Myostatin suppresses adipogenic differentiation and lipid accumulation by activating crosstalk between ERK1/2 and PKA signaling pathways in porcine subcutaneous preadipocytes

Abstract

The current study was undertaken to determine the effect of myostatin (MSTN) on lipid accumulation in porcine subcutaneous preadipocytes (PSPAs) and to further explore the potential molecular mechanisms. PSPAs isolated from Meishan weaned piglets were added with various concentrations of MSTN recombinant protein during the entire period of adipogenic differentiation process. Results showed that MSTN treatment significantly reduced the lipid accumulation, intracellular triglyceride (TG) content, glucose consumption, and glycerol phosphate dehydrogenase activity, while increased glycerol and free fatty acid release. Consistent with above results, the extracellular signal-regulated kinase 1/2 (ERK1/2) pathway was obviously activated and thus key adipogenic transcription factors peroxisome proliferator-activated receptor-gamma (PPAR-γ), CCAAT/enhancer-binding protein-alpha (C/EBP-α), and their downstream enzymes fatty acid synthase and acetyl-CoA carboxylase were all inhibited. However, chemical inhibition of ERK1/2 signaling pathway by PD98059 markedly reversed the decreased TG content by increasing PPAR-γ expression. In addition, MSTN activated the cyclic AMP/protein kinase A (cAMP/PKA) pathway and stimulated lipolysis by reducing the expression of antilipolytic gene perilipin, thus elevated key lipolytic enzymes adipose triglyceride lipase and hormone-sensitive lipase (HSL) expression and enzyme activity. On the contrary, pretreatment with PKA inhibitor H89 significantly reversed TG accumulation by increasing PPAR-γ expression and thus inhibiting ERK1/2, perilipin, and HSL phosphorylation, supporting the crosstalk between PKA and ERK1/2 pathways in both the anti-adipogenic and pro-lipolytic effects. In summary, our results suggested that MSTN suppressed adipogenesis and stimulated lipolysis, which was mainly mediated by activating crosstalk of ERK1/2 and PKA signaling pathways, and consequently decreased lipid accumulation in PSPAs, our findings may provide novel insights for further exploring MSTN as a potent inhibitor of porcine subcutaneous lipid accumulation.

Introduction

Lipid accumulation and utilization have been widely studied in domestic meat animals due to their direct economic value for production efficiency (Sillence, 2004; Quinn, 2008; Xu et al., 2009; Liu et al., 2010; Wu et al., 2016; Yan et al., 2018; Wei et al., 2019) and human health (Tarazona et al., 2019). Numerous studies have focused on intramuscular fat (IMF) accumulation, one of the most important meat quality indicators, and IMF content has been greatly improved (Estany et al., 2017; Ma et al., 2020; Mitka et al., 2020). However, few details have been clarified about the subcutaneous adipose tissues (SCA) development. For pigs, especially Chinese indigenous pig breeds, SCA are metabolically distinct with IMF and accounts for a large amount of body fat (Kouba et al., 1999; Poulos et al., 2010; Wei et al., 2018). Excessive SCA deposition not only severely reduces feed utilization but also adversely affects the meat quality (Hausman et al., 2009; Wei et al., 2018). Therefore, unravelling specific underlying mechanisms of SCA formation in pigs is critical to elucidating novel strategies to reduce the SCA deposition, so as to circumvent the obvious resources waste and resultant production inefficiency.

Adipose tissue formation, characterized by hyperplasia (increased adipocyte proliferation and adipogenesis) and hypertrophy (increased adipocyte size by lipogenesis and reduced lipolysis; Hausman et al., 2014), is a highly integrated physiological process that involves lipid storage, triglyceride (TG) synthesis, and mobilization. Peroxisome proliferator-activated receptor gamma (PPAR-γ) and CCAAT/enhancer-binding protein alpha (C/EBP-α) are two adipocyte-specific transcription factors, which are critical for adipogenesis and TG synthesis by activating the expression of major lipogenic enzymes acetyl-CoA carboxylase (ACC) and fatty acid synthase (FAS; Lu et al., 2018). The extracellular signal-regulated kinase 1 and 2 (ERK1/2) signaling pathway, a subfamily of mitogen-activated protein kinases (MAPKs), is involved in regulating numerous cellular functions like cell proliferation and differentiation (Ferguson et al., 2016; Wang et al., 2019a; Zong et al., 2019). Both the in vitro and in vivo evidence indicated that ERK1/2 positively regulates adipogenesis (Aubert et al., 1999; Prusty et al., 2002; Tang et al., 2003; Liao et al., 2008), while the others showed completely opposite results (Gwon et al., 2013; Ning et al., 2016), leading to controversial roles in lipid accumulation, which means that further studies are needed to clarify the roles of ERK1/2 in adipogenesis. Moreover, further research showed that ERK1/2 signaling pathway suppressed adipogenesis was closely associated with PPAR-γ inhibition (Song et al., 2016; Wu et al., 2018). However, whether the ERK/PPAR-γ pathway is involved in the adipogenic differentiation porcine subcutaneous preadipocytes (PSPAs) also needs further investigation.

In mature adipocytes, neutral lipids are mainly stored in lipid droplets (LDs) as TG, which can be progressively hydrolyzed and converted to free fatty acid (FFA) and glycerol. Hormone-sensitive lipase (HSL) and adipose triglyceride lipase (ATGL) are two key cytosolic lipases involving in TG lipolysis, whose phosphorylation and translocation into LDs are largely controlled by LDs-associated proteins perilipin and comparative gene identification-58 (CGI-58) (Ahmadian et al., 2010). Under basal conditions, perilipin interacts with CGI-58 at the surface of LDs, thereby regulating their availability for interacting with and stimulating the activity of HSL and ATGL (Ahmadian et al., 2010). However, cAMP-mediated activation of protein kinase (PKA) is able to induce the phosphorylation of perilipin, which further enhances the lipolytic process by facilitating the translocation of phosphorylated HSL from the cytoplasm to the LDs surface (Ahmadian et al., 2010). Besides PKA phosphorylation, numerous studies have also showed that the activation of ERK1/2 signaling pathway can promote the degradation of perilipin and the subsequent HSL phosphorylation, which accelerates lipolysis and FFA release (Greenberg et al., 2001; Liu et al., 2011; Drira and Sakamoto, 2014), proposing that ERK1/2 signaling pathway also positively activates lipolysis via the phosphorylation of perilipin. However, the crosstalk between PKA and ERK1/2 pathways on perilipin phosphorylation and the lipolysis in PSPAs also needs to be further studied.

Myostatin (MSTN) is a myokine belonging to the TGF-1β family, which is mainly secreted by skeletal muscle (McPherron et al., 1997). It has been extensively studied (Deng et al., 2017) as a key negative regulator of muscle growth, accompanied by a new line of reports focusing on MSTN applicability by gene editing both in vitro and in vivo (Cui et al., 2019; Matika et al., 2019; Zhang et al., 2019a; Li et al., 2020). However, when considering its efficient strategy to improve the muscle mass in livestock and poultry by editing MSTN gene, its potential impact on other tissues function must be considered, especially adipose tissue development, since more and more evidence has demonstrated that MSTN is involved in several biological processes and has been suggested as an important candidate gene for regulating fat deposition (Deng et al., 2017; Liu et al., 2019; Xin et al., 2020). Although its role in muscle growth has been well confirmed, there is a subject of ongoing debate whether MSTN promotes or inhibits lipid accumulation. Numerous in vivo experiments demonstrated that naturally occurring or engineered mutation of MSTN led to a lower fat mass in both mammalian species (Qian et al., 2015; Gu et al., 2016) and mice (Lin et al., 2002; Guo et al., 2009). However, other results showed that adipose-specific hyperexpression of MSTN significantly reduced fat mass in mice (Feldman et al., 2006). In vitro experiments on the lipid deposition by MSTN also have yielded contradictory results. There is evidence in preadipocytes of murine, bovine, and human origins showing promoted adipogenesis upon MSTN exposure (Artaza et al., 2005; Feldman et al., 2006; Muruganandan et al., 2009), whereas a series of experimental results have demonstrated inhibited adipogenesis after MSTN administration (Kim et al., 2001; Hirai et al., 2007; Zhu et al., 2015). Furthermore, in terms of pigs, fewer studies have concerned the effect of MSTN on adipogenesis, and the existing results are also controversial (Deng et al., 2012; Sun et al., 2016). Therefore, it is urgent to clarify how MSTN influences the adipogenesis and lipolysis in PSPAs and to further determine underlying potential mechanisms. It has been reported in some cell types that ERK1/2 activation inhibited lipid accumulation. Furthermore in 3T3-L1 cells, it was even demonstrated that MSTN suppressed preadipocyte differentiation and regulated lipid metabolism of mature adipocyte via activation of ERK1/2 signaling pathway (Li et al., 2011). However, to our knowledge, little is known about the interaction between MSTN and ERK1/2 signaling pathway in PSPAs lipid accumulation. Furthermore, previous studies showed that one of the major functions of PKA pathway is to regulate lipolysis (Li et al., 2019). However, whether MSTN can lead to excessive lipolysis in PSPAs by activating both PKA and ERK1/2 signaling pathways are also largely unknown.

As a result, the aim of the study was to investigate the effect of MSTN on lipid accumulation of PSPAs and to determine its underlying mechanisms. Our data demonstrated that administration of MSTN to PSPAs in vitro resulted in an increase in glycerol and FFA release, and thereby reduced lipid accumulation and intracellular TG content by promoting lipolysis. This effect was mainly achieved by activating both ERK1/2 and PKA signaling pathways, and subsequent PPAR-γ repression and phosphorylation of perilipin and HSL. These findings may improve our understanding of the metabolic crosstalk between muscle and adipose tissue upon this myokine, and provide potential applications of MSTN as an extrinsic modulatory factor on SCA deposition by affecting adipocyte differentiation and fat mobilization.

Materials and Methods

Ethics statements

This study was carried out in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the Ministry of Science and Technology of the People’s Republic of China. The protocols for animal experiments were approved by the Jiangsu Administrative Committee for Laboratory Animals (Approval number: SYXK-SU-2007-0005), and complied with the guidelines of Jiangsu laboratory animal welfare and ethics of Yangzhou University Animal Care and Use Committee, China.

Reagents, cells, and antibodies

Dexamethasone, insulin, 3-isobutyl-1-methylxanthine (3-IBMX), ERK inhibitor PD98059, and PKA inhibitor H89 were obtained from Sigma-Aldrich (St Louis, MO, USA). Dulbecco’s modified eagle’s medium (DMEM, high glucose) and fetal bovine serum (FBS) were purchased from Gibco (Waltham, MA, USA). Cell Counting Kit-8 (CCK-8) cell viability assay and oil red O (ORO) staining kits were gained from Nanjing Jiancheng Bioengineering Institute (Nanjing, China). Antibodies used in the study are as follows: PPAR-γ (polyclonal rabbit antibody, 1:1,000, AP0686, Bioworld Technology, Inc., Minneapolis, MN, USA), CCAAT/enhancer binding protein-α (C/EBP-α; polyclonal rabbit antibody, 1:1,000, BS1384, Bioworld Technology, Inc.), FAS (polyclonal rabbit antibody, 1:500, 13098-1-AP, Proteintech), ACC (rabbit polyclonal antibody, 1:500, BS90018, Proteintech), ATGL(rabbit polyclonal antibody, 1:500, BS7989, Proteintech), HSL (rabbit polyclonal antibody, 1:500, ab45422, Abcam, Cambridge, UK), Perilipin (rabbit polyclonal antibody, 1:1,000, BS91052, Proteintech), ERK1/2 (rabbit polyclonal antibody, 1:500, ^#9101, Cell Signaling), p-PKA (rabbit polyclonal antibody, 1:500, ^#4781, Cell Signaling, Danvers, MA, USA), PKA (rabbit polyclonal antibody, 1:500, ^#4782, Cell Signaling), and β-actin (mouse monoclonal antibody, 1:10,000, sc-130656, Santa Cruz).

Cell culture

Male Meishan piglets (a typical Chinese indigenous obese breed, weaned at 28 d old) used in the study were provided by the Small Meishan Pig Breeding Center (Jurong, Jiangsu, China). In the study, preadipocytes isolated from the SCA of 5 male Meishan piglets were mixed into a single pool to ensure the uniformity of the primary cells for culture. Cells were then randomly divided into four groups: Control group (CONT, only added with MSTN dissolving reagent PBS), 25, 50, and 100 ng/mL MSTN administration groups, each group had six technical replicates (n = 6/group) for each of the following experiment/assay such as proliferation, differentiation, gene expression, western blot analysis, etc. Briefly, piglets were killed by exsanguination, and SCA were collected from the neck and back, according to the guidelines of the Institutional Animal Care and Use Committee of Yangzhou University. PSPAs were isolated according to others’ and our published protocols (Bai et al., 2008; Pan et al., 2013, 2014) and pooled together. Briefly, collected SCA were rinsed with DMEM (containing 15 mM NaHCO₃, 100 IU/mL penicillin and streptomycin) without FBS. The SCA mass was cut into small pieces and digested with digestive juice (DMEM plus 20 g/L BSA, 1 g/L type IV collagenase) at 37 °C water bath and shaken for nearly 1 h. Then, DMEM (containing 10% FBS) was used to terminate digestion. The suspension was filtered by sterile nylon filter (150, 75, 38, and 23 μm pore size, respectively) to remove undigested fragments, and then PSPAs pellet was separated from the filtrate by centrifugation at 1,000 rpm for 10 min. The pellet was then incubated with erythrocyte lysis buffer twice at room temperature for 10 min, followed by centrifugation at 800 rpm for 5 min to remove red cell fragment (Pan et al., 2014). The PSPAs pellet was washed with DMEM containing 10% FBS and seeded in T25 cm² bottles at a density of 3 × 10⁴ cells/cm². Cells were cultured in DMEM with 10% FBS, 100 U/mL penicillin, 100 μg/mL streptomycin and 2 mM L-glutamine (Invitrogen, Carlsbad, CA, USA) in a humidified atmosphere of 5% CO₂ at 37 °C.

Adipogenic differentiation of preadipocytes

In the study, in order to evaluate the effect of MSTN on PSPAs differentiation, on day 3 after 85%～90% confluence (day 0), PSPAs were all exposed to differentiation medium (DMEM containing 0.25 mM 3-IBMX, 0.25 µM dexamethasone, and 1 µg/mL insulin [MDI] with 10% FBS) for 48 h. Cell culture media were collected for glycerol and FFA release detection. Cells were harvested for further detection of adipogenesis and lipolysis-related genes.

Cell viability assay

PSPAs were seeded in 96-well plates at a density of 1 × 10³ cell/well, and were cultured with 100 μL DMEM plus 10% FBS per well. After MSTN treatment for 48 h, each well was added with 10 μL CCK-8 reagent and were then incubated at 37 °C with 5% CO₂ atmosphere, humidified incubator for another 2 h. The OD450 values were detected by a microplate reader (Synergy HTX, BioTek, Winooski, VT, USA).

Lactate dehydrogenase (LDH) assay

Commercial cytotoxicity detection kit (Applygen Technologies, Beijing, China) was used to evaluate LDH release from cells after MSTN exposure according to the manufacturer’s protocol. Both the culture media and cell lysates LDH activities were measured by absorbance at 440 nm using a microplate reader (Synergy HTX). Cell cytotoxicity index is calculated as a percentage of LDH release into the media compared with total LDH (LDH in both media and cell lysates) activity. Data are expressed as a percentage of LDH in MSTN-treated cells relative to that in control cells. The percentage of viable cells was calculated by defining the cell viability without treatment as 100%.

Lipid quantification

ORO staining was employed to measure the lipid quantification of PSPAs after MSTN treatment for 48 h. After differentiation was induced, PSPAs were firstly washed with phosphate buffered saline (PBS) for three times and were fixed with 10% formalin for 5 min at room temperature. Then cells were stained with ORO working solution (0.2% ORO in 60% isopropanol). ORO staining was determined by a modified protocol. The cells were washed twice with PBS, fixed with 10% formalin for 1 h, dried, and stained with ORO for 10 min. The cells were washed with 70% ethanol and water and then dried. The lipid content of stained cells was visualized by microscopy (Olympus IX73, Tokyo, Japan). The stained LDs were dissolved in isopropanol and quantified by measuring absorbance at 510 nm with a microplate reader (Synergy HTX).

Intracellular TG content and glucose consumption determination

TG determination kit (Applygen Technologies) was used to determine the cellular TG content. PSPAs at a density of 1 × 10⁶ cell/mL in each group were collected and were centrifugated at 1,000 rpm for 10 min. Cell precipitate was washed with PBS for three times, which was then lysed with 1% TritonX-100 for 30 min. Then, 96-well plates with 3 μL of the cell lysates and 300 μL of working solution were blended and incubated for 5 min at 37 °C, and the OD 500 values were detected by a microplate reader (Synergy HTX). The glucose (GLU) level in the cell culture media was detected by a glucose reagent kit (Applygen Technologies) according to instructions.

Lipolysis analysis

Lipolysis was evaluated by measuring the amount of glycerol and FFAs released to the media. Glycerol and FFA release in the cell culture media were measured accurately using a glycerol assay kit (Applygen Technologies) and a NEFA C test (Nanjing Jiancheng Bioengineering Institute, China), respectively.

Lipase activity assay (including HSL and ATGL)

Almost 10⁷ adipocytes were homogenized on ice for 30 min with 1 mL of homogenization buffer, and then were centrifuged at 12,000 rpm for 10 min at 4 °C. The BCA protein assay kit (Pierce Chemical Corp., Rockford, IL, USA) was used to determine the supernatant protein concentration. Triolein without glycerin which can be hydrolyzed to glycerol by lipolytic enzymes HSL and ATGL was used as a substrate. The supernatant with triolein was incubated at 37 °C for 1 h, then the triolein lipolytic degradation was activated by the supernatant lipases, and glycerol was released. A commercial kit (Applygen Technologies) was employed to determine the released glycerol. The activity of lipases was defined as nM released glycerol per milligram protein per hour.

RNA extraction and real-time PCR

TRIzol Total RNA Extraction Kit (Invitrogen Life Technologies) was used to extract the total RNA from PSPAs according to the manufacturer’s instructions, and then RNA was reverse-transcribed into cDNA with the PrimeScript First Strand cDNA Synthesis kit (no. D6110A, Takara). qRT-PCR was carried out with 2 μL 1:20 diluted cDNA, and gene expression levels were normalized to peptidylprolyl isomerase A (PPIA), after comparing with GAPDH and β-actin through NormFinder analysis. Data were shown as fold change compared with the CONT group. All primers used in the current study were synthesized by Genewiz Inc. (Suzhou, China) and listed in Table 1.

Table 1.

Primers used in the present study.

Name	Accession number	Primer sequence (5’-3’)
PPAR-γ	AF059245.1	F: GCCCTTCACCACTGTTGATT
		R: GAGTTGGAAGGCTCTTCGTG
C/EBP-α	AF103944.1	F: CGTGGAGACTCAACAGAAGG
		R: GCAGCGTGTCCAGTTCGCGG
FAS	EF589048.1	F: GTCCTGCTGAAGCCTAACTC
		R: TCCTTGGAACCGTCTGTG
ACC	EU168399.1	F: GGCCATCAAGGACTTCAACC
		R: ACGATGTAAGCGCCGAACTT
HSL	AY686758.1	F: ACCCTCGGCTGTCAACTTCTT
		R: TCCTCCTTGGTGCTAATCTCGT
ATGL	EF583921.1	F: ACCTGTCCAACCTGCTGC
		R: GCCTGTCTGCTCCTTTATCCA
Perilipin	AY973170.1	F: GCCTGACTTTGCTGGATGG
		R: CTTGGTGCTGGTGTAGGTCTTCT
PPIA	NM_214353.1	F: TCCTCCTTGGTGCTAATCTCGT
		R: TGATCTTCTTGCTGGTCTT

Western blotting

Total proteins of porcine adipocytes were extracted using RIPA lysis buffer containing 2 mM EDTA, 100 mM NaCl, 5% SDS, 50 mM NaF, 0.1 mM Na₃VO4, 100 μM AEBSF, 1 mM benzamidine, 50 mM HEPES (pH 7.4), and 10 μg/mL aprotinin. Protein concentration was determined with the BCA Protein Assay Kit (Pierce Biotechnology). About 40 μg protein was mixed with loading buffer and were denatured for 5 min by boiling before being loaded on a 10% SDS-polyacrylamide gel. The proteins were transferred to nitrocellulose membranes after electrophoresis, and were blocked with 3% BSA for 90 min at room temperature. The membranes were then incubated with different polyclonal antibodies after washing with TBST repeatedly. β-actin was used as a reference protein. Goat anti-rabbit IgG peroxidase-conjugated secondary antibodies (Bioworld Technology) were used at a dilution of 1:10,000. Finally, using enhanced chemiluminescence with the LumiGlo substrate (Super Signal West Pico Trial Kit, Pierce), the bands were visualized and captured by VersaDoc 4000MP system (Bio-Rad, Hercules, CA, USA), and then Quantity One software (Bio-Rad) was used to calculate the value of band density automatically. Protein levels were showed as relative-fold change of the CONT cells. The western blotting was also performed five times independently (one western blot assay was done for each of the five replicates), with one representative experiment shown.

Inhibitor study

To further analyze the crosstalk of ERK1/2 and PKA signaling pathways involved in MSTN actions, PSPAs were preincubated for 30 min with 50 μM PD98059 (a pharmacological inhibitor of ERK1/2) or 1 µM H89 (a specific PKA inhibitor), respectively, and then were induced differentiation. Briefly, when the PSPAs reached 85%～90% confluence, they were randomly divided into three groups (n = 6/group): CONT group, 100 ng/mL MSTN administration group and 100 ng/mL MSTN with 50 μM PD98059 or 1 µM H89 group, then the PSPAs from three groups were all exposed to differentiation medium for another 48 h. Then the adipogenic differentiation and lipid accumulation as well as the expression of ERK1/2 and PKA signaling pathways related genes were detected.

Statistical analysis

Different groups were handled in a completely randomized design. All data were presented as the mean ± SEMs. Statistical analyses were carried out with Statistical Program for Social Sciences (SPSS) software 20.0 for Windows (SPSS Inc., Chicago, IL, USA). The differences were tested with the one-way ANOVA, followed by Duncan’s multiple comparisons test. A P-value of less than 0.05 was considered significant. Each experiment/assay was performed five times independently, with one representative experiment/assay shown.

Results

Cell viability and cytotoxicity assay for PSPAs after treatment with MSTN

Both CCK-8 and LDH assays were used to detect the cell viability and cytotoxicity of PSPAs after MSTN exposure for 48 h. Results showed that when compared with CONT cells, MSTN did not show any statistical difference on the cell viability at lower concentration less than 100 ng/mL (25 to 100 ng/mL), however, an increase in MSTN concentration (200 ng/mL) markedly promoted the proliferation (Figure 1A), indicating that MSTN did not affect the cell proliferation of PSPAs at maximum 100 ng/mL. This conclusion was also supported by cell viability assay based on LDH leakage into cell culture media from cells that significant changes were not observed at maximum 100 ng/mL MSTN during a 48-h incubation (Figure 1B). Both CCK and LDH release assay results confirmed that MSTN doses of up to 100 ng/mL were not cytotoxic to the PSPAs, therefore, 25 to 100 ng/mL MSTN is used for further treatment study.

Figure 1.

Effect of MSTN on cell viability and LDH leakage of PSPAs. PSPAs were differentiated and treated with various concentrations of MSTN for 48 h. Cell viability (A). LDH leakage assessment (B). Values are presented as mean ± SEM, n = 6/group. ^**P ＜ 0.01 vs. CONT cells.

MSTN decreased lipid accumulation and intracellular TG content during PSPAs differentiation

To investigate the effects of MSTN on lipid accumulation and intracellular TG content, PSPAs were cultured until 85%～90% confluence (Figure 2A), and then differentiation was induced using the standard MDI induction cocktail containing 0 (CONT, PBS vehicle), 25, 50, or 100 ng/mL of MSTN for 48 h. Lipid accumulation was observed and quantified after ORO staining. TG quantification kit was used to measure intracellular TG contents in parallel. Results showed that less LDs were observed in MSTN-treated PSPAs under the microscope, when compared with CONT cells (Figure 2B). ORO staining showed that positive rate of cytoplasmic ORO staining was obviously decreased, suggesting the inhibited lipid accumulation (Figure 2C). ORO staining quantification also presented reduced LDs in 25, 50, and 100 ng/mL MSTN-treated cells, the inhibiting rate was 24.8%, 58.3% (P < 0.05), and 72.8% (P < 0.01), respectively (Figure 2D). Furthermore, TG contents were also significantly reduced (Figure 2E). In addition, the MSTN-treated cells consumed less glucose compared with the CONT cells during the PSPAs differentiation (Figure 2F). Meanwhile, the functional activity of glycerol-3-phosphate dehydrogenase (GPDH), which plays a major role in lipid biosynthesis, was also suppressed when compared with CONT cells (Figure 2G). Collectively, these above results suggested that MSTN treatment inhibited lipid accumulation and TG content in PSPAs, specifically, 100 ng/mL MSTN cells presented the strongest inhibitory effect.

Figure 2.

Effect of MSTN on lipid accumulation and intracellular TG content during PSPAs differentiation. PSPAs were differentiated and treated with various concentrations of MSTN for 48 h, and lipid accumulation quantification was conducted using ORO staining and extraction. 85%–90% confluence of PSPAs (100×) (A). Representative lipid accumulation images were observed under a microscope (100×) (B). Lipid accumulation was monitored with ORO staining (100×) (C). ORO-stained intracellular lipids were then extracted and quantified by measuring the absorbance at 510 nm (D). Intracellular TG content by TG assay kit (E). Glucose consumption in the culture media (F). The functional activity of GPDH (G). Values are presented as mean ± SEM, n = 6/group. *P ＜ 0.05, ^**P ＜ 0.01 vs. CONT cells.

MSTN treatment increased FFA and glycerol release by stimulating lipolysis

LDs are considered critical for the management of cellular lipid stores, and can be hydrolyzed by lipolytic enzymes, the final step of which is the release of FFA and glycerol. Therefore, in order to assess the lipolytic effect of MSTN on lipid accumulation and intracellular TG contents in PSPAs, the release of FFA and glycerol in cell culture media were detected. As is shown in Figure 3A and B, when compared with CONT cells, both the FFA and glycerol release were significantly increased in MSTN-treated cells, indicating that MSTN promotes the process of lipolysis.

Figure 3.

Effect of MSTN on lipolysis in PSPAs. PSPAs were differentiated and treated with various concentrations of MSTN for 48 h, and the release of glycerol and FFA in the cell culture media was detected. Effect of MSTN on glycerol release (A). Effect of MSTN on FFA release (B). Values are presented as the mean ± SEM, n = 6/group. *P ＜ 0.05, ^**P ＜ 0.01 vs. CONT cells.

MSTN inhibited adipogenesis by activating ERK1/2 signaling pathway and repressing PPAR-γ as well as related adipogenic genes expression

As above data indicated that maximum 100 ng/mL MSTN inhibited lipid accumulation and TG content of PSPAs without affecting the cell viability, the final concentration of 100 ng/mL was used to evaluate the effect of MSTN on key adipogenic genes expression. Results showed that when compared with the CONT cells, the mRNA expression of PPAR-γ and C/EBP-α, two key activators of adipogenesis, as well as related de novo lipogenesis key enzymes FAS and ACC were all significantly decreased in 100 ng/mL MSTN treated cells (Figure 4A). Consistently, the protein levels of PPAR-γ, C/EBP-α, FAS, and ACC showed the same results as the mRNA expression (Figure 4B and C). These results demonstrated that MSTN could inhibit adipogenesis and lipogenesis, mainly through repressing the expression of PPAR-γ and simultaneously inhibiting multidirectional adipogenic genes.

Figure 4.

Effect of MSTN on ERK signaling pathway and related adipogenic genes expression in PSPAs. The mRNA expression and protein levels of PPAR-γ, C/EBP-α, FAS, and ACC (A–C). The phosphorylated ERK1/2 expression (D–E). Values are presented as mean ± SEM, n = 6/group. *P ＜ 0.05, ^**P ＜ 0.01 vs. CONT cells. ^&&P ＜ 0.01 vs. MSTN cells.

Numerous studies have suggested that MAPKs signaling pathways can inhibit adipocyte differentiation by suppressing diverse transcription factors (Bost et al., 2005), among which the ERK1/2 signaling pathway activation has been reported to play critical roles in controlling adipogenesis by regulating PPAR-γ. To further elucidate signaling pathways underlying the inhibition of PPAR-γ expression and adipogenesis upon MSTN exposure, we next examined whether ERK1/2 signaling pathway was activated or not. Results showed that 100 ng/mL MSTN treatment markedly increased the phosphorylation of ERK1/2 when compared with CONT cells (Figure 4D and E). These results suggested that MSTN inhibited PPAR-γ expression and adipogenesis in PSPAs was related with the ERK1/2 activation.

Chemical inhibition of ERK signaling pathway attenuate the reduced lipid accumulation of MSTN in PSPAs by reversing PPAR-γ expression

We next sought to determine whether repressed lipid accumulation upon MSTN exposure could be reversed by chemical inhibition of ERK1/2 signaling pathway. As shown in Figure 5, when compared with MSTN alone-treated cells, ERK inhibitor PD98059 pretreatment significantly increased the mRNA expression of PPAR-γ and C/EBP-α as well as FAS and ACC (Figure 5A), the protein level of PPAR-γ was also obviously elevated, which was followed with reduced phosphorylation of ERK1/2 (Figure 5B and C). In line with above results, higher positive rate of cytoplasmic ORO staining, increased lipid accumulation (Figure 5D and E) and intracellular TG content (Figure 5F) were also observed in PD98059 and MSTN cotreated cells. Once again, these results confirmed that MSTN inhibited adipogenesis and thereby reduced the lipid accumulation and TG content via ERK1/2 phosphorylation and PPAR-γ suppression.

Figure 5.

Chemical inhibition of ERK signaling pathway on the lipid accumulation in PSPAs. The mRNA expression of PPAR-γ, C/EBP-α, FAS, and ACC (A). The protein levels of PPAR-γ and p-ERK1/2 (B–C). Lipid accumulation under a microscope (100×) and ORO-stained lipids (200×) in cells after chemical inhibition of ERK1/2 signaling pathway by ERK inhibitor PD98059 (D). Lipid contents were quantified based on the absorbance values at 510 nm of destained ORO extracted from the cells (E). Intracellular TG content (F). Values are presented as mean ± SEM, n = 6/group. *P ＜ 0.05, ^**P ＜ 0.01 vs. CONT cells. ^&&P ＜ 0.01 vs. MSTN cells.

MSTN promoted lipolysis by activating PKA signaling pathways and increasing key lipolytic genes expression

To further clarify the lipolytic effect of MSTN in the PSPAs, the phosphorylation of the lipolysis signal cAMP-dependent PKA, as well as the expression of its downstream hydrolysis enzymes HSL, ATGL, and anti-lipolytic protein perilipin were detected by qRT-PCR and western blot. Our results showed that when compared with the CONT cells, 100 ng/mL MSTN significantly activated the PKA phosphorylation (Figure 6A and B). Simultaneously, the protein level of lipolytic enzyme ATGL, the phosphorylation of HSL (p-HSL) and perilipin (p-perilipin) were all significantly increased, which revealed that p-perilipin facilitated lipolysis by interacting with p-HSL and promoting its translocation from cytoplasm to the surface of LDs (Figure 6A and B). Furthermore, not only the mRNA expression of HSL and ATGL, but also the lipolytic lipases activity (including both ATGL and HSL) were all increased, while perilipin mRNA expression was significantly decreased (Figure 6C and D), presenting the consistent results as the protein levels. Collectively, these above results demonstrated again that MSTN promoted lipolysis in PSPAs, mainly through the activation of PKA signaling pathway and perilipin phosphorylation, and subsequent HSL and ATGL phosphorylation and translocation.

Figure 6.

Effect of MSTN on PKA signaling pathway and the expression of related lipolytic enzymes in PSPAs. The protein levels of ATGL, p-HSL, p-Perilipin, and p-PKA (A–B). The relative mRNA expression of HSL, ATGL, and Perilipin (C). The activity of lipolytic lipases (including ATGL and HSL) (D). Values are presented as mean ± SEM, n = 6/group. *P ＜ 0.05, ^**P ＜ 0.01 vs. CONT cells.

PKA signaling pathway inhibition reversed MSTN induced lipid accumulation repression

In addition to the serial inhibition of transcriptional regulators and activation of lipolytic factors, modulation of intracellular signaling pathways is also essential for lipid accumulation. Two of the well-characterized signaling pathways are the MAPK and the PKA pathways, both of which usually do not operate independently of each other, but multiple crosstalk events between these pathways can occur. For example, it has been shown that PKA is the upstream of the ERK pathway. It is possible that PKA activation results in phosphorylated ERK1/2. Although we have demonstrated the involvement of PKA pathway in the process of lipolysis, and ERK1/2 pathways in adipogenic differentiation. However, the functions of ERK1/2 in lipolysis and the crosstalk with PKA pathway in lipolytic effect of MSTN in PSPAs are still unclear. Therefore, we next sought to determine whether repressed lipid accumulation upon MSTN exposure could be reversed by chemical inhibition of PKA signaling pathway. Results showed that when compared with single MSTN treated cells, H89 pretreatment significantly decreased the phosphorylation of PKA and ERK1/2, followed by increased expression of PPAR-γ, while the p-HSL and p-perilipin were significantly decreased (Figure 7A–C), which was in line with increased lipid accumulation (Figure 7D–G) and intracellular TG content (Figure 7H) as well as decreased FFA and glycerol release (Figure 7I and J). Once again, these results confirmed that MSTN presented lipolytic effect and thereby reduced the lipid accumulation via activation of PKA and subsequent ERK1/2 phosphorylation.

Figure 7.

Chemical inhibition of PKA signaling pathways on lipid accumulation in PSPAs. The mRNA expression of PPAR-γ, HSL, and Perilipin after PKA signaling pathways inhibition with PKA inhibitor H89 (A). The protein levels of PPAR-γ, p-HSL, p-Perilipin, p-PKA, and p-ERK (B–C). Lipid accumulation under a microscope (100×) and ORO stained lipids (200×) in cells (D–F). Lipid contents were quantified based on the absorbance values at 510 nm of destained ORO extracted from the cells (G). Intracellular TG content (H). FFA and glycerol release in the cell culture media (I–J). Values are presented as mean ± SEM, n = 6/group. *P ＜ 0.05, ^**P ＜ 0.01 vs. CONT cells. ^&P ＜ 0.05, ^&&P ＜ 0.01 vs. MSTN cells.

The fundamental mechanism of MSTN inhibited lipid accumulation by governing the adipogenesis and lipolysis of PSPAs is summarized in Figure 8.

Figure 8.

Summary of the proposed mechanism by which MSTN governs the lipid accumulation of PSPAs by activating PKA and ERK1/2 crosstalk signaling pathways.

Discussion

Domestic animals have been widely studied for more efficient growth and consumers’ higher pursuit of meat quality. One of the most important indicators affecting meat quality is fat deposition, a complex physiological and biochemical process involving in multiple transcription activators and lipolytic enzymes (Zhang et al., 2019b; Chen et al., 2020). Since preadipocytes and muscle precursor cells are derived from the same stem cells pool, research on the active substances secreted by muscle cells regulating preadipocytes differentiation, which means the “crosstalk” between these two endocrine organs (Hausman and Poulos, 2004), has become a hot topic in both livestock and biomedical fields in recent years.

Four types of fat depots mainly exists in animal body, subcutaneous, visceral, intermuscular, and intramuscular fat. As the most important economic trait affecting meat quality, genetic approaches for IMF have been focusing on different meat animals (Estany et al., 2017). However, major efforts should be made to clarify the deposition of subcutaneous fat, since it is the main organ storing excess energy of body and also an important traits directly affect economic value and meat quality. Especially in pigs, the main fat storage type is subcutaneous fat, however its commercial value is extremely low. Excessive deposition of subcutaneous fat will eventually lead to waste of feed and increased production costs in pig industry (Hausman et al., 2009; Wei et al., 2018). In addition, pig has the strongest ability to deposit fat and is one of the ideal research models for studying metabolic diseases, for the reason that pigs and humans share high similarities in a slew of phenotypic and physiological characters (Vodicka et al., 2005; Bendixen et al., 2011). As such, identifying genes regulating subcutaneous fat deposition may produce benefits for both animal production and human health disciplines.

Adipocytes (main component of adipose tissues) initially originate from an existing pool of preadipocytes, which are easy to be differentiated and overloaded with TG basing on further adipogenic stimulation, also the mature adipocytes can be dedifferentiated by promoting lipolysis. In view of this, exploring potential mechanisms involved in proliferation, adipogenesis and lipolysis at the cellular and molecular levels has received more and more concern (Ntambi et al., 2000). Research have developed a better knowledge of adipogenesis and lipolysis, mostly using the 3T3-L1 cell line. However, adipogenesis and lipolysis in this cell line can not always represent that of other species. Here, primary cultured PSPAs were selected, mainly because that the biological characteristics of primary cells are much closer to the physiological state of the pig, which is more conducive to screen target genes in regulating adipogenesis.

Numerous in vivo and in vitro studies have confirmed the crucial role of MSTN in suppressing the myocytes proliferation (Kumar et al., 2018; Zhang et al., 2018; Huang et al., 2019). We found in the present study that lower concentrations of MSTN (25, 50, and 100 ng/mL) had no effect on the cell proliferation of PSAP, while higher concentration of MSTN (200 ng/mL) could significantly increase the proliferation of PSAP, which is consistent with previous results obtained from 3T3-L1 cells (Li et al., 2011; Zhu et al., 2015). However, why higher concentration of MSTN was able to promote the proliferation of PSAP needs our further study, we suspected that it might be related to the secretion of IGF1, and a previous study in 3T3-L1 indeed showed that MSTN promoted the proliferation by stimulating IGF1 secretion (Zhu et al., 2015). Here, our main aim was to determine the adipogenic and lipolytic effect of MSTN, hence, the maximum concentration of 100 ng/mL was employed in the following analyses.

Preadipocytes can be differentiated into lipid-storing mature adipocytes, in which TG accounts for 90% of the intracellular lipids in the late differentiation stage. Here, the lipid accumulation and intracellular TG content were determined by both TG assay kit and semi-quantitative ORO staining, which is a lipophilic dye that can be combined with intracellular LDs and can be considered as a classic method reflecting the adipogenic differentiation. In the study, ORO staining and extraction result as well as TG content assay all showed reduced lipid accumulation and intracellular TG content after MSTN exposure, which was consistent with previous results obtained from human bone marrow mesenchymal stem cells (hBMSCs), 3T3-L1 cell line and intramuscular preadipocytes of bovine and pigs (Kim et al., 2001; Hirai et al., 2007; Zhu et al., 2015), all of which uniformly corroborated our conclusion and revealed that MSTN inhibited the adipogenesis in vitro studies. Although suppression of body fat accumulation in MSTN-deficient mice was obtained (McPherron and Lee, 2002), most in vivo studies also demonstrated the inhibition effect of MSTN on adipogenesis, supporting that adipose-specific hyperexpression of MSTN leaded to reduced fat mass and improved insulin sensitivity (Feldman et al., 2006). Furthermore, limited in PSPAs, the only one existing report we found was slightly different from our conclusion which showed no significant effect of MSTN on adipogenesis (Deng et al., 2012), one explanation for the discrepancy may be the different pig breeds, age, and MSTN doses were used in these two experiments. Therefore, although the effect of MSTN on adipogenesis is known currently (Chu et al., 2017; Deng et al., 2017, 2020), we further confirmed the negative roles of MSTN in regulating porcine adipogenesis, especially in Meishan pigs, a typical Chinese indigenous obese breed, which is regarded among the world’s most prolific breeds. It not only has diverse excellent characteristics such as desirable meat quality, high resistance to crude feed, high resistance to disease, docile temperament and good adaptability to the local environment, but also has undesired characteristics such as excess subcutaneous fat deposition, slow growth, and low proportion of carcass (Wang et al., 2019b; Zhao et al., 2021).

In mature adipocytes, when exposed to lipolytic stimulators, TG can be hydrolyzed into glycerol and FFA, both of which can account for lipolysis and fat mobilization. We showed that MSTN exposure increased the release of glycerol and FFA when compared with the CONT cells, indicating that MSTN activated intracellular lipolysis process. Both the intracellular TG and the FFA and glycerol release results showed that 100 ng/mL MSTN showed the strongest lipolytic effect while did not change the cell viability, therefore, only CONT and 100 ng/mL MSTN cells were used in the following experiment.

TG deposition is largely determined by mutual velocity of two simultaneous processes, adipogenesis and lipolysis. PPAR-γ and C/EBP-α play critical roles in adipogenesis. In our current study, we found that MSTN significantly reduced PPAR-γ and C/EBP-α expression, which was consistent with previous results obtained from 3T3-L1 cells (Kim et al., 2001; Zhu et al., 2015) and porcine intramuscular fat cells (Sun et al., 2016). Furthermore, the reduced expression of FAS and ACC, two key enzymes of de novo lipogenesis was also observed, indicating repressed de novo lipogenesis, and this result can be partially explained by PPAR-γ inhibition, since previous study demonstrated that PPAR-γ could drive the expression of key lipogenic enzymes. We then further clarified whether the ERK1/2 signaling pathway was responsible for downregulated PPAR-γ and exhibited the anti-adipogenic effect by determining the ERK1/2 expression, since a series of evidence showed that the activation of MAPKs signaling was involved in inhibiting lipid accumulation by regulating PPAR-γ expression. As expected, we found that the ERK1/2 signaling was indeed activated, suggesting that ERK1/2 signaling was involved in MSTN repressed differentiation (Yang et al., 2006). In addition, chemical inhibition of ERK signaling pathway attenuated the MSTN-reduced lipid accumulation in PSPAs by reversing PPAR-γ expression. All these results indicated that ERK1/2 signaling pathway activation was involved in MSTN inhibited adipogenesis in PSPAs by inhibiting PPAR-γ and then reduced lipogenesis, which were agreed with previous studies in 3T3-L1 cells that phosphorylated ERK1/2 inhibited adipogenesis by decreasing PPAR-γ (Hu et al., 1996). In contrast, others in human mesenchymal stem cells (HMSCs) and 3T3-L1 adipocytes reported a positive role of ERK1/2 activation in adipogenesis (Prusty et al., 2002). We speculate that these opposite effects on adipogenesis of ERK1/2 activation may be related to the activation at different periods during differentiation.

Adipocyte lipolysis is a complex process involving the cooperative participation of several lipolytic enzymes and LDs-related proteins. Under physiological state, perilipin, a major protective protein of the LDs, can inhibit lipids hydrolysis by preventing key lipolytic enzymes HSL and ATGL from approaching LDs, while under the lipolysis stimulator, perilipin can be phosphorylated by PKA, then HSL and ATGL can be ectopically phosphorylated and co-localized with phosphorylated perilipin on the surface of LDs, thereby stimulating lipolysis. As was consistent with the previous result in 3T3-L1, our result here also showed that MSTN stimulated lipolysis (increased release of FFA and glycerole), furthermore, we demonstrated that the increased expression of HSL and ATGL (Occupies more than 95% of lipolytic enzymes in white adipocytes) resulted in MSTN triggered lipolysis. In addition, we further indicated that elevated HSL phosphorylation was associated with activated PKA signaling and decreased perilipin, suggesting that enhanced lipolysis was determined by the phosphorylated PKA and decreased perilipin, and thereby phosphorylated HSL. Furthermore, combining our above results with previous reports, in addition to the activation of the PKA pathway, decreased perilipin expression and HSL phosphorylation can be also resulted from ERK/PPAR-γ pathway inhibition, since previous experiments have reported that downregulated PPAR-γ was able to promote lipolysis by downregulating perlipin (perlipin gene promoter region has a binding element of PPAR-γ) and upregulating ATGL and HSL expression (Puckett et al., 2020; Kuppusamy et al., 2021).

Increased HSL phosphorylation results in elevated hydrolytic activity, translocation of HSL from cytosol to the LDs surface and enhanced TG breakdown in adipocytes. In addition to the PKA-mediated phosphorylation, HSL can be also phosphorylated by other signaling such as ERK1/2 (Jaworski et al., 2007). Despite the involvement of ERK signaling in adipogenesis, we speculated that the activated ERK signaling was also contributed to the enhanced lipolysis, by decreasing perilipin expression. Actually, accumulated evidence in 3T3-L1 and human adipocytes have already showed that ERK activation was an early signal for perilipin inhibition, which directly stimulated the lipolysis by phosphorylating HSL (Puckett et al., 2020). These above results jointly suggested that both PKA and ERK signaling pathways activation reinforced the lipolysis by MSTN. However, the crosstalk between those two pathways in MSTN lipolysis function needs further clarified. To test this possibility, H89 (an inhibitor of PKA) was used to block the PKA pathway during PSPAs lipolysis, and results showed that both MSTN-induced lipolysis and perilipin inhibition were significantly reversed in the presence of H89, indicating that MSTN-stimulated lipolysis, defined by perilipin inhibition and HSL phosphorylation, was through both the PKA and ERK1/2 signaling pathways. These above results suggested that a crosstalk existed between these two pathways in MSTN-repressed TG content and lipid accumulation, while the PKA activation might play crucial roles.

Conclusion

Altogether, this study presented the first experimental evidence for the functional roles of MSTN action as a negative regulator of porcine SCA deposition by the crosstalk between the PKA and ERK1/2 pathways, which thus decreased adipogenesis and increased lipolysis by inhibiting PPAR-γ, and stimulating perilipin and HSL phosphorylation. These findings provide a comprehensive basis for the inhibitory effect of hyperexpression of MSTN on adipogenic differentiation and subcutaneous fat deposition, thus giving us a novel clue for understanding the mechanism of the molecular regulation of SCA in pigs.

Glossary

Abbreviations

ACC

acetyl-CoA carboxylase

ATGL

adipose triglyceride lipase

cAMP

cyclic AMP

C/EBP-α

CCAAT/enhancer binding protein-α

DMEM

Dulbecco’s modified eagle’s media

ERK1/2

extracellular signal-regulated kinases 1 and 2

FAS

fatty acid synthetase

FBS

fetal bovine serum

HSL

hormone-sensitive lipase

IBMX

isobutyl-1-methylxanthine

MAPK

mitogen-activated protein kinases

MSTN

myostatin

ORO

oil red O

PKA

protein kinase A

PPAR-γ

peroxisome proliferator-activated receptor-γ

PPIA

peptidylprolyl isomerase A

PSPAs

porcine subcutaneous preadipocytes

RT-PCR

quantitative real-time polymerase chain reaction

SPSS

statistical program for social sciences

SCA

subcutaneous adipose tissue

TG

triglyceride

Conflicts of interest statement

The authors declare that they have no competing interests.

Author Contributions

L.Z. and Z.L. conducted the experiments, analyzed the data, and wrote the manuscript. H.X. and S.P. critically revised the manuscript. All authors have read and given approval of the final manuscript.

Data Availability

The datasets used and/or analyzed in the present study are available from the corresponding author on reasonable request.