Abstract
Extended-spectrum-β-lactamase (ESBL) and AmpC β-lactamase are two enzymes commonly found in Enterobacteriaceae that confer resistance to major antibiotics, such as third-generation cephalosporins that are widely prescribed for both human and animals. We screened for Escherichia coli producing ESBL and plasmid-mediated AmpC β-lactamase (pAmpC) from dogs and cats brought to National Taiwan University Veterinary Hospital, Taipei, Taiwan from 29 June 2020, to 31 December 2020. The genotypes and phylogenetic relatedness of these E. coli were also analyzed. Fifty samples of E. coli obtained from 249 bacterial isolates were included in this study. Among them, eight isolates had ESBL, seven had pAmpC, and one had both. Thirty-two percent (16/50) of E. coli isolates were resistant to third-generation cephalosporins. The detected ESBL genes included the blaCTX-M-1 and blaCTX-M-9 groups, and the blaCMY-2 group was the only gene type found in pAmpC. ESBL-producing E. coli belonged to the pathogenic phylogroup B2, and the sequence types (STs) were ST131 and ST1193. Three isolates were determined to be ST131-O25b, a highly virulent epidemic clone. The pAmpC-producing E. coli were distributed in multiple phylogroups, primarily the commensal phylogroup B1. The STs of the pAmpC-producing E. coli included ST155, ST315, ST617, ST457, ST767, ST372, and ST93; all of these have been reported in humans and animals. Imipenem was active against all the ESBL/pAmpC-producing E. coli; however, since in humans it is a last-resort antimicrobial, its use in companion animals should be restricted.
Keywords: extended-spectrum-β-lactamase, plasmid-mediated AmpC, Escherichia coli, companion animals
1. Introduction
Antimicrobial resistance (AMR) is a worldwide public health crisis that prevents practitioners, either from medicine or veterinary medicine, from successfully treating bacterial infections [1]. Members of the Enterobacteriaceae family, such as Escherichia coli, are responsible for most of the common infections in hospitals or communities [2]. β-lactamases are the most prominent enzymes in Gram-negative bacteria, and within the β-lactamase class, extended-spectrum-β-lactamases (ESBLs), AmpC (also termed class C) β-lactamases, and carbapenemases are currently widespread. These enzymes allow bacteria to resist the major therapeutic regimes available in clinical settings that rely on beta-lactams. Third-generation cephalosporins are broad-spectrum-β-lactam antimicrobials that are widely prescribed to both humans and animals to treat serious infections [3]. Because third-generation cephalosporins are essential treatments for many bacterial infections for which resistance is a major concern, this type of antimicrobial agents has been classified as “critically important” for human health [3].
Resistance to third-generation cephalosporins is often mediated by extended-spectrum-β-lactamase (ESBL) and AmpC β-lactamase. ESBLs are a group of enzymes derived from point mutations of β-lactamase. ESBLs confer resistance to most β-lactam antibiotics, including extended-spectrum cephalosporins and monobactams; ESBLs are, however, susceptible to carbapenems and cephamycins and are inhibited by clavulanic acid, sulbactam, and tazobactam [4]. AmpC β-lactamase is chromosomally mediated and present in various microorganisms [5]. The ampC gene in E. coli is normally expressed at a low level [6]. Papanicolaou et al. first demonstrated that AmpC β-lactamase was captured on a plasmid [7], and subsequently, plasmid-mediated AmpC β-lactamase (pAmpC) disseminated worldwide [5].
This study was conducted at National Taiwan University Veterinary Hospital (NTUVH), a teaching hospital affiliated with the College of Bioresources and Agriculture at National Taiwan University located in Taipei, Taiwan. The objective of this study was to screen for E. coli in the dogs and cats that visited NTUVH 29 June 2020, to 31 December 2020, examine their resistance to third-generation cephalosporins, and investigate the resistant gene profile of and connection among these isolates. The results provide valuable public health information.
2. Results
2.1. Occurrence of the ESBL/pAmpC-Producing E. coli and Their bla Genotypes
The 50 E. coli isolates obtained from this study (dog: n = 41, cat: n = 9) were initially screened using CHROMagar ESBL, after which the ESBL-producing E. coli were identified through the phenotypic confirmatory test. Nine E. coli isolates (dog: n = 6, cat: n = 3) that contained ESBL genes were discovered, one of which (from dogs) possessed both ESBL and pAmpC genes. Seven E. coli isolates contained only pAmpC genes. The bla genes that were identified included the blaCTX-M-1, blaCTX-M-9, and blaTEM groups. The blaCTX-M-1 group contained blaCTX-M-55 (n = 2), blaCTX-M-238 (n = 2), blaCTX-M-211, and blaCTX-M-199. blaCTX-M-235 was the only type detected in the blaCTX-M-9 group. The blaTEM group included blaTEM-215 (n = 4) and blaTEM-243 (n = 1). No blaCTX-M-2, blaCTX-M-8, blaCTX-M-25, or blaSHV groups were found. Within the pAmpC gene groups, only the blaCMY-171 type of the blaCMY-2 group was detected (Table 1).
Table 1.
Case No. | Species | Source | Phylogroup | ST Type | bla Genes |
---|---|---|---|---|---|
001 | cat | urine | B2 | ST131 | blaTEM-215 + blaCTX-M-235 (ESBL) |
002 | dog | urine | A | ST93 | blaCTX-M-55 + blaCMY-171 (ESBL + pAmpC) |
004 | cat | ascites | B2 | ST131 | blaCTX-M-235 (ESBL) |
008 | dog | urine | B1 | ST155 | blaCMY-171 (pAmpC) |
010 | dog | urine | D | ST315 | blaCMY-171 (pAmpC) |
011 | cat | urine | B2 | ST131 | blaTEM-215 + blaCTX-M-55 + blaCTX-M-235 (ESBL) |
025 | dog | nasal discharge | B1 | ST767 | blaTEM-243 + blaCMY-171 (pAmpC) |
031 | dog | urine | B2 | ST131 | blaTEM-215 + blaCTX-M-211 + blaCTX-M-235 (ESBL) |
032 | cat | pus | C | ST617 | blaCMY-171 (pAmpC) |
034 | dog | urine | B2 | ST131 | blaCTX-M-238 (ESBL) |
038 | dog | urine | F | ST457 | blaCMY-171 (pAmpC) |
040 | dog | urine | B2 | ST131 | blaCTX-M-235 (ESBL) |
042 | dog | urine | B2 | ST131 | blaCTX-M-238 (ESBL) |
049 | dog | nasal discharge | B1 | ST767 | blaCMY-171 (pAmpC) |
050 | dog | oral mass | B2 | ST1193 | blaTEM-215 + blaCTX-M-199 (ESBL) |
051 | dog | urine | B2 | ST372 | blaCMY-171 (pAmpC) |
2.2. Phylogenetic Grouping, Genotyping, and Phylogenetic Analysis
B2 (n = 9) was the most common phylogroup, followed by B1 (n = 3). A, C, D, and F were detected once, and E and clade I were not detected. MLST identified nine STs among 16 ESBL- and/or pAmpC-producing E. coli, with ST131 being the most predominant ST (n = 7). ST767 was found in two E. coli isolates, and the other STs were encountered once (Table 1). Figure 1 demonstrates the minimal spanning tree of the 16 ESBL- and/or pAmpC-producing E. coli STs or phylogroups, according to the degree of allele sharing.
2.3. E. coli ST131 O25b Detection
Case numbers 004, 034, and 042 of the 7 ST131 ESBL-producing E. coli isolates tested positive for O25b clones, with both trpA and pabB PCR products observed on an agarose gel (Figure S1 in Supplementary Materials).
2.4. Conjugation Test
For the E. coli that only contained the pAmpC gene, a transfer of the blaCMY-171 gene to the recipient E. coli J53 strain was observed for five of six isolates by conjugation. The 049 strain did not transfer blaCMY-171 to the recipient strain. The 025 strain possessed both blaTEM-243 and blaCMY-171 and only transferred blaCMY-171 to the E. coli J53 strain. For the eight E. coli strains that possessed only ESBL genes, seven isolates could transfer all the ESBL genes to the E. coli J53 strain; however, only two of the three bla genes were transferred to the recipient E. coli by the 011 E. coli strain (Table 2). Figure S2 in Supplementary Materials demonstrates that the bla genes can be detected from the donor E. coli 031 strain and the transconjugant strain, but they cannot be detected in the recipient E. coli J53 strain.
Table 2.
Case No. | bla Genes in the Donor Strain | bla Genes in the Transconjugant Strain |
---|---|---|
001 | blaTEM-215, blaCTX-M-235 | blaTEM-215, blaCTX-M-235 |
002 | blaCTX-M-55, blaCMY-171 | blaCTX-M-55, blaCMY-171 |
004 | bla CTX-M-235 | bla CTX-M-235 |
008 | bla CMY-171 | bla CMY-171 |
010 | bla CMY-171 | bla CMY-171 |
011 | blaTEM-215, blaCTX-M-55, blaCTX-M-235 | blaTEM-215, blaCTX-M-235 |
025 | blaTEM-243, blaCMY-171 | bla CMY-171 |
031 | blaTEM-215, blaCTX-M-211, blaCTX-M-235 | blaTEM-215, blaCTX-M-211, blaCTX-M-235 |
032 | bla CMY-171 | bla CMY-171 |
034 | bla CTX-M-238 | bla CTX-M-238 |
038 | bla CMY-171 | bla CMY-171 |
040 | bla CTX-M-235 | bla CTX-M-235 |
042 | bla CTX-M-238 | bla CTX-M-238 |
049 | bla CMY-171 | -- † |
050 | blaTEM-215, blaCTX-M-199 | blaTEM-215, blaCTX-M-199 |
051 | bla CMY-171 | bla CMY-171 |
†: not detected.
2.5. Antimicrobial Susceptibility Test
The results of the resistant rate of the 50 E. coli isolates to the specified antimicrobials are presented in Figure 2. The breakpoints and the details can be found in Supplementary Table (Tables S1 and S2). The E. coli isolates that carried the ESBL genes, pAmpC genes, or both all exhibited a more frequently multidrug-resistant phenotype than those that possessed neither gene. The E. coli isolates that possessed neither ESBL nor pAmpC were susceptible to ceftiofur and imipenem, and all of the E. coli isolates were susceptible to imipenem.
3. Discussion
Overall, 18% (9/50) of the E. coli assayed contained ESBLs, which was close to the percentage we previously reported (22.8%) [8]. We did not observe significant variations in the prevalence of ESBL-producing E. coli in companion animals in the same vicinity over time. Recently, Salgado-Caxito et al. reached the same conclusion through a scoping review and meta-analysis [9]. Although the prevalence did not fluctuate greatly over time, our data exhibited a higher rate than the average rate (6.87% in dogs and 5.04% in cats) reported from other continents, which could have resulted from our use of a dissimilar study design or methodology [9,10]. Additionally, NTUVH is a university-based teaching hospital and a major referral hospital for local clinics in Taipei. Therefore, previous antibiotic treatments prescribed to ailing dogs and cats before their admittance to NTUVH could also have contributed to a higher prevalence of ESBL-producing E. coli. In Asia, similar studies have revealed that the prevalence rates of ESBL-producing E. coli from companion animals in China and Japan were 24.5% and 28%, respectively [11,12]. In a study conducted in Pakistan, 15.3% of Enterobacteriaceae in companion animals were noted to be ESBL producing [13]. A high prevalence of ESBL-producing E. coli in Asian countries warrants concern. Socioeconomic and behavioral factors and veterinarians’ use of various levels of antibiotics may contribute to the disparate prevalence rates between Asia and other continents [9,14].
Eight isolates from 50 E. coli (16%) specimens contained pAmpC and belonged to different phylogroups (A, B1, B2, C, F, D), within which one isolate Case No. 002 possessed both pAmpC and ESBL. All the pAmpC genes of these eight isolates were determined to be blaCMY-2 group, which indicates that CMY-2 is the most prevalent and geographically diverse group of pAmpC enzymes [15,16,17]. Interestingly, our sequencing results revealed that blaCMY-171 was the only type within the blaCMY-2 group.
Thirty-two percent (16/50) of the E. coli assayed possessed ESBL- and/or pAmpC-encoding genes, a higher rate than those reported in Japan, Europe, or the United States [18,19,20,21,22]. The high frequency of ESBL and pAmpC genes in E. coli found in dogs and cats may pose a risk for the transmission this multidrug-resistant E. coli to pet owners. A study examined the genetic relationship between multidrug-resistant bacterial isolates, including ESBL producers, between pet owners and their dogs, demonstrating that 9.5% (4/42) of the owner–dog pairs shared similar multidrug-resistant E. coli isolates [23].
We only detected blaCTX-M-1, blaCTX-M-9, and blaTEM groups from the ESBL-producing E. coli. Here, only blaCTX-M-1 and blaCTX-M-9 groups belonged to ESBL-encoding genes, whereas blaTEM-215 and blaTEM-243 were class A β-lactamase (https://www.ncbi.nlm.nih.gov/pathogens/beta-lactamase-data-resources/, accessed on 1 December 2021). blaCTX-M-2, blaCTX-M-8, blaCTX-M-25, and blaSHV groups were not found; however, blaCTX-M-2 and blaSHV groups had been present in the E. coli isolates obtained from the companion animals visiting NTUVH during studies conducted from 2014 to 2017 [8]. It is unknown why E. coli-containing blaCTX-M-2 and blaSHV groups were absent during the present study. Teunis et al. conducted a longitudinal study to investigate the duration of the presence of ESBL- and pAmpC-producing E. coli in humans living in a livestock-dense region [24]. They concluded that blaSHV-12 was both easily acquired and lost. The estimated overall mean time to eliminate blaSHV-12 was 1.1 years, and the mean time to acquire it was approximately 3.0 years [24]. Because both this and our previous studies were only sectional studies, it is worth performing a longitudinal study in the future to investigate how long companion animals carry ESBL- or pAmpC-producing E. coli.
Of the nine ESBL-producing E. coli strains, seven were E. coli ST131 samples that were isolated from urine and ascites and belonged to the B2 phylogroup. Three out of the seven ST131 strains were identified as O25b clones, a globally spreading clone with a high virulence potential [25]. ST131 O25b with CTX-M-15 is a highly virulent clone for humans and is spreading globally [25]. The presence of this virulent clone was first reported in a dog with chronic cystitis in Portugal [26]. In our previous study, CTX-M-174 and CTX-M-194 were the β-lactamases found in the ST131 O25b clones [8], whereas CTX-235 and CTX-238 were those noted in the present study. β-lactamase other than CTX-M-15 were also found in E. coli ST131 O25b clones from companion animals [27]. Therefore, regardless of the β-lactamases present in the ST131 O25b clone, its potential zoonotic risk must be considered as a precaution. ST1193 has emerged as a pandemic clone of a multidrug-resistant human pathogen [28,29]. This ST was first identified in Australia as a fluoroquinolones resistant clone group [30], and its presence has been reported worldwide [31,32,33,34]. The 002 strain possessed both blaCTX-M-55 and blaCMY-171 and was typed as ST93, which has been reported as an avian and human extraintestinal pathogenic or diarrhoeagenic form of E. coli in humans and animals [35,36,37].
The conjugation test revealed that 81% (13/16) of the ESBL/pAmpC determinants were successfully transferred from the donor strains to the recipient E. coli J53 strain. The 049 strain did not transfer its single blaCMY-171 to E. coli J53, and the 011 and 025 strains transferred some bla genes to the recipient strain. The bla genes that did not transfer to the recipient strain may be located at plasmids other than those that transferred to the recipient strain. Studies have shown that some plasmids carrying blapAmpC were not self-transmissible; they can, however, be transferred through transformation or mobilization [5,38,39]. We cannot rule out the possibility that blaCMY-171 may be chromosome-encoded. Although plasmid extraction from the donor strains was performed (Figure S3), PCR-based replicon typing was not conducted which is a study limitation. Nevertheless, the conjugation test performed in this study demonstrated that the majority of blaESBL- and blapAmpC-encoding genes were located on mobile genetic elements, which has important public health implications because of its likely easier dissemination.
The ESBL/pAmpC-producing E. coli exhibited a more prominent multidrug-resistant phenotype than E. coli isolates without either gene. Imipenem was active against all E. coli strains in our study. This carbapenem class of drug has been used to treat multidrug- resistant bacteria in veterinary medicine [40]; however, it should be avoided and restricted to exceptional circumstances where no other options are available under the cascade because carbapenems are critically important antimicrobials of last resort for humans. Furthermore, carbapenem-resistant E. coli has been isolated from companion animals in previous studies, and thus, the selection pressure through antimicrobial use in companion animals should be avoided [41,42].
4. Materials and Methods
4.1. Sample Collection
Between June and December 2020, we cultured 249 bacterial isolates from 172 cases of companion animals admitted to NTUVH. Of them, 50 E. coli isolates were obtained from dogs (n = 41) or cats (n = 9). The bacteria were identified to the species level using a Vitek-2 Compact microbial detection system (bioMérieux, Marcy I’Etoile, France). The E. coli isolates were cultured from urine (n = 38), ascites (n = 2), pus (n = 4), nasal discharge (n = 2), body mass (n = 3), and an unknown source (n = 1). The isolates were stored in a Microbank system (Pro-Lab Diagnostics, Richmond Hill, ON, Canada) and maintained at −80 °C until analysis.
4.2. ESBL Screening and Phenotype Confirmation
E. coli obtained from NTUVH were streaked on CHROMagar ESBL plates (CHROMagar, Paris, France) to initially screen for ESBL producers. ESBL-producing E. coli would grow well and exhibit purple colonies on the chromogenic agar medium, and E. coli isolates that did not produce ESBL would not grow [43]. Subsequently, ESBL-producing E. coli were further identified by using the phenotypic confirmatory test specified by the Clinical and Laboratory Standards Institute (CLSI) [44]. E. coli that tested positive for ESBLs through the CHROMagar ESBL-test were evenly streaked on a Muller–Hinton agar (Difco/BectonDickinson, Franklin Lakes, NJ, USA) at a concentration of approximately 0.5 McFarland standards with a cotton swab. Four discs were placed on the agar surface: cefotaxime (30 μg), cefataxime–clavulanic acid (30 μg/10 μg), ceftazidime (30 μg), and ceftazidime–clavulanic acid (30 μg/10 μg). The plates were then incubated at 35 °C for 16 to 18 h. A difference of 5 mm or more in the inhibition zones between either cefotaxime–clavulanic or ceftazidime–clavulanic acid combination and cefotaxime or ceftazidime alone was used to identify an ESBL-producing E. coli. Klebsiella pneumoniae ATCC 700603 and E. coli ATCC 25922 were used as the positive and negative controls, respectively. The antimicrobial susceptible test discs were purchased from BD BBL (Difco/Becton Dickinson, Franklin Lakes, NJ, USA).
4.3. Phylogenetic Grouping
To understand the genetic substructure of the ESBL- and/or pAmpC-producing E. coli, the PCR method reported by Clermont et al. was applied to classify these E. coli cultures into multiple phylogroups, including A, B1, B2, C, D, E, F, and clade I [45]. The lysate preparations of the ESBL- and/or pAmpC-producing E. coli were used as the templates for the PCR, and the primers used are listed in Table 3. The boiling method reported by Shaheen et al. was used to prepare the lysates [46]. Briefly, the tested E. coli strains were cultured for 16–18 h at 37 °C on tryptic soy agar plates (Difco/Becton Dickinson, Franklin Lakes, NJ, USA). A loopful of bacterial cells was resuspended in 200 μL of double-distilled H2O (ddH2O) and boiled for 10 min. The supernatant was saved after centrifugation at 12,000× g for 10 min and used as the template source for PCR.
Table 3.
PCR Target | Primer | Sequences (5′-3′) | Annealing Tm (°C) | Predicted PCR Size (bp) | Reference |
---|---|---|---|---|---|
bla TEM | TEM-F | TCGGGGAAATGTGCGCG | 55 | 972 | [47] |
TEM-R | TGCTTAATCATGAGGCACC | ||||
bla SHV | SHV-F | GCCTTTATCGGCCCTCATCAA | 54 | 819 | [48] |
SHV-R | TCCCGCAGATAAATCACCACAATG | ||||
bla CTX-M-1-group | CTX-M-1-F | CCCATGGTTAAAAAATCACTGC | 54 | 942 | [49] |
CTX-M-1-R | CAGCGCTTTTGCCGTCTAAG | ||||
bla CTX-M-2-group | CTX-M-2-F | CGACGCTACCCCTGCTATT | 52 | 552 | [50] |
CTX-M-2-R | CCAGCGTCAGATTTTTCAGG | ||||
bla CTX-M-8-group | CTX-M-8-F | TCGCGTTAAGCGGATGATGC | 52 | 666 | [50] |
CTX-M-8-R | AACCCACGATGTGGGTAGC | ||||
bla CTX-M-9-group | CTX-M-9-F | ATGGTGACAAAGAGAGTGCAAC | 55 | 876 | [51] |
CTX-M-9-R | TTACAGCCCTTCGGCGATGATT | ||||
bla CTX-M-25-group | CTX-M-25-F | GCACGATGACATTCGGG | 52 | 327 | [50] |
CTX-M-25-R | AACCCACGATGTGGGTAGC | ||||
bla pAmpC | CIT-M-F | TGGCCAGAACTGACAGGCAAA | 64 | 462 | [52] |
CIT-M-R | TTTCTCCTGAACGTCGCTGGC | ||||
bla pAmpC | MOX-M-F | GCTGCTCAAGGAGCACAGGAT | 64 | 520 | [52] |
MOX-M-R | CACATTGACATAGGTGTGGTGC | ||||
bla pAmpC | DHA-M-F | AACTTTCACAGCTGTGCTGGGT | 64 | 405 | [52] |
DHA-M-R | CCGTACGCATACTGGCTTTGC | ||||
bla pAmpC | CMY-F | ATGATGAAAAAATCGTTATGCT | 64 | 1146 | [52] |
CMY-R | TTATTGCAGCTTTTCAAGAATGCG | ||||
chuA | chuA.1b | ATGGTACCGGACGAACCAAC | 59 | 288 | [45,53] |
chuA.2 | TGCCGCCAGTACCAAAGACA | ||||
yjaA | yjaA.1b | CAAACGTGAAGTGTCAGGAG | 59 | 211 | [45] |
yjaA.2b | AATGCGTTCCTCAACCTGTG | ||||
TspE4.C2 | TspE4C2.1b | CACTATTCGTAAGGTCATCC | 59 | 152 | [45] |
TspE4C2.2b | AGTTTATCGCTGCGGGTCGC | ||||
arpA | AceK.f | AACGCTATTCGCCAGCTTGC | 59 | 400 | [45,54] |
ArpA1.r | TCTCCCCATACCGTACGCTA | ||||
arpA | ArpAgpE.f | GATTCCATCTTGTCAAAATATGCC | 57 | 301 | [55] |
ArpAgpE.r | GAAAAGAAAAAGAATTCCCAAGAG | ||||
trpA | trpAgpC.1 | AGTTTTATGCCCAGTGCGAG | 59 | 219 | [55] |
trpAgpC.2 | TCTGCGCCGGTCACGCCC | ||||
trpA | trpBA.f | CGGCGATAAAGACATCTTCAC | 59 | 489 | [56] |
trpBA.r | GCAACGCGGCCTGGCGGAAG | ||||
pabB | O25pabBspe.F | TCCAGCAGGTGCTGGATCGT | 65 | 347 | [57] |
O25pabBspe.R | GCGAAATTTTTCGCCGTACTGT | ||||
trpA | trpA.F | GCTACGAATCTCTGTTTGCC | 65 | 427 | [57] |
trpA2.R | GCAACGCGGCCTGGCGGAAG |
4.4. Genotyping and Phylogenetic Analysis
The ESBL- and/or pAmpC-producing E. coli were genotyped through multilocus sequence typing (MLST) [58]. The related PCR products were sequenced. The sequence data were then uploaded to the EnteroBase MLST website (http://enterobase.warwick.ac.uk/; accessed on 20 March 2021) for comparison. The similarities between these strains were analyzed using BioNumerics version 7.0 (Applied Maths, Sint-Martens-Latem, Belgium).
4.5. E. coli ST131 O25b Detection
E. coli ST131/O25b was detected through PCR based on the method described by Clermont et al. as follows: initial denaturation at 94 °C for 4 min followed by 30 cycles at 94 °C for 5 s, annealing at 65 °C for 10 s, and 72 °C extension for 5 min [52]. Ten μL of each PCR sample was inserted into a 2.0% agarose gel and electrophoresed at 100 V for 30 min using Tris-acetate-EDTA (TAE) buffer. The gels were then stained with a fluorescent nucleic acid dye (Biotium, Fremont, CA, USA) for 20 min and examined under ultraviolet illumination.
4.6. Conjugation Test
A conjugation test was performed using broth mating experiments as described by Tamang et al. [59]. We added 0.5 mL of the overnight culture of ESBL- and/or pAmpC-producing E. coli (donor) and E. coli J53 (recipient) to 4.5 mL of MH broth (Difco/Becton Dickinson, Franklin Lakes, NJ, USA) and incubated them with constant shaking at 37 °C for 4 h. An aliquot of 0.5 mL of the donor and recipient cells were added to 4 mL of MH broth and incubated with constant shaking at 37 °C overnight. An aliquot of 100 μL of the cocultured cells was spotted and evenly spread on the agar surface of the MH agar supplemented with sodium azide (150 mg/L) (Sigma) and cefotaxime (2 mg/L). Only transconjugants would grow on such double-selected MH agar, and neither the donor nor the recipient would be recovered. PCR detection for the specific ESBL and/or pAmpC genes of each donor strain was performed on the transconjugant strain to confirm the transfer of these genes.
4.7. Antimicrobial Susceptibility Test
All 50 E. coli isolates were tested for susceptibility to the specific antimicrobial agents using the Vitek 2 AST-GN96 card (bioMérieux, Marcy I’Etoile, France), which was designed for minimum inhibitory concentration (MIC) determination and for veterinary use only. We only included ampicillin, amoxicillin/clavulanate, ceftiofur, imipenem, and enrofloxacin in this study. Breakpoints specified in the Performance Standards for Antimicrobial Disk and Dilution Susceptibility Tests for Bacteria Isolated from Animals of CLSI (Vet 08) were used to interpret the data [44].
5. Conclusions
The expansion of the resistant genes mediated by plasmids, such as ESBL and pAmpC-encoding, has become a major public health concern. ESBL and pAmpC confer resistance to broad-spectrum cephalosporins, limiting treatment options in human and veterinary medicine. E. coli isolates of public health concern ST131 O25b, were discovered in this study, although they possessed bla genes other than blaCTX-M-15, which is commonly present in humans. ST131 O25b clones with different bla genes have been reported to be of companion animal origin. Thus, the role these animals may play in disseminating this clone should be considered. By frequently being MDR, the dissemination of such strains may lead to therapeutic failures or limited therapeutic options. A high prevalence of ESBL- and/or pAmpC-encoding genes in E. coli from companion animals underscores the necessity of antibiotic prudent use and periodic monitoring of multidrug-resistant bacteria.
Acknowledgments
The authors also would like to thank L. J. Teng from the Department of Clinical Laboratory Sciences and Medical Biotechnology, National Taiwan University, for providing Klebsiella pneumoniae ATCC 700603 strain and C.-T. Liao from the Department of Medical Laboratory Science and Biotechnology, Central Taiwan University of Science and Technology, for providing the Escherichia coli J53 strain.
Supplementary Materials
The following are available online at https://www.mdpi.com/article/10.3390/antibiotics10121536/s1, Figure S1: PCR detection of E. coli ST131/O25b clone. Figure S2: PCR detection of the transfer of the ESBL genes from donor E. coli isolate 031 to recipient E. coli J53 strain in a conjugation test. Figure S3: The plasmid DNA isolation from the donor and the recipient cells. Table S1: Antimicrobial susceptibility test of the E. coli containing ESBL, pAmpC, both or neither. Table S2: Interpretive categories and breakpoints used in the present study.
Author Contributions
Conceptualization, K.-S.Y.; methodology, F.-L.L. and N.-L.K.; writing—original draft preparation, F.-L.L.; writing—review and editing, K.-S.Y.; project administration, K.-S.Y. All authors have read and agreed to the published version of the manuscript.
Funding
This research received no external funding.
Institutional Review Board Statement
Not applicable.
Informed Consent Statement
Not applicable.
Data Availability Statement
Data are contained within the article or the Supplementary Materials. Sequence data presented in this study are also available on request from the corresponding author.
Conflicts of Interest
The authors declare no conflict of interest.
Footnotes
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.
References
- 1.McEwen S.A., Collignon P.J. Antimicrobial resistance: A one health perspective. Microbiol. Spectr. 2018;6:2. doi: 10.1128/microbiolspec.ARBA-0009-2017. [DOI] [PubMed] [Google Scholar]
- 2.Vaishnavi C. Translocation of gut flora and its role in sepsis. Indian J. Med. Microbiol. 2013;31:334–342. doi: 10.4103/0255-0857.118870. [DOI] [PubMed] [Google Scholar]
- 3.WHO Advisory Group on Integrated Surveillance of Antimicrobial Resistance (AGISAR) Critically Important Antimicrobials for Human Medicine. 5th ed. WHO; Geneva, Switzerland: 2016. [Google Scholar]
- 4.Bush K. Past and present perspectives on beta-Lactamases. Antimicrob. Agents Chemother. 2018;62:10. doi: 10.1128/AAC.01076-18. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Philippon A., Arlet G., Jacoby G.A. Plasmid-determined AmpC-type beta-lactamases. Antimicrob. Agents Chemother. 2002;46:1–11. doi: 10.1128/AAC.46.1.1-11.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Honore N., Nicolas M.H., Cole S.T. Inducible cephalosporinase production in clinical isolates of Enterobacter cloacae is controlled by a regulatory gene that has been deleted from Escherichia coli. EMBO J. 1986;5:3709–3714. doi: 10.1002/j.1460-2075.1986.tb04704.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Papanicolaou G.A., Medeiros A.A., Jacoby G.A. Novel plasmid-mediated beta-lactamase (MIR-1) conferring resistance to oxyimino- and alpha-methoxy beta-lactams in clinical isolates of Klebsiella pneumoniae. Antimicrob. Agents Chemother. 1990;34:2200–2209. doi: 10.1128/AAC.34.11.2200. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Huang Y.H., Kuan N.L., Yeh K.S. Characteristics of extended-spectrum beta-lactamase-producing Escherichia coli from dogs and cats admitted to a veterinary teaching hospital in Taipei, Taiwan from 2014 to 2017. Front. Vet. Sci. 2020;7:395. doi: 10.3389/fvets.2020.00395. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Salgado-Caxito M., Benavides J.A., Adell A.D., Paes A.C., Moreno-Switt A.I. Global prevalence and molecular characterization of extended-spectrum beta-lactamase producing-Escherichia coli in dogs and cats—A scoping review and meta-analysis. One Health. 2021;12:100236. doi: 10.1016/j.onehlt.2021.100236. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.McLain J.E., Cytryn E., Durso L.M., Young S. Culture-based methods for detection of antibiotic resistance in agroecosystems: Advantages, challenges, and gaps in knowledge. J. Environ. Qual. 2016;45:432–440. doi: 10.2134/jeq2015.06.0317. [DOI] [PubMed] [Google Scholar]
- 11.Tsuyuki Y., Kurita G., Murata Y., Takahashi T., Veterinary Infection Control Association Sepsis Working Group Bacteria isolated from companion animals in Japan (2014–2016) by blood culture. J. Infect. Chemother. 2018;24:583–587. doi: 10.1016/j.jiac.2018.01.014. [DOI] [PubMed] [Google Scholar]
- 12.Sun Y., Zeng Z., Chen S., Ma J., He L., Liu Y., Deng Y., Lei T., Zhao J., Liu J.H. High prevalence of bla(CTX-M) extended-spectrum beta-lactamase genes in Escherichia coli isolates from pets and emergence of CTX-M-64 in China. Clin. Microbiol. Infect. 2010;16:1475–1481. doi: 10.1111/j.1469-0691.2010.03127.x. [DOI] [PubMed] [Google Scholar]
- 13.Ejaz H., Younas S., Abosalif K.O.A., Junaid K., Alzahrani B., Alsrhan A., Abdalla A.E., Ullah M.I., Qamar M.U., Hamam S.S.M. Molecular analysis of blaSHV, blaTEM, and blaCTX-M in extended-spectrum β-lactamase producing Enterobacteriaceae recovered from fecal specimens of animals. PLoS ONE. 2021;16:e0245126. doi: 10.1371/journal.pone.0245126. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Okeke I.N., Lamikanra A., Edelman R. Socioeconomic and behavioral factors leading to acquired bacterial resistance to antibiotics in developing countries. Emerg. Infect. Dis. 1999;5:18–27. doi: 10.3201/eid0501.990103. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Smet A., Martel A., Persoons D., Dewulf J., Heyndrickx M., Herman L., Haesebrouck F., Butaye P. Broad-spectrum β-lactamases among Enterobacteriaceae of animal origin: Molecular aspects, mobility and impact on public health. FEMS Microbiol. Rev. 2010;34:295–316. doi: 10.1111/j.1574-6976.2009.00198.x. [DOI] [PubMed] [Google Scholar]
- 16.Cejas D., Fernandez Canigia L., Quinteros M., Giovanakis M., Vay C., Lascialandare S., Mutti D., Pagniez G., Almuzara M., Gutkind G., et al. Plasmid-encoded AmpC (pAmpC) in Enterobacteriaceae: Epidemiology of microorganisms and resistance markers. Rev. Argent. Microbiol. 2012;44:182–186. [PubMed] [Google Scholar]
- 17.Rumi M.V., Mas J., Elena A., Cerdeira L., Munoz M.E., Lincopan N., Gentilini E.R., Di Conza J., Gutkind G. Co-occurrence of clinically relevant beta-lactamases and MCR-1 encoding genes in Escherichia coli from companion animals in Argentina. Vet. Microbiol. 2019;230:228–234. doi: 10.1016/j.vetmic.2019.02.006. [DOI] [PubMed] [Google Scholar]
- 18.Huber H., Zweifel C., Wittenbrink M.M., Stephan R. ESBL-producing uropathogenic Escherichia coli isolated from dogs and cats in Switzerland. Vet. Microbiol. 2013;162:992–996. doi: 10.1016/j.vetmic.2012.10.029. [DOI] [PubMed] [Google Scholar]
- 19.Dierikx C.M., van Duijkeren E., Schoormans A.H.W., van Essen-Zandbergen A., Veldman K., Kant A., Huijsdens X.W., van der Zwaluw K., Wagenaar J.A., Mevius D.J. Occurrence and characteristics of extended-spectrum-β-lactamase and AmpC-producing clinical isolates derived from companion animals and horses. J. Antimicrob. Chemother. 2012;67:1368–1374. doi: 10.1093/jac/dks049. [DOI] [PubMed] [Google Scholar]
- 20.Bogaerts P., Huang T.D., Bouchahrouf W., Bauraing C., Berhin C., El Garch F., Glupczynski Y., ComPath Study Group Characterization of ESBL- and AmpC-producing Enterobacteriaceae from diseased companion animals in Europe. Microb. Drug. Resist. 2015;21:643–650. doi: 10.1089/mdr.2014.0284. [DOI] [PubMed] [Google Scholar]
- 21.Maeyama Y., Taniguchi Y., Hayashi W., Ohsaki Y., Osaka S., Koide S., Tamai K., Nagano Y., Arakawa Y., Nagano N. Prevalence of ESBL/AmpC genes and specific clones among the third-generation cephalosporin-resistant Enterobacteriaceae from canine and feline clinical specimens in Japan. Vet. Microbiol. 2018;216:183–189. doi: 10.1016/j.vetmic.2018.02.020. [DOI] [PubMed] [Google Scholar]
- 22.Shaheen B.W., Nayak R., Foley S.L., Kweon O., Deck J., Park M., Rafii F., Boothe D.M. Molecular characterization of resistance to extended-spectrum cephalosporins in clinical Escherichia coli isolates from companion animals in the United States. Antimicrob. Agents Chemother. 2011;555:666–675. doi: 10.1128/AAC.00656-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Carvalho A.C., Barbosa A.V., Arais L.R., Ribeiro P.F., Carneiro V.C., Cerqueira A.M. Resistance patterns, ESBL genes, and genetic relatedness of Escherichia coli from dogs and owners. Braz. J. Microbiol. 2016;47:150–158. doi: 10.1016/j.bjm.2015.11.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Teunis P.F.M., Evers E.G., Hengeveld P.D., Dierikx C.M., Wielders C.C.H., van Duijkeren E. Time to acquire and lose carriership of ESBL/pAmpC producing E. coli in humans in the Netherlands. PLoS ONE. 2018;13:e0193834. doi: 10.1371/journal.pone.0193834. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Mathers A.J., Peirano G., Pitout J.D. The role of epidemic resistance plasmids and international high-risk clones in the spread of multidrug-resistant Enterobacteriaceae. Clin. Microbiol. Rev. 2015;28:565–591. doi: 10.1128/CMR.00116-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Pomba C., da Fonseca J.D., Baptista B.C., Correia J.D., Martinez-Martinez L. Detection of the pandemic O25-ST131 human virulent Escherichia coli CTX-M-15-producing clone harboring the qnrB2 and aac(6′)-Ib-cr genes in a dog. Antimicrob. Agents Chemother. 2009;53:327–328. doi: 10.1128/AAC.00896-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Timofte D., Maciuca I.E., Kemmett K., Wattret A., Williams N.J. Detection of the human pandemic Escherichia coli B2-O25b-ST131 in UK dogs. Vet. Rec. 2014;17:4352. doi: 10.1136/vr.101893. [DOI] [PubMed] [Google Scholar]
- 28.Tchesnokova V., Radey M., Chattopadhyay S., Larson L., Weaver J.L., Kisiela D., Sokurenko E.V. Pandemic fluoroquinolone resistant Escherichia coli clone ST1193 emerged via simultaneous homologous recombinations in 11 gene loci. Proc. Natl. Acad. Sci. USA. 2019;116:14740–14748. doi: 10.1073/pnas.1903002116. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Johnson J.R., Johnston B.D., Porter S.B., Clabots C., Bender T.L., Thuras P., Trott D.J., Cobbold R., Mollinger J., Ferrieri P., et al. Rapid emergence, subsidence, and molecular detection of Escherichia coli sequence type 1193-fimH64, a new disseminated multidrug-resistant commensal and extraintestinal pathogen. J. Clin. Microbiol. 2019;57:e01664-18. doi: 10.1128/JCM.01664-18. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Platell J.L., Trott D.J., Johnson J.R., Heisig P., Heisig A., Clabots C.R., Johnston B., Cobbold R.N. Prominence of an O75 clonal group (clonal complex 14) among non-ST131 fluoroquinolone-resistant Escherichia coli causing extraintestinal infections in humans and dogs in Australia. Antimicrob. Agents Chemother. 2012;56:3898–3904. doi: 10.1128/AAC.06120-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Valenza G., Werner M., Eisenberger D., Nickel S., Lehner-Reindl V., Holler C., Bogdan C. First report of the new emerging global clone ST1193 among clinical isolates of extended-spectrum beta-lactamase (ESBL)-producing Escherichia coli from Germany. J. Glob. Antimicrob. Resist. 2019;17:305–308. doi: 10.1016/j.jgar.2019.01.014. [DOI] [PubMed] [Google Scholar]
- 32.Kim Y., Oh T., Nam Y.S., Cho S.Y., Lee H.J. Prevalence of ST131 and ST1193 among bloodstream isolates of Escherichia coli not susceptible to ciprofloxacin in a tertiary care university hospital in Korea, 2013–2014. Clin. Lab. 2017;63:1541–1543. doi: 10.7754/Clin.Lab.2017.170319. [DOI] [PubMed] [Google Scholar]
- 33.Wu J., Lan F., Lu Y., He Q., Li B. Molecular characteristics of ST1193 clone among phylogenetic group B2 non-ST131 fluoroquinolone-resistant Escherichia coli. Front. Microbiol. 2017;8:2294. doi: 10.3389/fmicb.2017.02294. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Tchesnokova V.L., Rechkina E., Larson L., Ferrier K., Weaver J.L., Schroeder D.W., She R., Butler-Wu S.M., Aguero-Rosenfeld M.E., Zerr D., et al. Rapid and extensive expansion in the United States of a new multidrug-resistant Escherichia coli clonal group, sequence type 1193. Clin. Infect. Dis. 2019;68:334–337. doi: 10.1093/cid/ciy525. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Chen Y., Chen X., Zheng S., Yu F., Kong H., Yang Q., Cui D., Chen N., Lou B., Li X., et al. Serotypes, genotypes and antimicrobial resistance patterns of human diarrhoeagenic Escherichia coli isolates circulating in southeastern China. Clin. Microbiol. Infect. 2014;20:52–58. doi: 10.1111/1469-0691.12188. [DOI] [PubMed] [Google Scholar]
- 36.Maluta R.P., Logue C.M., Casas M.R., Meng T., Guastalli E.A., Rojas T.C., Montelli A.C., Sadatsune T., de Carvalho Ramos M., Nolan L.K., et al. Overlapped sequence types (STs) and serogroups of avian pathogenic (APEC) and human extra-intestinal pathogenic (ExPEC) Escherichia coli isolated in Brazil. PLoS ONE. 2014;9:e105016. doi: 10.1371/journal.pone.0105016. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Vogt D., Overesch G., Endimiani A., Collaud A., Thomann A., Perreten V. Occurrence and genetic characteristics of third-generation cephalosporin-resistant Escherichia coli in Swiss retail meat. Microb. Drug Resist. 2014;20:485–494. doi: 10.1089/mdr.2013.0210. [DOI] [PubMed] [Google Scholar]
- 38.Tzouvelekis L.S., Tzelepi E., Mentis A.F., Tsakris A. Identification of a novel plasmid-mediated beta-lactamase with chromosomal cephalosporinase characteristics from Klebsiella pneumoniae. J. Antimicrob. Chemother. 1993;31:645–654. doi: 10.1093/jac/31.5.645. [DOI] [PubMed] [Google Scholar]
- 39.Wu S.W., Dornbusch K., Kronvall G., Norgren M. Characterization and nucleotide sequence of a Klebsiella oxytoca cryptic plasmid encoding a CMY-type beta-lactamase: Confirmation that the plasmid-mediated cephamycinase originated from the Citrobacter freundii AmpC beta-lactamase. Antimicrob. Agents Chemother. 1999;43:1350–1357. doi: 10.1128/AAC.43.6.1350. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Barker C.W., Zhang W., Sanchez S., Budsberg S.C., Boudinot F.D., Stevenson M.A.M. Pharmacokinetics of imipenem in dogs. Am. J. Vet. Res. 2003;64:694–699. doi: 10.2460/ajvr.2003.64.694. [DOI] [PubMed] [Google Scholar]
- 41.Hong J.S., Song W., Park H.M., Oh J.Y., Chae J.C., Han J.I., Jeong S.H. First detection of New Delhi metallo-beta-lactamase-5-producing Escherichia coli from companion animals in Korea. Microb. Drug. Resist. 2019;25:344–349. doi: 10.1089/mdr.2018.0237. [DOI] [PubMed] [Google Scholar]
- 42.Cole S.D., Peak L., Tyson G.H., Reimschuessel R., Ceric O., Rankin S.C. New Delhi metallo-beta-lactamase-5-producing Escherichia coli in companion animals, United States. Emerg. Infect. Dis. 2020;26:381–383. doi: 10.3201/eid2602.191221. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Hornsey M., Phee L., Woodford N., Turton J., Meunier D., Thomas C., Wareham D.W. Evaluation of three selective chromogenic media, CHROMagar ESBL, CHROMagar CTX-M and CHROMagar KPC, for the detection of Klebsiella pneumoniae producing OXA-48 carbapenemase. J. Clin. Pathol. 2013;66:348–350. doi: 10.1136/jclinpath-2012-201234. [DOI] [PubMed] [Google Scholar]
- 44.CLSI. M-100 . Performance Standards for Antimicrobial Susceptibility Testing. 30th ed. CLSI; Wayne, PA, USA: 2020. [Google Scholar]
- 45.Clermont O., Christenson J.K., Denamur E., Gordon D.M. The Clermont Escherichia coli phylo-typing method revisited: Improvement of specificity and detection of new phylo-groups. Environ. Microbiol. Rep. 2013;5:58–65. doi: 10.1111/1758-2229.12019. [DOI] [PubMed] [Google Scholar]
- 46.Shaheen B.W., Oyarzabal O.A., Boothe D.M. The role of class 1 and 2 integrons in mediating antimicrobial resistance among canine and feline clinical E. coli isolates from the US. Vet. Microbiol. 2010;144:363–370. doi: 10.1016/j.vetmic.2010.01.018. [DOI] [PubMed] [Google Scholar]
- 47.Sutcliffe J.G. Nucleotide-sequence of ampicillin resistance gene of Escherichia coli plasmid pBR322. Proc. Natl. Acad. Sci. USA. 1978;75:3737–3741. doi: 10.1073/pnas.75.8.3737. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Chia J.H., Chu C., Su L.H., Chiu C.H., Kuo A.J., Sun C.F., Wu T.L. Development of a multiplex PCR and SHV melting-curve mutation detection system for detection of some SHV and CTX-M beta-lactamases of Escherichia coli, Klebsiella pneumoniae, and Enterobacter cloacae in Taiwan. J. Clin. Microbiol. 2005;43:4486–4491. doi: 10.1128/JCM.43.9.4486-4491.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49.Yu Y., Ji S., Chen Y., Zhou W., Wei Z., Li L., Ma Y. Resistance of strains producing extended-spectrum beta-lactamases and genotype distribution in China. J. Infect. 2007;54:53–57. doi: 10.1016/j.jinf.2006.01.014. [DOI] [PubMed] [Google Scholar]
- 50.Woodford N., Fagan E.J., Ellington M.J. Multiplex PCR for rapid detection of genes encoding CTX-M extended-spectrum β-lactamases. J. Antimicrob. Chemother. 2006;57:154–155. doi: 10.1093/jac/dki412. [DOI] [PubMed] [Google Scholar]
- 51.Zhang J., Zheng B., Zhao L., Wei Z., Ji J., Li L., Xiao Y. Nationwide high prevalence of CTX-M and an increase of CTX-M-55 in Escherichia coli isolated from patients with community-onset infections in Chinese county hospitals. BMC Infect. Dis. 2014;14:659. doi: 10.1186/s12879-014-0659-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 52.Javier Pérez-Pérez F., Hanson N.D. Detection of plasmid-mediated AmpC β-lactamase genes in clinical isolates by using multiplex PCR. J. Clin. Microbiol. 2002;40:2153–2162. doi: 10.1128/JCM.40.6.2153-2162.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 53.Clermont O., Bonacorsi S., Bingen E. Rapid and simple determination of the Escherichia coli phylogenetic group. Appl. Environ. Microbiol. 2000;66:4555–4558. doi: 10.1128/AEM.66.10.4555-4558.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 54.Clermont O., Bonacorsi S., Bingen E. Characterization of an anonymous molecular marker strongly linked to Escherichia coli strains causing neonatal meningitis. J. Clin. Microbiol. 2004;42:1770–1772. doi: 10.1128/JCM.42.4.1770-1772.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 55.Lescat M., Clermont O., Woerther P.L., Glodt J., Dion S., Skurnik D., Djossou F., Dupont C., Perroz G., Picard B., et al. Commensal Escherichia coli strains in Guiana reveal a high genetic diversity with host-dependant population structure. Environ. Microbiol. Rep. 2013;5:49–57. doi: 10.1111/j.1758-2229.2012.00374.x. [DOI] [PubMed] [Google Scholar]
- 56.Clermont O., Lescat M., O’Brien C.L., Gordon D.M., Tenaillon O., Denamur E. Evidence for a human-specific Escherichia coli clone. Environ. Microbiol. 2008;10:1000–1006. doi: 10.1111/j.1462-2920.2007.01520.x. [DOI] [PubMed] [Google Scholar]
- 57.Clermont O., Dhanji H., Upton M., Gibreel T., Fox A., Boyd D., Mulvey M.R., Nordmann P., Ruppe E., Sarthou J.L., et al. Rapid detection of the O25b-ST131 clone of Escherichia coli encompassing the CTX-M-15-producing strains. J. Antimicrob. Chemother. 2009;64:274–277. doi: 10.1093/jac/dkp194. [DOI] [PubMed] [Google Scholar]
- 58.Wirth T., Falush D., Lan R., Colles F., Mensa P., Wieler L.H., Karch H., Reeves P.R., Maiden M.C.J., Ochman H., et al. Sex and virulence in Escherichia coli: An evolutionary perspective. Mol. Microbiol. 2006;60:1136–1151. doi: 10.1111/j.1365-2958.2006.05172.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 59.Tamang M.D., Nam H.M., Jang G.C., Kim S.R., Chae M.H., Jung S.C., Byun J.W., Park Y.H., Lim S.K. Molecular characterization of extended-spectrum-beta-lactamase-producing and plasmid-mediated AmpC beta-lactamase-producing Escherichia coli isolated from stray dogs in South Korea. Antimicrob. Agents Chemother. 2012;56:2705–2712. doi: 10.1128/AAC.05598-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
Data are contained within the article or the Supplementary Materials. Sequence data presented in this study are also available on request from the corresponding author.