Skip to main content
PLOS One logoLink to PLOS One
. 2022 Jan 4;17(1):e0259386. doi: 10.1371/journal.pone.0259386

The pathogenic biomarker alcohol dehydrogenase protein is involved in Bacillus cereus virulence and survival against host innate defence

Devon W Kavanaugh 1, Constance Porrini 1, Rozenn Dervyn 1, Nalini Ramarao 1,*
Editor: Vijay Tripathi2
PMCID: PMC8726459  PMID: 34982789

Abstract

Bacillus cereus is a spore forming bacteria recognized among the leading agents responsible for foodborne outbreaks in Europe. B. cereus is also gaining notoriety as an opportunistic human pathogen inducing local and systemic infections. The real incidence of such infection is likely underestimated and information on genetic and phenotypic characteristics of the incriminated strains is generally scarce. We have recently analyzed a large strain collection of varying pathogenic potential. Screening for biomarkers to differentiate among clinical and non-clinical strains, a gene encoding an alcohol dehydrogenase-like protein was identified among the leading candidates. This family of proteins has been demonstrated to be involved in the virulence of several bacterial species. The relevant gene was knocked out to elucidate its function with regards to resistance to host innate immune response, both in vitro and in vivo. Our results demonstrate that the adhB gene plays a significant role in resistance to nitric oxide and oxidative stress in vitro, as well as its pathogenic ability with regards to in vivo toxicity. These properties may explain the pathogenic potential of strains carrying this newly identified virulence factor.

Introduction

Bacillus cereus is an ubiquitous spore forming human pathogen. It is present in soil, foods, almost all surfaces in hospital settings, and human skin. It is the second leading cause of collective foodborne outbreaks in France after Staphylococcus aureus and the third in Europe [13]. B cereus was associated with 155 outbreaks, 1,636 illnesses and 44 hospitalizations in Europe in 2019 according to reports by 27-member states. B. cereus can induce two types of gastrointestinal diseases, leading to emetic or diarrhoeal syndromes. B. cereus can also cause severe systemic infections, especially in immunocompromised patients leading to patient death in approximately 10% of cases [49]. However, some B. cereus strains can cause severe and even fatal infections in healthy people [10]. The pathogenic potential of B. cereus is thus extremely variable, with some strains being harmless and others lethal [11].

B. cereus produces toxins such as Hbl, Nhe, and CytK that induce cell toxicity [1214]. In addition, other factors such as HlyII, InhA1, CwpFM or Mfd have been implicated in B. cereus resistance against the host immune system [1521]. These toxins provide an indication of the strain toxicity potential [13, 2224]. However, these factors do not allow the discrimination of strains according to their pathogenicity. Indeed, several studies have shown that the Nhe production by hazardous strains is variable and that non-pathogenic strains can also produce it in large quantities [1, 24]. Moreover, these toxins do not appear to be suitable markers for strains causing non-gastrointestinal infections [22].

B. cereus strains that induced severe gastrointestinal or non-gastrointestinal disorders do not carry neither hbl, ces, hlyII, cytK1 nor cytK2 genes and did not produce the Nhe protein, implying that other still unknown factors were responsible for their pathogenicity [1, 11].

Accordingly, we have recently analyzed a large strain collection comparing strains that induced an infection (intestinal or otherwise) with non-pathogenic strains [11, 25]. The large strain screening allowed to identify a combination of four as yet undescribed biomarkers, wherein their presence/absence allows an accurate identification of clinical B. cereus strains [26]. Three of these genes are located on the bacterial chromosome, and the fourth one is located on a large plasmid in a region that could be defined as a novel pathogenicity island for B. cereus [27]. These findings constitute a huge step in the understanding of the B. cereus pathogenic potential and complexity and may provide tools to better assess the risks associated with B. cereus contamination. Among these genes, adhB, was identified as a leading candidate [26]. This adhB gene encodes an alcohol dehydrogenase-like protein (ADH). This family of enzymes is involved in oxidation-reduction biological process. ADH are involved in metabolic and physiological processes in a variety of organisms, including fermentative metabolism [28], the oxidation of alcohols as carbon and energy sources [29], protection against anaerobic stress [30], and maintenance of the intracellular redox balance [31].

In this study, the adhB gene was knocked out to better elucidate its function during B. cereus virulence. Our results demonstrate that adhB plays a significant role in resistance to nitric oxide (NO) and oxidative stress in vitro, as well as its pathogenic ability with regards to in vivo infection and toxicity. These properties may explain the pathogenic potential of strains carrying this newly identified virulence factor.

Materials and methods

Bacterial strains

This study includes 35 B. cereus strains isolated from human patients following systemic or local infections and 21 non-pathogenic strains (Table 1). The 35 strains of the clinical collection were isolated from patient samples (biopsy, blood culture, etc) from nine French voluntary hospitals between 2008 and 2014. The samples and information were collected for a previous study and were treated anonymously and thus not subjected to personal consent [22]. The non-pathogenic strains have been isolated from food, where no infection was reported in humans. They were further tested in cell and animal models and did not induce any pathologies [23, 25]. We have previously shown a correlation between cytotoxicity and virulence [11]. Nevertheless, although these strains had previously been shown to be weakly cytotoxic to human cells and to have reduced virulence in an insect infection model, this does not rule out their potential ability to produce symptoms in specific vulnerable populations (i.e. the elderly, immunocompromised, or premature/new-born babies).

Table 1. Characteristics of non-pathogenic (A) and clinical (B) strains.

A
Non-pathogenic strains Source adhB
INRA-PF_S09 Milk protein 0
I13_S10 Cooked rice 1
INRA-5_S11 Pasteurized zucchini puree 0
INRA-C64_S12 Pasteurized vegetables 0
ADRIA-I3_S13 Cooked foods 0
INRA-BN_S36 Vegetable 1
INRA-PA_S37 Milk protein 0
INRA-A3_S38 Starch 1
I23_S39 Cooked apple 0
SB_S40 Soil from a vegetable field 0
I11_S41 Cooked food 1
INRA-C1_S42 Pasteurized vegetables 0
INRA-C46_S43 Pasteurized vegetables 0
INRA-SL_S44 Soil 0
INRA-SO_S45 Soil 0
INRA-BC_S47 Vegetable 1
I2_S48 Dried fruit 0
INRA-BL_S49 Vegetable 0
ADRIA I21_S50 Cooked foods 0
INRA-SV_S51 Soil 0
WSBC 10204_S52 Pasteurized milk 0
B
Clinical strains Age of patients Type of sampling Symptoms Outcomes adhB
09CEB13BAC_S6 Premature newborn Blood culture Brain abscess Recovery 1
09CEB14BAC_S7 Premature newborn Blood culture Bacteremia Recovery 1
09CEB33BAC_S8 Newborn Axilla-later feces Skin infection Recovery 1
12CEB31BAC_S14 Premature newborn Blood culture Organ failure and pulmonary and cerebral abscesses Death 1
13CEB06BAC_S15 86 Blood culture from catheter Heart failure, ventilator-associated pneumonia, ischemic stroke Recovery 1
09CEB11BAC_S16 Premature newborn Blood culture Meningitis, infection in the liver, both lungs Death 1
09CEB16BAC_S17 Newborn Umbilical Local colonization Recovery 1
12CEB30BAC_S18 Premature newborn Blood culture Sepsis Recovery 1
12CEB40BAC_S20 63 Blood culture Bacteremia and central venous catheter-linked infection Recovery 1
12CEB46BAC _S21 61 Blood culture Sepsis (patient with an acute myeloid leukemia) Recovery 1
12CEB47BAC_S22 43 Blood culture Bacteremia Recovery 1
12CEB51BAC_S23 60 blood culture Sternum abscess, absent fever Sequela of osteitis 1
13CEB01BAC_S24 31 Prosthesis from tibia No clinical sign of infection Recovery 1
09CEB12BAC_S53 Premature newborn Cerebrospinal fluid Meningitis, infection in the liver, both lungs Death 1
09CEB34BAC_S59 Premature-newborn Stomach-tube feeding Premature birth Recovery 1
09CEB36BAC_S61 Premature-newborn Central venous catheter Bacteremia Recovery 1
12CEB34BAC_S64 80 Thoracentesis Pulmonary infection not known 1
12CEB37BAC_S90 30 Blood culture Endocarditis Death 1
12CEB38BAC_S91 65 Blood culture Sepsis Death 1
12CEB39BAC_S92 54 Blood culture Sepsis Recovery 1
12CEB42BAC_S94 63 Blood culture Bacteremia and central venous catheter-linked infection Recovery 1
12CEB43BAC_S95 63 Blood culture Bacteremia and central venous catheter-linked infection Recovery 1
12CEB44BAC_S96 34 Blood culture Bacteremia Recovery 1
12CEB45BAC_S97 newborn Blood culture Kidneys and urinary infections Recovery 1
12CEB48BAC_S98 66 Blood culture Bacteremia (patient with a colorectal cancer) Recovery 1
12CEB49BAC_S99 24 Blood culture+ skin infection Sepsis and aplastic anemia caused by drugs Recovery 1
12CEB50BAC_S100 77 Blood culture Bacteremia (patient with breast cancer) Recovery 1
12CEB52BAC_S101 40 Blood culture Bacteremia (immunocompromised patient) Recovery 0
13CEB03BAC_S102 76 Blood culture Community acquired pneumonia Recovery 1
13CEB07BAC_S105 24 Blood culture Abdominal pain, shivering, vomiting, fever, diarrhea Recovery 1
13CEB09BAC_S106 85 Liver abscess Sepsis, hepatitis c and liver abscess, abdominal pain, diarrhea Recovery 1
13CEB30BAC_S107 not known Blood culture Nausea, abdominal pain and vomiting not known 1
14CEB16BAC_S114 Premature newborn Blood culture from peripheral veins Septic shock, multiple organ failure, pulmonary and cerebral abscesses Death 1
14CEB17BAC_S115 Premature newborn Bronchial aspiration (lung) Septic shock and pneumonia Death 1
pulmonary necrotic abscesses, recurrent pneumothorax
14SBCL987_S116 not known Biopsy (kidney) Vomiting and diarrhea Death 1

The absence (0) or presence (1) of the adhB gene was detected by PCR.

adhB gene detection by PCR

For all the strains, a single colony was picked, resuspended in 100 μL Tris-EDTA NaCl buffer (TEN) and incubated at 98°C for 10 min. After centrifugation to pellet cell debris, 1 μl of supernatant was used as DNA matrix. The PCR mixture for gene detection contained 1 μl DNA matrix, 0.5 μM primer (forward: TTATTATCTATTCTTTCGTGTGATGC, and reverse CTATTTGTAGCAGAACATTCRAAACC), 10 μL DreamTaq Green PCR Master Mix (2X) (Thermo Scientific) in a final volume of 20 μL. Thermal cycling was carried out in a Mastercycler® nexus (Eppendorf) with the following program: a start cycle of 3 min at 98°C, followed by 30 cycles of 20 s at 98°C, 30 s at 55°C, and 1 min at 72°C, and a final extension time of 10 min at 72°C. PCR fragment sizes were revealed on 1.5% agarose gels containing Midori Green, and visualised by a UV imaging device as previously described [26].

adhB mutant generation

The Bt407 Cry- with the reference genome Bacillus thuringiensis Bt407: NC_018877.1 was used as a model for B. cereus and was renamed Bc 407.

Knock-out of the adhB gene (WP_000438843) was accomplished by double-cross over gene substitution by use of the pMAD vector [32]. Briefly, using the available sequencing information of the Bc407 strain, 600 bp regions upstream and downstream of the identified gene of interest were synthesized surrounding a tetracycline-resistance cassette by the GeneCust company (Boynes, France). The upstream nucleotide coordinates used are 2,575,680 to 2,576,279, and the downstream nucleotide coordinates are 2,577,204 to 2,577,802. The synthesized region was then ligated into the pMAD vector. This vector was further transformed by heat shock into chemically competent NEB-10 beta cells. The plasmid was then extracted and transformed into E. coli strain ET to facilitate de-methylation of the plasmid, increasing subsequent transformation into B. cereus Bc407 as previously described [16]. Resulting colonies were then subjected to temperature stress at 40°C to force the incorporation of the resistance cassette leading to the stable knock-out of the adhB gene, which was verified by PCR with oligonucleotide sequences flanking the cloned region. The mutation was stable and sequencing revealed that the mutation occurred at the corrected place and did not affect the flanking regions. The resulting strain was designated as ΔadhB.

Wild type and mutant strains were streaked onto BHI agar from 20% glycerol stocks to obtain isolated colonies. Colonies were inoculated into BHI broth and grown at 37°C, 200 rpm until mid to late-exponential phase for phenotypic analysis. Cultures in mid-exponential phase were used for microscopy to determine cellular morphology. For growth assays, stocks were inoculated into BHI broth and followed by sampling for CFU/ml at regular intervals.

Nitric oxide (NO) stress survival

B. cereus Bc407 and the ΔadhB mutant were grown to late-exponential phase. Cultures were harvested and diluted 1:1000 in RPMI (Gibco Glutamax, Fisher Scientific, Illkirch Cedex, France) and further grown at 37°C without agitation with differing doses of the NO donor, NOC-5 (3-[2-hydroxy-1-(1-methylethyl)-2-nitrosohydrazino]-1-propanamine (Calbiochem, Sigma-Aldrich, Saint-Louis, MO, USA). NOC-5 was dissolved in NaOH 0.01 M and used at the following concentrations: 0, 15.6, 25, 31.25, 50, 62.5, 100, 125, 250, 500 μM. After 1 h, bacteria were agitated to avoid sedimentation and the survival rate was quantified after 4 h by plating serial dilutions on LB agar plates. Data are pooled from two to four independent experiments and presented as % survival = (NO-treated/Buffer-treated) × 100.

Oxidative stress survival

Oxidative stress-resistance was determined as previously described [33]. Briefly, wild-type and ΔadhB mutant strains were grown and 2 h post-inoculation, 500 μl of each culture was added to 100 μl of either sterile water or hydrogen peroxide at final concentrations of 2 mM or 10 mM. Treated (2 mM or 10 mM H2O2) and control (H2O) cultures were incubated for 10 min at 37°C and then serially diluted in phosphate-buffered saline (PBS) and plated on BHI to stop the reaction and count CFU/ml. Data are pooled from two independent experiments and presented as % survival = (H2O2-treated/H2O-treated) × 100.

Insect infection trial

B. cereus Bc407 and the ΔadhB mutant were grown to exponential phase. Cultures were harvested and serially diluted 1:4 in peptone water prior to injection. 10 to 20 last instar Galleria mellonella larvae were used following a 24 h fast as previously described [34, 35]. 10 μl of bacterial preparations at various doses were injected between the second and third body segment from the rear of the insect. Injected insects were incubated at 37°C for 24 h, following which survival was assessed. Peptone water was injected as negative control. Data are pooled from three independent experiments and presented as % survival = (injected with strain/injected with water) x 100.

Protein bioinformatic analysis

The protein sequences of the ADH protein (WP_000438843) was analysed with Pfam to find functional domains. E-values are based on searching the Pfam-A family against UniProtKB 2018_04 using HMM search.

Statistical analysis

Statistical analysis was performed with GraphPad Prism version 7. Insect survival curves were assessed by non-linear regression, constraining the bottom to 0.

Bacterial survival rate following stresses were also analysed by non-linear regression, and the statistical differences were calculated with a Wilcoxon test between the conditions with or without stress.

Results

adhB as a marker of clinical B. cereus strains

The presence/absence of the adhB gene was assessed by PCR on a collection of strains of varying pathogenic potential: 21 non-pathogenic strains and 35 clinical strains (Table 1). adhB was present in 34/35 (97%) clinical isolates, whereas it was present in 5 of 21 (24%) non-pathogenic isolates. We thus hypothesised that adhB may be a new and important virulence factor of B. cereus.

The amino acid sequences of the Bc407 gene WP_000438843 coding for a protein of the AdhB family was analysed using the Uniprot database (Fig 1). This enzyme of 308 amino acids belongs to the zinc-containing alcohol dehydrogenase family. The software identified two domains, with the catalytic domain of the alcohol dehydrogenase containing an inserted zinc-binding domain. This domain has a GroES-like structure [36, 37]. The co-factor-binding domain of the enzyme is located proximal to the C-terminus. Structural studies indicate that it forms a classical motif called Rossman fold that reversibly binds NAD(H) as a co-factor [38, 39].

Fig 1. Structural domains of AdhB.

Fig 1

The AdhB protein of B. cereus is composed of a catalytic domain with an inserted zinc-binding domain (green box) and a co-factor-binding domain at its C terminus (red box). E-values are based on searching the Pfam-A family against UniProtKB 2018_04 using hmmsearch.

Growth characteristics and morphology

B. cereus Bc407 and the ΔadhB mutant were grown in BHI medium at 37°C, 200 rpm and bacterial growth was followed by measuring the OD600, and CFU/mL determined by serial dilution and plating (Fig 2A and 2B). The two strains presented similar rates of growth with no significant differences in growth curves. The strains were observed under the microscope and bacterial morphology shows that the two strains are similar in cellular shape and size, with the adhB mutant often making longer chains of cells (6–8 cells) (Fig 2C and 2D).

Fig 2. Bacterial growth curves and cellular morphology.

Fig 2

Bacterial growth was determined by calculating CFU/mL (A) or following optical density at 600 nm (B) for the wildtype B. cereus Bc407 (▲; solid line) and the ΔadhB mutant (●; dashed line) strains. Representative bacterial morphology of Bt407 WT (C) and adhB mutant (D) are viewed at 100x magnification. The scale bar represents a length of 10 μm. All graphs represent one representative experiment out of three biological replicates.

Nitric oxide (NO) and oxidative stress resistance

To assess the role of AdhB in the resistance to the host immune system response, B. cereus Bc407 and ΔadhB strains were incubated with the NO donor to test their resistance against NO stress (Fig 3). Several doses of NO were assessed and the dose inhibiting 50% of bacterial growth (IC50) was calculated. The IC50 of B. cereus wild type (WT) strain is approximately 4 times higher than that of the mutant (193 vs 45 μM of NO) and the survival rate of the mutant is lower at each concentration of NO tested. Thus, the mutant adhB is more sensitive to nitric oxide than the wild type strain.

Fig 3. NO sensitivity.

Fig 3

The wild type and ΔadhB mutant strains were cultured and incubated for 4 h in the presence of different concentrations of NO donors. Bacterial survival was quantified by plating and bacterial resistance to NO was measured and normalized with respect to the control condition, without NO. Data points correspond to the mean ± SEM of the values obtained from 2 to 4 biological replicates. The calculation of the IC50 of NO was performed using Graphpad.

Then, oxidative stress resistance of B. cereus Bc407 WT and ΔadhB strains was determined after exposure to 2 mM or 10 mM H2O2 for 10 min at 37°C (Fig 4). Wildtype Bc407 demonstrated increased resistance at both concentrations, with survival percentage being 14-fold higher at 2 mM, and 20-fold higher at 10 mM.

Fig 4. H2O2 sensitivity.

Fig 4

The wild-type and ΔadhB mutant strains were grown and subsequently exposed to either 2 mM or 10 mM of hydrogen peroxide for 10 min at 37°C. Bacterial survival was assessed by plating and normalized against buffer-treated controls. Data points correspond to the mean ± SEM of the values obtained from 2 biological replicates.

Insect model of B. cereus toxicity

The role of AdhB in the pathogenicity of B. cereus was assessed in an insect model of infection. B. cereus Bc407 and ΔadhB mutant strains were injected at various doses into Galleria mellonella larvae (Fig 5). At 24 h post-injection, survival of the insects was assessed. Insects infected with the ΔadhB mutant strain demonstrated higher rates of survival in relation to the wildtype strain, demonstrating a reduced virulence of the mutant strain. Further, statistical analysis of the survival curves reveals a significant difference in the LD50 values between the strains: 4.2 103 CFU/injection for the wildtype and 1.5 104 CFU/injection for the ΔadhB mutant. HillSlope determined the curves to be distinct at 99.94% probability.

Fig 5. Insect infection.

Fig 5

Bacterial virulence was determined as Galleria mellonella survival percentage following injection with varying CFU/mL of wild type (triangles, black line) or ΔadhB (circles, dashed line) mutant strains. Survival was measured as live insects following 24 h post-injection. Calculation of the LD50 was done using Graphpad software.

Discussion

Alcohol dehydrogenase (ADH) is an enzyme involved in oxidation-reduction biological process. It catalyses the reversible oxidation of alcohols and induces the formation of their corresponding acetaldehyde or ketone with the reduction of NAD (Fig 6). This class of enzyme typically has a broad spectrum of action [40, 41]. Here we characterized AdhB as a protein involved in B. cereus resistance to nitric and oxidative stresses, two major components of the host immune system, and in its pathogenicity.

Fig 6. Reaction catalyzed by an alcohol dehydrogenase.

Fig 6

The alcohol dehydrogenase catalyzes the oxidation of alcohol into their corresponding aldehyde (primary alcohol) or ketone (secondary alcohol) with the reduction of NAD+.

Currently three types of alcohol dehydrogenases are known, that differ structurally and catalytically: Zinc-containing ’long-chain’ alcohol dehydrogenases, ’short-chain’ alcohol dehydrogenases, and iron-containing alcohol dehydrogenases [42, 43]. The AdhB (WP_000438843) protein in B. cereus is a zinc-containing ADH. These enzymes are typically dimeric or tetrameric proteins, which require two atoms of zinc per subunit to be functional, however, catalytic activity is maintained in the presence of a single zinc atom. The zinc atoms interact with either cysteine or histidine residues; the catalytic zinc being coordinated by two cysteines and one histidine. Zinc-containing ADH’s are found in bacteria, mammals, plants, and fungi. Normally, there is more than one isozyme per species (e.g. humans possess at least six isozymes and yeast have three). Consistently, we identified three Zinc-containing ADH’s in the Bc407 strain (WP_000438843, WP_000649129.1, WP_000645827.1). These three isozymes share common structures with two identified domains (not shown). The first is the catalytic domain that might contain an inserted zinc-binding domain. This domain has a GroES-like structure; a name derived from the superfamily of proteins with a GroES fold. Proteins with a GroES fold structure have a highly conserved hydrophobic core and a glycyl-aspartate dipeptide, which is thought to maintain the fold. The second is the domain that binds its cofactor NAD owing to its motif denoted as a Rossman fold [38, 39].

In order to specify the role of AdhB in B. cereus, the virulence of the wild type and ΔadhB mutant was tested in an insect infection model. G. mellonella larvae were used as a model of infection as B. cereus is both a human and an insect pathogen [25, 44]. This study reveals that adhB plays an essential role during B. cereus virulence and could thus be considered as a new pathogenic factor.

During human or insect infections, B. cereus is able to resist the host immune system and persist. It can indeed survive phagocytosis by macrophages and can induce their apoptosis [20, 45]. The primary mechanism of macrophage-induced cytotoxicity is through the massive production of nitric oxide and oxidative stress at the peak of inflammation leading to bacterial death [46, 47]. Thus, bacterial response to NO is of major importance for bacterial survival and several pathogenic bacteria have developed means for detoxification and repair of the damages caused by NO [48]. We have previously shown that B. cereus is particularly resistant to NO [15, 18, 45, 49]. Here, we show that the ΔadhB mutant was more sensitive than the wildtype strain to both oxidative and nitric stresses. Accordingly, this sensitivity may be implicated in the reduced mutant virulence in the insect model.

The initial step of bacterial response to NO and oxidative response is the detection of reactive oxygen and nitrogen species (ROS and RNS), which will permit to activate the detoxification and repair pathways. It has been previously shown that virulence factor production by B. cereus is dynamic and shaped by cellular oxidation [50]. ADH proteins have been previously shown to be involved in the reduction of alcohol and the production of NADH. NADPH is required to maintain and regenerate the cellular detoxifying and anti-oxidative defense systems [51]. The antioxidant defense system of B. cereus is constituted by an elaborate, often overlapping network of enzymes [52], but to the best of our knowledge, there was no evidence of ADH implication in the resistance of oxidative or NO stress. As oxidative and NO response overlap during the immune response, it is not surprising that mechanisms of bacterial resistance against ROS and RNS share similarities. The reduction capacity of ADH may be involved in NO detoxification. Bacterial capacity to detoxify NO through reduction is widely distributed in denitrifying bacteria but is also present in pathogens. For denitrifying bacteria, the reduction of nitrate to N2 is part of the nitrogen cycle and prevents NO high toxicity; for pathogenic bacteria, NO detoxification might be a mean to survive under oxygen limited environments and to survive to nitrogen stress [46, 47, 53].

Taken together, we have identified a new virulence factor implicated in B. cereus resistance to host immunity whose activities may explain the pathogenic potential of clinical strains carrying this newly identified pathogenic biomarker.

Data Availability

All relevant data are within the manuscript.

Funding Statement

The author(s) received no specific funding for this work.

References

  • 1.Glasset B, Herbin S, Guiller L, Cadel-Six S, Vignaud ML, Grout J, et al. Large-scale survey of Bacillus cereus-induced food-borne outbreaks: epidemiologic and genetic characterization EuroSurveillance. 2016;21(48): 30413. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Stenfors Arnesen L, Fagerlund A, Granum P. From soil to gut: Bacillus cereus and its food poisoning toxins. FEMS Microbiol Rev. 2008;32:579–606. doi: 10.1111/j.1574-6976.2008.00112.x [DOI] [PubMed] [Google Scholar]
  • 3.Ramarao N, Lereclus D, Sorokin A. The Bacillus cereus group. Molecular Medical Microbiology. 2015; III(Second Edition):1041–78. [Google Scholar]
  • 4.Veysseyre F, Fourcade C, Lavigne JP, Sotto A. Bacillus cereus infection: 57 case patients and a literature review. Med Mal Infect. 2015;45(11–12):436–40. Epub 2015/11/04. doi: 10.1016/j.medmal.2015.09.011 [DOI] [PubMed] [Google Scholar]
  • 5.Bottone EJ. Bacillus cereus, a volatile human pathogen. Clin Microbiol Rev. 2010;23(2):382–98. doi: 10.1128/CMR.00073-09 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Ramarao N, Belotti L, Deboscker S, Ennahar-Vuillemin M, de Launay J, Lavigne T, et al. Two unrelated episodes of Bacillus cereus bacteremia in a neonatal intensive care unit. Am J Infect Control. 2014;42(6):694–5. doi: 10.1016/j.ajic.2014.01.025 [DOI] [PubMed] [Google Scholar]
  • 7.Gaur AH, Patrick CC, McCullers JA, Flynn PM, Pearson TA, Razzouk BI, et al. Bacillus cereus bacteremia and meningitis in immunocompromised children. Clinic Infect dis. 2001;32:1456–62. doi: 10.1086/320154 [DOI] [PubMed] [Google Scholar]
  • 8.Lotte R, Herisse AL, Berrouane Y, Lotte L, Casagrande F, Landraud L, et al. Virulence Analysis of Bacillus cereus Isolated after Death of Preterm Neonates, Nice, France, 2013. Emerg Infect Dis. 2017;23(5):845–8. doi: 10.3201/eid2305.161788 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Cormontagne D, Rigourd V, Vidic J, Rizzotto F, Bille E, Ramarao N. Bacillus cereus Induces Severe Infections in Preterm Neonates: Implication at the Hospital and Human Milk Bank Level. Toxins (Basel). 2021;13(2). doi: 10.3390/toxins13020123 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Hoffmaster AR, Hill KK, Gee JE, Marston CK, De BK, Popovic T, et al. Characterization of Bacillus cereus isolates associated with fatal pneumonias: strains are closely related to Bacillus anthracis and harbor B. anthracis virulence genes. J Clin Microbiol. 2006;44(9):3352–60. 44/9/3352. doi: 10.1128/JCM.00561-06 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Glasset B, Sperry M, Dervyn R, Herbin S, Brisabois A, Ramarao N. The cytotoxic potential of Bacillus cereus strains of various origins. Food Microbiol. 2021;98:103759. doi: 10.1016/j.fm.2021.103759 [DOI] [PubMed] [Google Scholar]
  • 12.Fagerlund A, Lindbäck T, Storset A, Granum P, Hardy S. Bacillus cereus Nhe is a pore forming toxin with structural and functional properties similar to ClyA (HlyE, SheA) family of haemolysins, able to induce osmotic lysis in epithelia. Microbiol. 2008;154:693–704. doi: 10.1099/mic.0.2007/014134-0 [DOI] [PubMed] [Google Scholar]
  • 13.Ramarao N, Tran SL, Marin M, Vidic J. Advanced Methods for Detection of Bacillus cereus and Its Pathogenic Factors. Sensors (Basel). 2020;20(9). doi: 10.3390/s20092667 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Guinebretière MH, Thompson, Sorokin A, Normand P., Dawyndt P., Ehling-Schulz M, et al. Ecological diversification in the Bacillus cereus Group. Environ Microbiol. 2008;10:851–65. doi: 10.1111/j.1462-2920.2007.01495.x [DOI] [PubMed] [Google Scholar]
  • 15.Darrigo C, Guillemet E, Dervyn R, Ramarao N. The Bacterial Mfd Protein Prevents DNA Damage Induced by the Host Nitrogen Immune Response in a NER-Independent but RecBC-Dependent Pathway. PLoS ONE. 2016;11(10):e0163321. doi: 10.1371/journal.pone.0163321 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Guillemet E, Cadot C, Tran SL, Guinebretiere MH, Lereclus D, Ramarao N. The InhA metalloproteases of Bacillus cereus contribute concomitantly to virulence. J Bacteriol. 2010;192(1):286–94. doi: 10.1128/JB.00264-09 . [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Haydar A, Tran SL, Guillemet E, Darrigo C, Perchat S, Lereclus D, et al. InhA1-Mediated Cleavage of the Metalloprotease NprA Allows Bacillus cereus to Escape From Macrophages Front Microbiol. 2018;23:1063. doi: 10.3389/fmicb.2018.01063 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Guillemet E, Lereec A, Tran SL, Royer C, Barbosa I, Sansonetti P, et al. The bacterial DNA repair protein Mfd confers resistance to the host nitrogen immune response. Sci Rep. 2016;6:29349. doi: 10.1038/srep29349 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Tran SL, Guillemet E, Gohar M, Lereclus D, Ramarao N. CwpFM (EntFM) is a Bacillus cereus potential cell wall peptidase implicated in adhesion, biofilm formation and virulence. J Bacteriol. 2010;192:2638–42. doi: 10.1128/JB.01315-09 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Tran SL, Guillemet E, Ngo-Camus M, Clybouw C, Puhar A, Moris A, et al. Hemolysin II is a Bacillus cereus virulence factor that induces apoptosis of macrophages. Cell Microbiol. 2011;13:92–108. doi: 10.1111/j.1462-5822.2010.01522.x [DOI] [PubMed] [Google Scholar]
  • 21.Tran SL, Cormontagne D, Vidic J, Andre-Leroux G, Ramarao N. Structural Modeling of Cell Wall Peptidase CwpFM (EntFM) Reveals Distinct Intrinsically Disordered Extensions Specific to Pathogenic Bacillus cereus Strains. Toxins (Basel). 2020;12(9). doi: 10.3390/toxins12090593 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Glasset B, Herbin S, Granier S, Cavalié L, Lafeuille E, Guérin C, et al. Bacillus cereus, a serious cause of nosocomial infections: epidemiologic and genetic survey. PLoS ONE. 2018;13(5):e0194346. doi: 10.1371/journal.pone.0194346 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Guinebretière MH, Broussolle V, Nguyen-The C. Enterotoxigenic profiles of food-poisoning and food-borne Bacillus cereus strains. J Clin Microbiol. 2002;40(8):3053–6. doi: 10.1128/JCM.40.8.3053-3056.2002 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Martinez-Blanch JF, Sanchez G, Garay E, Aznar R. Development of a real-time PCR assay for detection and quantification of enterotoxigenic members of Bacillus cereus group in food samples. Int J Food Microbiol. 2009;135(1):15–21. doi: 10.1016/j.ijfoodmicro.2009.07.013 [DOI] [PubMed] [Google Scholar]
  • 25.Kamar R, Gohar M, Jéhanno I, Réjasse A, Kallassy M, Lereclus D, et al. Pathogenic Potential of Bacillus cereus Strains as Revealed by Phenotypic Analysis. J Clin Microbiol. 2013;51:320–3. doi: 10.1128/JCM.02848-12 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Kavanaugh D, Glasset B, Dervyn R, Guérin C, Plancade S, Cormontagne D, et al. New genetic biomarkers to differentiate pathogenic and clinically relevant Bacillus cereus strains. Clin Microb Infect. 2021. 7:S1198-743X(21)00283-4. doi: 10.1016/j.cmi.2021.05.035 [DOI] [PubMed] [Google Scholar]
  • 27.Dervyn R, Kavanaugh DW, Cormontagne D, Glasset B, Ramarao N. Identification of a new pathogenicity island within the large pAH187_270 plasmid involved in Bacillus cereus virulence. Front. Cell. Infect. Microbiol. 2021;11:788757. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Callejas-Negrete OA, Torres-Guzman JC, Padilla-Guerrero IE, Esquivel-Naranjo U, Padilla-Ballesteros MF, Garcia-Tapia A, et al. The Adh1 gene of the fungus Metarhizium anisopliae is expressed during insect colonization and required for full virulence. Microbiol Res. 2015;172:57–67. doi: 10.1016/j.micres.2014.11.006 [DOI] [PubMed] [Google Scholar]
  • 29.Saliola M, Falcone C. Two mitochondrial alcohol dehydrogenase activities of Kluyveromyces lactis are differently expressed during respiration and fermentation. Mol Gen Genet. 1995;249(6):665–72. doi: 10.1007/BF00418036 [DOI] [PubMed] [Google Scholar]
  • 30.Kelly JM, Drysdale MR, Sealy-Lewis HM, Jones IG, Lockington RA. Alcohol dehydrogenase III in Aspergillus nidulans is anaerobically induced and post-transcriptionally regulated. Mol Gen Genet. 1990;222(2–3):323–8. doi: 10.1007/BF00633836 [DOI] [PubMed] [Google Scholar]
  • 31.Bakker BM, Bro C, Kotter P, Luttik MA, van Dijken JP, Pronk JT. The mitochondrial alcohol dehydrogenase Adh3p is involved in a redox shuttle in Saccharomyces cerevisiae. J Bacteriol. 2000;182(17):4730–7. doi: 10.1128/JB.182.17.4730-4737.2000 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Arnaud M, Chastanet A, Debarbouille M. New vector for efficient allelic replacement in naturally nontransformable, low-GC-content, gram-positive bacteria. Appl Environ Microbiol. 2004;70(11):6887–91. doi: 10.1128/AEM.70.11.6887-6891.2004 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Hagan CTt, Medik YB, Wang AZ. Nanotechnology Approaches to Improving Cancer Immunotherapy. Adv Cancer Res. 2018;139:35–56. doi: 10.1016/bs.acr.2018.05.003 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Ramarao N, Nielsen-LeRoux C, Lereclus D. The insect Galleria mellonella as a powerful infection model to investigate bacterial pathogenesis. J Vis Exp. 2012;70:e4392. doi: 10.3791/4392 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Tran S, Guillemet E, Lereclus D, Ramarao N. Iron regulates Bacillus thuringiensis haemolysin hlyII gene expression during insect infection. J Invert Pathol. 2013;113:205–8. doi: 10.1016/j.jip.2013.04.001 [DOI] [PubMed] [Google Scholar]
  • 36.Murzin AG. Structural classification of proteins: new superfamilies. Curr Opin Struct Biol. 1996;6(3):386–94. doi: 10.1016/s0959-440x(96)80059-5 [DOI] [PubMed] [Google Scholar]
  • 37.Taneja B, Mande SC. Conserved structural features and sequence patterns in the GroES fold family. Protein Eng. 1999;12(10):815–8. doi: 10.1093/protein/12.10.815 [DOI] [PubMed] [Google Scholar]
  • 38.Rubach JK, Plapp BV. Amino acid residues in the nicotinamide binding site contribute to catalysis by horse liver alcohol dehydrogenase. Biochemistry. 2003;42(10):2907–15. doi: 10.1021/bi0272656 [DOI] [PubMed] [Google Scholar]
  • 39.Thorn JM, Barton JD, Dixon NE, Ollis DL, Edwards KJ. Crystal structure of Escherichia coli QOR quinone oxidoreductase complexed with NADPH. J Mol Biol. 1995;249(4):785–99. doi: 10.1006/jmbi.1995.0337 [DOI] [PubMed] [Google Scholar]
  • 40.Mukherjee PK, Mohamed S, Chandra J, Kuhn D, Liu S, Antar OS, et al. Alcohol dehydrogenase restricts the ability of the pathogen Candida albicans to form a biofilm on catheter surfaces through an ethanol-based mechanism. Infect Immun. 2006;74(7):3804–16. doi: 10.1128/IAI.00161-06 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Plapp BV, Leidal KG, Murch BP, Green DW. Contribution of liver alcohol dehydrogenase to metabolism of alcohols in rats. Chem Biol Interact. 2015;234:85–95. doi: 10.1016/j.cbi.2014.12.040 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Jornvall H, Persson B, Jeffery J. Characteristics of alcohol/polyol dehydrogenases. The zinc-containing long-chain alcohol dehydrogenases. Eur J Biochem. 1987;167(2):195–201. doi: 10.1111/j.1432-1033.1987.tb13323.x [DOI] [PubMed] [Google Scholar]
  • 43.Sun HW, Plapp BV. Progressive sequence alignment and molecular evolution of the Zn-containing alcohol dehydrogenase family. J Mol Evol. 1992;34(6):522–35. doi: 10.1007/BF00160465 [DOI] [PubMed] [Google Scholar]
  • 44.Cadot C, Tran SL, Vignaud ML, De Buyser ML, Kolsto AB, Brisabois A, et al. InhA1, NprA and HlyII as candidates to differentiate pathogenic from non-pathogenic Bacillus cereus strains. J Clin Microbiol. 2010;48:1358–65. doi: 10.1128/JCM.02123-09 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Tran SL, Ramarao N. Bacillus cereus immune escape: a journey within macrophages. FEMS Microbiol Lett. 2013;347:1–6. doi: 10.1111/1574-6968.12209 [DOI] [PubMed] [Google Scholar]
  • 46.Porrini C, Ramarao N, Tran SL. Dr. NO and Mr. Toxic—the versatile role of nitric oxide. Biol Chem. 2020;401(5):547–72. doi: 10.1515/hsz-2019-0368 [DOI] [PubMed] [Google Scholar]
  • 47.Chin MP, Schauer DB, Deen WM. Nitric oxide, oxygen, and superoxide formation and consumption in macrophages and colonic epithelial cells. Chem Res Toxicol. 2010;23(4):778–87. doi: 10.1021/tx900415k [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Zaki MH, Akuta T, Akaike T. Nitric oxide-induced nitrative stress involved in microbial pathogenesis. J Pharmacol Sci. 2005;98(2):117–29. JST.JSTAGE/jphs/CRJ05004X. doi: 10.1254/jphs.crj05004x [DOI] [PubMed] [Google Scholar]
  • 49.Porrini C, Guérin C, Tran SL, Dervyn R, Nicolas P, Ramarao N. Implication of a Key Region of Six Bacillus cereus Genes Involved in Siroheme Synthesis, Nitrite Reductase Production and Iron Cluster Repair in the Bacterial Response to Nitric Oxide Stress. Int J Mol Sci. 2021;11;22(10):5079. doi: 10.3390/ijms22105079 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Madeira JP, Alpha-Bazin B, Armengaud J, Duport C. Time dynamics of the Bacillus cereus exoproteome are shaped by cellular oxidation. Front Microbiol. 2015;6:342. doi: 10.3389/fmicb.2015.00342 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Agledal L, Niere M, Ziegler M. The phosphate makes a difference: cellular functions of NADP. Redox Rep. 2010;15(1):2–10. doi: 10.1179/174329210X12650506623122 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Duport C, Jobin M, Schmitt P. Adaptation in Bacillus cereus: From Stress to Disease. Front Microbiol. 2016;7:1550. doi: 10.3389/fmicb.2016.01550 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Leclerc M, Bedu-Ferrari C, Etienne-Mesmin L, Mariadassou M, Lebreuilly L, Tran SL, et al. Nitric Oxide Impacts Human Gut Microbiota Diversity and Functionalities. mSystems. 2021. Oct 26;6(5):e0055821. doi: 10.1128/mSystems.00558-21 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

All relevant data are within the manuscript.


Articles from PLoS ONE are provided here courtesy of PLOS

RESOURCES