN-induced HCC.

TGF is linked to a better prognosis in the early stages of liver cancer, but higher tumor invasiveness and heterogeneity in advanced stages, suggesting that TGF initially suppresses liver cancer, but can later aggravate its malignancy via its pro-oncogenic activity [60]. Our study revealed that HCC-induced rats exhibited significant upregulation of TGF-β gene expression. However, in the HCC-induced group treated with honey, there was significant downregulation of TGF-β gene expression. Therefore, the antifibrotic effect of honey through the downregulation of TGF-β is one of the mechanisms underlying its hepatoprotective effects.

Caspase-3 is the chief executioner of apoptosis, being responsible either partly or completely for the proteolytic cleavage of many key proteins [61]. In the current study, in the group with DEN/CCl4-induced HCC, significant downregulation of caspase-3 was observed. This is in line with a previous study [62] in which it was reported that caspase-3 expression was lowered in HCC. The administration of honey in the groups with HCC induction attenuated HCC via the initiation of caspase-mediated apoptotic signals.

Many surface molecules, such as glypican-3 (GPC3), are highly expressed on the surface of HCC cells [63]. GPC3 is highly correlated with the development of HCC. It is used not only for diagnosis, but also as a significant target of HCC immunotherapy [64]. Our results revealed the overexpression of GPC3 in the HCC-induced group compared with the level in controls. In addition, it was previously reported [65] that the serum level of GPC-3 was increased in NDEN-treated rats. Meanwhile, the administration of honey to HCC-induced rats decreased the overexpression of GPC3 when compared with that in the untreated HCC group.

In the current study, DEN/CCl4 administration induced Trx1 and Grx gene overexpression, which is inconsistent with a previous report [66]. The upregulation of Trx1 can result in an increment in the expression of vascular endothelial growth factor-A, as well as increases of tumor cell proliferation and angiogenesis [67, 68]. Grx1 plays a vital role in the defense against TNF-α-induced apoptosis [69], cell differentiation [70], and the regulation of nuclear factor-kappa B, which has an anti-apoptotic function in most cell types [71, 72]. However, the administration of honey in the HCC-induced group downregulated Trx and Grx expression, blocking the cascade dependent on their activation.

Overall, honey has promising hepatoprotective effects. However, its prophylactic administration before the induction of HCC is more effective than its therapeutic dosing after the induction of HCC.

Conclusion

Honey administration either before or after HCC induction had preventive effects in the treatment of HCC. This may be due to honey’s antioxidant property, which suppressed the expression of TNF-α, ICAM-1, VCAM-1, TGF-β1, GP3, Trx-1, and Grx with the upregulation of caspase-3. These results suggest the underlying molecular mechanisms of honey’s modulatory effect in reversing DEN/CCl4-induced HCC rats, through the activation of caspase-3 and the inhibition of Grx-mediated apoptosis. Another underlying mechanism is the inhibition of tumor development, proliferation, and metastasis through downregulating TNF-α, ICAM-1, VCAM-1, TGF-β1, GP3, and Trx-1.

Acknowledgments

The authors are grateful for Taif University’s financial assistance via the Taif University Researchers’ Support Project (TURSP-2020/09), Taif, Saudi Arabia. The experiment was carried out at the Faculty of Veterinary Medicine, Kafrelsheikh University, Egypt.

Contributor Information

Tarek Kamal Abouzed, Biochemistry Department, Faculty of Veterinary Medicine, Kafrelsheikh University, Kafrelsheikh, Egypt.

Ehab B Eldomany, Department of Biotechnology and Life Sciences, Faculty of Postgraduate Studies for Advanced Sciences, Beni-suef University, Beni-suef, Egypt.

Shymaa A Khatab, Genetics and Genetic Engineering Department of Animal Husbandry and Animal Wealth Development, Faculty of Veterinary Medicine, Alexandria University, Alexandria, Egypt.

Adil Aldhahrani, Clinical Laboratory Sciences Department, Turabah University College, Taif University, P.O. Box 11099, Taif 21944, Saudi Arabia.

Wael M Gouda, Department of Pathology, Faculty of Veterinary Medicine, Damanhur University, Damanhur, Egypt.

Ahmed M Elgazzar, Department of Veterinary Forensic Medicine and Toxicology, Faculty of Veterinary Medicine, Alexandria University, Alexandria, Egypt.

Mohamed Mohamed Soliman, Clinical Laboratory Sciences Department, Turabah University College, Taif University, P.O. Box 11099, Taif 21944, Saudi Arabia.

Mohmed Atef Kassab, Department of Cytology and Histology, Faculty of Veterinary Medicine, Kafr-Elsheikh University, Kafr-Elsheikh, Egypt.

Samir Ahmed El-Shazly, Biochemistry Department, Faculty of Veterinary Medicine, Kafrelsheikh University, Kafrelsheikh, Egypt.

Fayez Althobaiti, Biotechnology Department, College of Science, Taif University, Taif 21995, Saudi Arabia.

Doaa Abdallha Dorghamm, Biochemistry Department, Faculty of Veterinary Medicine, Kafrelsheikh University, Kafrelsheikh, Egypt.

Data Availability

Data are available upon request.

Funding

This study was supported in part by the Taif University Researchers Supporting Project (TURSP-2020/09), Taif University, Taif, Saudi Arabia.

Conflict of interest statement

The authors declare that there are no conflict of interest associated with this work.

Ethical Statement

All experimental procedures were carried out under the National Institutes of Health Guidelines for the Care and Use of Laboratory Animals. All procedures were performed and designed to alleviate the suffering of the experimental animals.

References

  • 1. Rawla, P., Sunkara  T., Muralidharan  P., Raj  J.P., Update in global trends and aetiology of hepatocellular carcinoma. Contemp Oncol, 2018. 22(3): p. 141–150. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2. Yang, J.D., Hainaut  P., Gores  G.J., Amadou  A., Plymoth  A., Roberts  L.R., A global view of hepatocellular carcinoma: trends, risk, prevention and management. Nat Rev Gastroenterol Hepatol, 2019. 16(10): p. 589–604. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3. Kohli, A., The relationship between hepatocellular carcinoma and hepatitis B and C virus. Gastroenterology & hepatology, 2016. 12(2): p. 116–118. [PMC free article] [PubMed] [Google Scholar]
  • 4. Rashed, W.M., Kandeil  M.A.M., Mahmoud  M.O., Ezzat  S., Hepatocellular carcinoma (HCC) in Egypt: A comprehensive overview. Journal of the Egyptian National Cancer Institute, 2020. 32(1): p. 1–11  5. [DOI] [PubMed] [Google Scholar]
  • 5. ALEEM  E., ELSHAYEB  A., ELHABACHI  N., MANSOUR  A.R., GOWILY  A., HELA  A., Serum IGFBP-3 is a more effective predictor than IGF-1 and IGF-2 for the development of hepatocellular carcinoma in patients with chronic HCV infection. Oncol Lett, 2012. 3(3): p. 704–712. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6. Subramanian, P., Mirunalini  S., Dakshayani  K.B., Pandi-Perumal  S.R., Trakht  I., Cardinali  D.P., Prevention by melatonin of hepatocarcinogenesis in rats injected with N-nitrosodiethylamine. J Pineal Res, 2007. 43(3): p. 305–12. [DOI] [PubMed] [Google Scholar]
  • 7. Park, D.H., Shin  J.W., Park  S.K., Seo  J.N., Li  L., Jang  J.J., Lee  M.J., Diethylnitrosamine (DEN) induces irreversible hepatocellular carcinogenesis through overexpression of G1/S-phase regulatory proteins in rat. Toxicol Lett, 2009. 191(2–3): p. 321–6. [DOI] [PubMed] [Google Scholar]
  • 8. Amin, A., Hamza  A.A., Bajbouj  K., Ashraf  S.S., Daoud  S., Saffron: a potential candidate for a novel anticancer drug against hepatocellular carcinoma. Hepatology, 2011. 54(3): p. 857–67. [DOI] [PubMed] [Google Scholar]
  • 9. Chang  W, He  W, Li  PP  et al.  Protective effects of Celastrol on diethylnitrosamine-induced hepatocellular carcinoma in rats and its mechanisms. Eur J Pharmacol  2016;784:173–80. [DOI] [PubMed] [Google Scholar]
  • 10. Uehara, T., I.P.  Pogribny, and I.  Rusyn, The DEN and CCl4-induced mouse model of fibrosis and inflammation-associated hepatocellular carcinoma. Current protocols in pharmacology, 2014. 66(1): p. 14.30. 1-14.30. 10. https://pubmed.ncbi.nlm.nih.gov/25181010/. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Moreira, D.D.L., Teixeira  S.S., Monteiro  M.H.D., de-Oliveira  A.C.A.X., Paumgartten  F.J.R.., Traditional use and safety of herbal medicines. Rev Bras, 2014. 24(2): p. 248–257. [Google Scholar]
  • 12. Sakurai, T., Maeda  S., Chang  L., Karin  M., Loss of hepatic NF-kappa B activity enhances chemical hepatocarcinogenesis through sustained c-Jun N-terminal kinase 1 activation. Proc Natl Acad Sci U S A, 2006. 103(28): p. 10544–51. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Raguz, S. and E.  Yagüe, Resistance to chemotherapy: new treatments and novel insights into an old problem. Br J Cancer, 2008. 99(3): p. 387–391. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Tabone, M. and R.  Pellicano, Prevention of intrahepatic hepatocarcinoma recurrence in patients with viral cirrhosis: two potential options. Minerva Gastroenterol Dietol, 2006. 52(1): p. 47–52. [PubMed] [Google Scholar]
  • 15. Cha  CH, Saif  MW, and e.a. Yamane  BH, Hepatocellular carcinoma: current management. Curr Probl Surg  2010. 47((1)): p. 10–67. [DOI] [PubMed] [Google Scholar]
  • 16. Ranneh, Y., Akim  A.M., Hamid  H.A., Khazaai  H., Fadel  A., Zakaria  Z.A., Albujja  M., Bakar  M.F.A., Honey and its nutritional and anti-inflammatory value. BMC complementary medicine and therapies, 2021. 21(1): p. 1–17  30. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Erejuwa, O.O., S.A.  Sulaiman, and M.S.A.  Wahab, Effects of honey and its mechanisms of action on the development and progression of cancer. Molecules, 2014. 19(2): p. 2497–2522. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. Johnston, J.E., Sepe  H.A., Miano  C.L., Brannan  R.G., Alderton  A.L., Honey inhibits lipid oxidation in ready-to-eat ground beef patties. Meat Sci, 2005. 70(4): p. 627–31. [DOI] [PubMed] [Google Scholar]
  • 19. El-Kott  AF, A  AK, El-Aziz  SFA, Ribea  HM. Anti-tumor effects of bee honey on PCNA and P53 expression in the rat hepatocarcinogenesis. Int J Cancer Res  2012;8:130–9. [Google Scholar]
  • 20. Abass  SA, Abdel-Hamid  NM, Abouzed  TK, el-Shishtawy  MM. Chemosensitizing effect of Alpinia officinarum rhizome extract in cisplatin-treated rats with hepatocellular carcinoma. Biomed Pharmacother  2018;101:710–8. [DOI] [PubMed] [Google Scholar]
  • 21. Elaidy, S.M., A.  Moghazy, and M.K.  El-Kherbetawy, Evaluation of the therapeutic effects of Polyvinylpyrrolidone-capped silver nanoparticles on the Diethylnitrosamine/carbon tetrachloride-induced hepatocellular carcinoma in rats. Egyptian Journal of Basic and Clinical Pharmacology, 2017. 7(2): p. 9–24. [Google Scholar]
  • 22. Chatterjee  T. Handbook of laboratory Mice and Rats. Kolkata, India: Department of Pharmaceutical Technology, Jadavpur University, 1993, 157. [Google Scholar]
  • 23. Reitman, S. and S.  Frankel, A colorimetric method for the determination of serum glutamic oxalacetic and glutamic pyruvic transaminases. Am J Clin Pathol, 1957. 28(1): p. 56–63. [DOI] [PubMed] [Google Scholar]
  • 24. Belfield  A, Goldberg  DM. D.G., colorimetric determination of alkaline phosphatase activity. Enzyme  1971;12:561–6. [DOI] [PubMed] [Google Scholar]
  • 25. Szasz, G., New substrates for measuring gamma-glutamyl transpeptidase activity. Z Klin Chem Klin Biochem, 1974. 12(5): p. 228. [PubMed] [Google Scholar]
  • 26. Cattini, R., Cooksey  M., Robinson  D., Brett  G., Bacarese-Hamilton  T., Jolley  N., Measurement of α-Fetoprotein, Carcinoembryonic Antigen and Prostate-Speciflc Antigen in Serum and Heparinised Plasma by Enzyme Immunoassay on the Fully Automated Serono SR1™ Analyzer. 1993.  31  8. https://pubmed.ncbi.nlm.nih.gov/7692986/. [DOI] [PubMed] [Google Scholar]
  • 27. Ohkawa, H., N.  Ohishi, and K.  Yagi, Assay for lipid peroxides in animal tissues by thiobarbituric acid reaction. Anal Biochem, 1979. 95(2): p. 351–8. https://pubmed.ncbi.nlm.nih.gov/36810/. [DOI] [PubMed] [Google Scholar]
  • 28. Aebi  H. Catalase in vitro. Methods Enzymol  1984;105:121–6. [DOI] [PubMed] [Google Scholar]
  • 29. Nishikimi, M., N.A.  Rao, and K.  Yagi, The occurrence of superoxide anion in the reaction of reduced phenazine methosulfate and molecular oxygen. Biochem Biophys Res Commun, 1972. 46(2): p. 849–854. [DOI] [PubMed] [Google Scholar]
  • 30. Paglia, D.E. and W.N.  Valentine, Studies on the quantitative and qualitative characterization of erythrocyte glutathione peroxidase. J Lab Clin Med, 1967. 70(1): p. 158–69. [PubMed] [Google Scholar]
  • 31. Bancroft  J, Layton  C, Suvarna  S. Bancroft’s Theory and Practice of Histological Techniques, 7th (edn) edn. NY, USA: Churchill Livingstone, 2013. [Google Scholar]
  • 32. Rzepecka-Stojko, A., Stojko  J., Kurek-Górecka  A., Górecki  M., Kabała-Dzik  A., Kubina  R., Moździerz  A., Buszman  E., Polyphenols from bee pollen: structure ,  Mol Ther. 2015. 20: p. 21732–21749  12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33. Ha, W.S., Kim  C.K., Song  S.H., Kang  C.B., Study on mechanism of multistep hepatotumorigenesis in rat: development of hepatotumorigenesis. J Vet Sci, 2001. 2(1):p. 53–58. [PubMed] [Google Scholar]
  • 34. El-kott, A.F. and A.A.  Kandeel, Anti-tumor effects of bee honey on PCNA and P53. International Journal of Cancer Research, 2012. 8(4): p. 130–139. [Google Scholar]
  • 35. Aly  SM, Fetaih  HA, Hassanin  AAI  et al.  Protective effects of garlic and cinnamon oils on hepatocellular carcinoma in albino rats. Anal Cell Pathol  2019;2019:1–. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36. Chinelo, N. and N.O.  Uzoma, Effect of methanol extract of Synsepalum dulcificum pulp on some biochemical parameters in albino rats. Journal of Coastal Life Medicine, 2015. 3(3): p. 233–240. [Google Scholar]
  • 37. Hassan, A.I. and M.  Bayoumi, Efficiency of camel milk and honey bee in alleviation of diabetes in rats. Nature and Science, 2010. 8(10): p. 333–341. [Google Scholar]
  • 38. Glory, M.D. and D.  Thiruvengadam, Potential chemopreventive role of chrysin against N-nitrosodiethylamine-induced hepatocellular carcinoma in rats. Biomedicine & Preventive Nutrition, 2012. 2(2): p. 106–112. [Google Scholar]
  • 39. Sell, S., Alpha-fetoprotein, stem cells and cancer: how study of the production of alpha-fetoprotein during chemical hepatocarcinogenesis led to reaffirmation of the stem cell theory of cancer. Tumor Biol, 2008. 29(3): p. 161–180. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40. Liu, J.-G., Zhao  H.J., Liu  Y.J., Liu  Y.W., Wang  X.L., Effect of two selenium sources on hepatocarcinogenesis and several angiogenic cytokines in diethylnitrosamine-induced hepatocarcinoma rats. J Trace Elem Med Biol, 2012. 26(4): p. 255–261. [DOI] [PubMed] [Google Scholar]
  • 41. Song, Y., Jin  S.J., Cui  L.H., Ji  X.J., Yang  F.G., Immunomodulatory effect of Stichopus japonicus acid mucopolysaccharide on experimental hepatocellular carcinoma in rats. Molecules, 2013. 18(6): p. 7179–7193. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42. Kadasa, N.M., Abdallah  H., Afifi  M., Gowayed  S., Hepatoprotective effects of curcumin against diethyl nitrosamine induced hepatotoxicity in albino rats. Asian Pac J Cancer Prev, 2015. 16(1): p. 103–108. [DOI] [PubMed] [Google Scholar]
  • 43. Zhang, Q., J.  Yang, and J.  Wang, Modulatory effect of luteolin on redox homeostasis and inflammatory cytokines in a mouse model of liver cancer. Oncol Lett, 2016. 12(6): p. 4767–4772. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44. Perumal, S., Langeshwaran  K., Selvaraj  J., Ponnulakshmi  R., Shyamaladevi  B., Balasubramanian  M.P., Effect of diosmin on apoptotic signaling molecules in N-nitrosodiethylamine-induced hepatocellular carcinoma in experimental rats. Mol Cell Biochem, 2018. 449(1–2): p. 27–37. [DOI] [PubMed] [Google Scholar]
  • 45. Zayed Mohamed  N, Aly  HF, moneim el-Mezayen  HA, el-Salamony  HE. Effect of co-administration of bee honey and some chemotherapeutic drugs on dissemination of hepatocellular carcinoma in rats. Toxicol Rep  2019;6:875–88. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46. Samarghandian, S. and F.  Samini, Antiproliferative and cytotoxic properties of honey in human prostate cancer cell line (PC-3): possible mechanism of cell growth inhibition and apoptosis induction. Afr J Pharm Pharmacol, 2014. 8(1): p. 9–15. [Google Scholar]
  • 47. Baltacıoğlu, E., Yuva  P., Aydın  G., Alver  A., Kahraman  C., Karabulut  E., Akalın  F.A., Lipid peroxidation levels and total oxidant/antioxidant status in serum and saliva from patients with chronic and aggressive periodontitis. Oxidative stress index: a new biomarker for periodontal disease?  J Periodontol, 2014. 85(10): p. 1432–1441. [DOI] [PubMed] [Google Scholar]
  • 48. Meligi, N.M., S.A.  Ismail, and N.S.  Tawfik, Protective effects of honey and bee venom against lipopolysaccharide and carbon tetrachloride-induced hepatoxicity and lipid peroxidation in rats. Toxicology Research, 2020. 9(5): p. 693–705. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49. Pérez, R.A., Iglesias  M.T., Pueyo  E., González  M., de Lorenzo  C., Amino acid composition and antioxidant capacity of Spanish honeys. J Agric Food Chem, 2007. 55(2): p. 360–365. [DOI] [PubMed] [Google Scholar]
  • 50. Gülcin, I., Antioxidant activity of food constituents: an overview. Arch Toxicol, 2012. 86(3): p. 345–391. [DOI] [PubMed] [Google Scholar]
  • 51. Wang, Y., Li  D., Cheng  N., Gao  H., Xue  X., Cao  W., Sun  L., Antioxidant and hepatoprotective activity of vitex honey against paracetamol induced liver damage in mice. Food Funct, 2015. 6(7): p. 2339–2349. [DOI] [PubMed] [Google Scholar]
  • 52. Guo  Y, Zhao  Q, Cao  L, Zhao  B. Hepatoprotective effect of Gan Kang Yuan against chronic liver injury induced by alcohol. J Ethnopharmacol  2017;208:1–7. [DOI] [PubMed] [Google Scholar]
  • 53. Huang, B.-P., Lin  C.S., Wang  C.J., Kao  S.H., Upregulation of heat shock protein 70 and the differential protein expression induced by tumor necrosis factor-alpha enhances migration and inhibits apoptosis of hepatocellular carcinoma cell HepG2. Int J Med Sci, 2017. 14(3): p. 284–293. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54. Zhang, J., Zhang  Q., Lou  Y., Fu  Q., Chen  Q., Wei  T., Yang  J., Tang  J., Wang  J., Chen  Y., Zhang  X., Zhang  J., Bai  X., Liang  T., Hypoxia-inducible factor-1α/interleukin-1β signaling enhances hepatoma epithelial–mesenchymal transition through macrophages in a hypoxic-inflammatory microenvironment. Hepatology, 2018. 67(5): p. 1872–1889. [DOI] [PubMed] [Google Scholar]
  • 55. Bayo, J., Real  A., Fiore  E.J., Malvicini  M., Sganga  L., Bolontrade  M., Andriani  O., Bizama  C., Fresno  C., Podhajcer  O., Fernandez  E., Gidekel  M., Mazzolini  G.D., García  M.G., IL-8, GRO and MCP-1 produced by hepatocellular carcinoma microenvironment determine the migratory capacity of human bone marrow-derived mesenchymal stromal cells without affecting tumor aggressiveness. Oncotarget, 2017. 8(46): p. 80235–80248. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56. Jing  Y, Sun  K, Liu  W  et al.  Tumor necrosis factor-α promotes hepatocellular carcinogenesis through the activation of hepatic progenitor cells. Cancer Lett  2018;434:22–32. [DOI] [PubMed] [Google Scholar]
  • 57. Rahn, J.J., Chow  J.W., Horne  G.J., Mah  B.K., Emerman  J.T., Hoffman  P., Hugh  J.C., MUC1 mediates transendothelial migration in vitro by ligating endothelial cell ICAM-1. Clinical & experimental metastasis, 2005. 22(6): p. 475–483. [DOI] [PubMed] [Google Scholar]
  • 58. Laurent, V.M., Duperray  A., Sundar Rajan  V., Verdier  C., Atomic force microscopy reveals a role for endothelial cell ICAM-1 expression in bladder cancer cell adherence. PLoS One, 2014. 9(5): p. e98034  e98034. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59. Khatib, A.-M., Auguste  P., Fallavollita  L., Wang  N., Samani  A., Kontogiannea  M., Meterissian  S., Brodt  P., Characterization of the host proinflammatory response to tumor cells during the initial stages of liver metastasis. Am J Pathol, 2005. 167(3): p. 749–759. 10.1016/S0002-9440(10)62048-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60. Chen, J., Zaidi  S., Rao  S., Chen  J.S., Phan  L., Farci  P., Su  X., Shetty  K., White  J., Zamboni  F., Wu  X., Rashid  A., Pattabiraman  N., Mazumder  R., Horvath  A., Wu  R.C., Li  S., Xiao  C., Deng  C.X., Wheeler  D.A., Mishra  B., Akbani  R., Mishra  L., Analysis of genomes and transcriptomes of hepatocellular carcinomas identifies mutations and gene expression changes in the transforming growth factor-β pathway. Gastroenterology, 2018. 154(1): p. 195–210. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61. Yuan  J, Horvitz  HR. A first insight into the molecular mechanisms of apoptosis. Cell  2004;116:S53–6. [DOI] [PubMed] [Google Scholar]
  • 62. Maurya  V, Kumar  P, Chakraborti  S  et al.  Zolmitriptan attenuates hepatocellular carcinoma via activation of caspase mediated apoptosis. Chem Biol Interact  2019;308:120–9. [DOI] [PubMed] [Google Scholar]
  • 63. Sun  B, Huang  Z, Wang  B  et al.  Significance of glypican-3 (GPC3) expression in hepatocellular cancer diagnosis. Medical science monitor: international medical journal of experimental and clinical research  2017;23:850–5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 64. Guo, M., Zhang  H., Zheng  J., Liu  Y., Glypican-3: a new target for diagnosis and treatment of hepatocellular carcinoma. J Cancer, 2020. 11  8: p. 2008–2021. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 65. Aglan, H.A., Ahmed  H.H., el-Toumy  S.A., Mahmoud  N.S., Gallic acid against hepatocellular carcinoma: an integrated scheme of the potential mechanisms of action from in vivo study. Tumor Biol, 2017. 39(6): p. 1010428317699127. [DOI] [PubMed] [Google Scholar]
  • 66. Abdel-Hamid, N.M., Mahmoud  T.K., Abass  S.A., el-Shishtawy  M.M., Expression of thioredoxin and glutaredoxin in experimental hepatocellular carcinoma—relevance for prognostic and diagnostic evaluation. Pathophysiology, 2018. 25(4): p. 433–438. 10.1016/j.pathophys.2018.08.008. [DOI] [PubMed] [Google Scholar]
  • 67. Hashemy  SI. The human thioredoxin system: modifications and clinical applications. 2011.Hashemy  SI, The human thioredoxin system: modifications and clinical applications. 2011.
  • 68. Reichl, P. and W.  Mikulits, Accuracy of novel diagnostic biomarkers for hepatocellular carcinoma: an update for clinicians. Oncol Rep, 2016. 36(2): p. 613–625. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 69. Kim, S., Millet  I., Kim  H.S., Kim  J.Y., Han  M.S., Lee  M.K., Kim  K.W., Sherwin  R.S., Karin  M., Lee  M.S., NF-κB prevents β cell death and autoimmune diabetes in NOD mice. Proc Natl Acad Sci, 2007. 104(6): p. 1913–1918. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 70. Takashima, Y., Hirota  K., Nakamura  H., Nakamura  T., Akiyama  K., Cheng  F.S., Maeda  M., Yodoi  J., Differential expression of glutaredoxin and thioredoxin during monocytic differentiation. Immunol Lett, 1999. 68(2–3): p. 397–401. [DOI] [PubMed] [Google Scholar]
  • 71. K.  Hirota, M.  Matsui, M.  Murata, Y.  Takashima, F.S.  Cheng, T.  Itoh, K.  Fukuda, Y.  Junji, Nucleoredoxin, glutaredoxin, and thioredoxin differentially regulateNF-kappaB, AP-1, and CREB activation in HEK293 cells ,.  Biochem Biophys Res Commun, 2000.  274 p. 177–182  1. [DOI] [PubMed] [Google Scholar]
  • 72. Daily, D., Vlamis-Gardikas  A., Offen  D., Mittelman  L., Melamed  E., Holmgren  A., Barzilai  A., Glutaredoxin protects cerebellar granule neurons from dopamine-induced apoptosis by activating NF-κB via Ref-1. J Biol Chem, 2001. 276(2): p. 1335–1344. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

Data are available upon request.

Articles from Toxicology Research are provided here courtesy of Oxford University Press

RESOURCES