Abstract
Background
Expanded-spectrum quinolones (ciprofloxacin) are highly effective against gram-negative bacteria, but significant resistance to quinolones has been increasingly reported. We sought to evaluate the prevalence of gram-negative ciprofloxacin-resistant isolates (CRIs) from our hospital and their mechanism of action.
Methods
Gram-negative CRIs were identified as per standard procedures and confirmed using the Ezy MICTM Strip (HiMedia). DNA from 67 CRIs was amplified for the quinolone resistance–determining region (QRDR) and plasmid-mediated quinolone resistance genes. Thirty isolates positive for QRDR DNA were sequenced by Sanger's method to detect mutation.
Results
Of the isolates, 42.5% were found to be CRIs, the majority (74.42%) from inpatient departments, and Escherichia coli (64.19%) was the predominant isolate. Among the CRIs, 24.55% were ESBL producers and 35.29% were multidrug resistant. The polymerase chain reaction results showed the majority were amplified by QRDR target regions of gyrA (35.4%) while 4.61% were amplified for the plasmid-mediated fluoroquinolone resistance region of the qnrB gene. Further sequencing of QRDR-positive genes showed point mutations with amino acid changes at codons Ser83 and Asp87 in the gyrA gene and Ser80, Glu84, and Leu88 positions in the parC gene.
Conclusion
Ciprofloxacin resistance observed in our study was mostly due to point mutations. Hence, strategies for rational use of ciprofloxacin and adherence to the dose and duration of treatment could be helpful to prevent selection and spread of mutant CRIs/strains.
Keywords: Ciprofloxacin, Gram-negative, gyrA, parC, Mutation
Introduction
Quinolones are the widely used synthetic antimicrobials in clinical medicine. With extensive use, resistance to this antibiotic has emerged, and it is becoming common in many bacterial species.1 Drug resistance is an emerging issue in both developing and developed countries in terms of morbidity, mortality, and the disability-adjusted life year associated with it.2 Quinolones, derived from nalidixic acid in 1962, were mostly used for treatment of gram-negative urinary tract infections (UTIs).3 Its pharmacological activity and spectrum were improved by addition of fluorine and piperazinyl at the C6 and C7 position. Since the 1990s, quinolone resistance has first emerged against methicillin-resistant Staphylococcus aureus and Pseudomonas species, which then subsequently spread to all organisms, especially the Enterobacteriaceae family.4
Quinolone acts by inhibiting bacterial DNA replication by blocking DNA gyrase/topoisomerase IV enzyme activity. Mutations altering the drug targets (most common) and plasmids coding for protective proteins can protect the bacteria from the lethal effects of quinolones.5,6,7 The genes coding for DNA gyrase are gyrA and gyrB and topoisomerase IV are parC and parE, collectively known as the quinolone resistance–determining region (QRDR); mutation in these regions leads to development of quinolone resistance. Similarly, genes encoding plasmid-mediated fluoroquinolone resistance (PMQNR) are qnrA, qnrB, qnrC, qnrD, and qnrS.5 The variations in the minimum inhibitory concentration in an antibiogram could be attributed to mutations in the QRDR and/or PMQNR genes. An increasing number of multidrug-resistant organisms (MDROs; non-susceptible to one or more antimicrobials in three or more antimicrobial classes) including ciprofloxacin resistance are being reported, which is an important public health concern.
Despite the number of MDROs identified and characterized, information on detailed mechanisms of resistance remains elusive. Studies have linked the non-judicious antibiotic use and non-compliance to treatment as the major cause of antibiotic resistance. Furthermore, the organisms have devised a strategy to transfer the genetic material for drug resistance both via chromosomes and plasmids, which is responsible for the rapid spread of antibiotic resistance.
Higher rates of resistance to quinolones have been reported from different parts of the world.4,8 However, studies on the resistance pattern to quinolones in this region are limited.7 In this study, we examined the prevalence of the ciprofloxacin resistance pattern in the clinical isolates from this region by phenotypic and molecular methods using polymerase chain reaction (PCR) and/or Sanger's sequencing.
The primary objective of this study was to determine the prevalence of ciprofloxacin resistance in gram-negative clinical isolates from patients attending this tertiary care hospital of Eastern India. The secondary objective of the study was to detect the mechanism of ciprofloxacin resistance by molecular detection of the QRDR and PMQNR.
Materials and methods
This observational cross-sectional study was conducted for a period of one year and eight months (from January 2017 to August 2018) after obtaining ethical approval from the institutional review board (IRB-T/IM-F/Micro/15/03). Taking into account ciprofloxacin resistance, 55% from previous year's (2016) antibiogram, the sample size was calculated to be 396 of 400. Gram-negative isolates obtained from clinical specimens (blood, urine, pus, sputum/tracheal secretions, body fluids, and so on) routinely received in the microbiology department were included in this study. Bacterial identification was carried out as per standard procedures.9 The detailed patient demographic information and history regarding previous use of quinolone in the past 6 months (where available) were collected from the requisition forms. The antimicrobial susceptibility of the isolates was determined by the disc diffusion method against ciprofloxacin (5 μg) and other antibiotic discs, procured from HiMedia Laboratories Limited, Mumbai, India. The antibiotic disc stocks were stored at −20 °C for long-term storage, and the working vials were stored at 4 °C to be used within a week. Moreover, quality control testing of the discs was performed routinely at every 15-day interval as per Clinical & Laboratory Standards Institute (CLSI) guidelines using the control strain Escherichia coli ATCC 25922 and Pseudomonas aeruginosa ATCC 27853. Resistance to ciprofloxacin was screened by the disc diffusion method and confirmed by minimum inhibitory concentration (MIC) detection using the Ezy MICTM Strip (CIP) (HiMedia) as per the manufacturer's instructions. Other antibiotic discs tested in addition to ciprofloxacin were amikacin (30 μgm), ceftriaxone (30 μgm), imipenem (10 μgm), levofloxacin (5 μgm), cotrimoxazole (μgm), and nitrofurantoin (μgm) in case of urinary isolates. For ciprofloxacin, the zone of inhibition (ZOI) >21 mm was read as sensitive and <15 mm was read as resistant for all gram-negative bacilli except for Salmonella typhi, for which >31 mm was read as sensitive and <20 mm was read as resistant; the MIC ≤1 mg/ml for ciprofloxacin by the E-test was read as susceptible, of 2 mg/ml was read as intermediate, and ≥ 4 μg/ml was read as resistant. The ZOI for other antimicrobial discs tested was interpreted as per CLSI guidelines (2016), and ESBL production was detected by the double-disc synergy test.10
One hundred representative ciprofloxacin-resistant isolates (CRIs; 25% from each specimen category including 45 subjects with history of quinolone use in the past 6 months) were subjected to DNA extraction using the QIAamp DNA extraction kit (Qiagen, Germany) as per the manufacturer's instructions. The extracted DNA was quantified using the nanodrop spectrophotometer (Thermo Scientific 2000c, USA). Of 100 extracted DNA samples, 65 had the required concentration to be subjected to PCR amplification of QRDR target regions of gyrA, gyrB, parC, and parE genes and PMQNR target regions of qnrA and qnrB genes. The primers used are mentioned in Table 1.7 The 50-μl PCR Master Mix, constituting 10× PCR buffer, 1.5 mM MgCl2, 200 μM dNTPs, 1 unit of Taq DNA polymerase, 10 pmol of respective sense and antisense primers, and 200 ng of DNA template, was used for amplification. The PCR conditions were standardized for multiplexing at the annealing temperature gradient from 55.1 °C to 61.8 °C for 40 cycles of PCR (10× and 30×). The amplicons were run on 2% tris-Acetate Ethylene diamine tetraacetic acid (TAE) agarose gel and stained with ethidium bromide (final concentration: 0.5 μg/ml), and the agarose gel was visualized using the gel documentation system (Bio-Rad). The different amplicon sizes were discriminated using the molecular weight marker in the gel.
Table 1.
Details of the sequence showing the primer position used in this study.
| No. | Gene | Primer sequence (5′–3′) | Amplicon base pair (bp) |
|---|---|---|---|
| 1 | gyrA | Forward: GCTGCCAGATGTCCGAGATG Reverse: TCCGTGCCGTCATAGTTATCAAC |
360 (bp) |
| 2 | gyrB | Forward: GTGAAGGCCTGATTGCGGTC Reverse: GATGATGATGCTGTGATAACGC |
540 (bp) |
| 3 | parC | Forward: GTTGCCGTTTATTGGTGATGGTC Reverse: AGGTTATGCGGTGGAATATCGG |
465 (bp) |
| 4 | parE | Forward: ATTCGTTTCTGGCGTGGTGAAA Reverse: CAGCGCGTAATAAACCTCTTTCC |
586 (bp) |
| 5. | QnrA | Forward: AGAGGATTTCTCACGCCAGG Reverse: TGCCAGGCACAGATCTTGAC |
580(bp) |
| 6. | QnrB | Forward: GGMATHGAAATTCGCCACTG Reverse: TTYGCBGYYCGCCAGTCGAA |
264(bp) |
CR, ciprofloxacin-resistant.
Sequence confirmation of mutations in the QRDR target gene
The PCR amplicons were purified using the Qiagen PCR purification kit (Qiagen, Germany) as per the manufacturer's instructions. Forty nanograms of purified DNA was used for Sanger's sequencing. A representative of 30 QRDR-positive PCR-purified products of gyrA, gyrB, parC, and ParE was subjected for sequencing using Sanger's sequencing technology on an ABI genetic analyzer. The sequence chromatogram was then converted to the FASTA format; in silico BLAST confirmed with the National Center for Biotechnology Information (NCBI) and aligned with the prototype strain using the BioEdit program. The obtained sequences were submitted to the NCBI.
Results
A total of 920 specimens were processed during the study period. Of these, 391 were found to be CR gram-negative bacilli, with a prevalence of 42.5% (95% confidence interval: 39.3–45.7%). Of these, 60.3% were from males, and the majority were within the age-group of 20–60 years, followed by >60 years (Table 2). Of the 391 CRIs, 74.42% were from the inpatient department (IPD), 11% from the outpatient department, 11% from the medical intensive care unit (ICU), and 4% from the surgical ICU (Fig. 1). The CRIs were obtained from 58.82%, 26.08%, 6.13%, 5.88%, and 3.06% of samples of urine, pus, blood, endotracheal tube secretion, and body fluids, respectively (Table 3). The following isolates were identified: E. coli in 64.19%, Klebsiella spp. in 20.20%, Enterobacter spp. in 2.55%, Acinetobacter spp. in 7.16%, Pseudomonas spp. in 3.58%, Proteus vulgaris in 1.02%, Citrobacter spp. in 0.5%, and S. typhi in 0.76% isolates (Table 4). Among the CRIs, 96 (24.55%) were identified to be ESBL producers by the double-disc synergy test, and 138 (35.29%) were multidrug resistant showing resistance to more than three groups of antimicrobials (Table 5). Regarding the resistance pattern of CRIs to other drugs, 98.2% were resistant to levofloxacin, 91.04% were resistant to ceftriaxone, 41.17% were resistant to imipenem, 34.78% were resistant to amikacin, 72.6% were resistant to cotrimoxazole, and 26% of the urinary isolates were resistant to nitrofurantoin (Table 5). All the CRIs were sensitive to colistin and polymixin B. Of the 65 DNA specimens amplified for QRDR and PMQNR target genes, gyrA was amplified in 35.4%, gyrB in 14.6%, parC in 26.6%, and parE in 32% isolates. Only 4.61% isolates were amplified for the QnrB gene (Fig. 2). Fourteen CRIs were positive for multiple genes in different combinations. All the four QRDR target genes (gyrA, gyrB, parC, andparE) were amplified in two isolates, which were resistant to all the drugs tested except colistin and polymyxin B. The MIC range was between 16 and 20 μgm in three isolates, which were positive for QnrB, and the rest (99.23%) of the CRIs had an MIC >32 μgm.
Table 2.
Age and sex distribution of patients having CR isolates from different specimens (N = 391).
| Age | n (%) | Total males (%) | Total females (%) |
|---|---|---|---|
| Up to 5 yrs | 29 (7.41) | 236 (60.35) | 155 (39.64) |
| 6–20 yrs | 49 (12.53) | ||
| 21–60 yrs | 218 (55.75) | ||
| >60 yrs | 95 (24.29) | ||
| Total | 391 |
CR, ciprofloxacin-resistant.
Majority of clinical isolates were detected from males, and the prevalence of CR isolates was higher in the age-group of 21–60 years.
Fig. 1.
Majority of the CR isolates were from the inpatient department (IPD) (74%), followed by 11% from both the outpatient department (OPD) and medical intensive care unit (MICU) each, and 4% isolates were from the surgical intensive care unit (SICU). CR, ciprofloxacin-resistant.
Table 3.
Distribution of CR gram-negative isolates from various samples (N = 391).
| Name of isolates | Urine | Pus | Blood | ET secretion | Body fluids | Total, n (%) |
|---|---|---|---|---|---|---|
| E. coli | 179 | 58 | 8 | 1 | 5 | 251 (64.19) |
| Klebsiella spp. | 31 | 28 | 6 | 9 | 5 | 79 (20.20) |
| Enterobacter spp. | 5 | 2 | 0 | 2 | 1 | 10 (2.55) |
| Acinetobacter spp. | 5 | 7 | 6 | 9 | 1 | 28 (7.16) |
| Pseudomonas spp. | 7 | 5 | 0 | 2 | 0 | 14 (3.58) |
| Proteus vulgaris | 2 | 2 | 0 | 0 | 0 | 4 (1.02) |
| Citrobacter spp. | 1 | 0 | 1 | 0 | 0 | 2 (0.5) |
| S. typhi | 0 | 0 | 3 | 0 | 0 | 3 (0.76) |
| Total | 230 (58.82) | 102 (26.08) | 24 (6.13) | 23 (5.88) | 12 (3.06) | 391 |
CR, ciprofloxacin-resistant.
The predominant isolate was E. coli, followed by Klebsiella spp. and others.
Table 4.
Distribution of ESBL and MDR strains among CR isolates (N = 391).
| Specimen | ESBL, n (%) | MDR, n (%) |
|---|---|---|
| Urine | 69 (17.64) | 75 (19.18) |
| Pus | 22 (5.62) | 35 (8.95) |
| Blood | 2 (0.5) | 15 (3.83) |
| ET secretion | 1 (0.25) | 10 (2.55) |
| Body fluids | 2 (0.5) | 3 (0.76) |
| Total | 96 (24.55) | 138 (35.29) |
ESBL, extended spectrum beta-lactamase; MDR, multidrug-resistant; ET, endotracheal tube; CR, ciprofloxacin resistant.
Majority of the distribution of strains found in urine samples, followed by pus, blood, ET secretion, and in other body fluids.
Table 5.
Resistance pattern of CR isolates to other antibiotics used (n = 391).
| Specimens | Levofloxacin | Ceftriaxone | Imipenem | Amikacin | Cotrimoxazole | Nitrofurantoin | Polymixin B | Colistin | Nitrofurantoin |
|---|---|---|---|---|---|---|---|---|---|
| Urine (230) | 223 | 200 | 59 | 60 | 162 | 60 (26%) | 0 | 0 | 60 (26%) |
| Pus (102) | 102 | 99 | 60 | 46 | 82 | ND | ND | ||
| Blood (24) | 24 | 22 | 15 | 8 | 13 | ND | 0 | 0 | ND |
| ET secretion (23) | 23 | 23 | 19 | 17 | 18 | ND | 0 | 0 | ND |
| Body fluids (12) | 12 | 12 | 8 | 5 | 9 | ND | 0 | 0 | ND |
| Total (391) | 384 (98.2%) | 356 (91.04%) | 161 (41.17%) | 136 (34.78%) | 284 (72.6%) | (0%) | (0%) |
ND, not done; CR, ciprofloxacin-resistant.
More than 90% isolates were resistant to levofloxacin and third-generation cephalosporins; however, all of them were sensitive to polymixin B and colistin.
Fig. 2.
Representative gel picture of PCR amplification of gyrB and parC genes for the QRDR. PCR, polymerase chain reaction; QRDR, quinolone resistance–determining region.
Sequencing of the four target genes gyrA, gyrB, parC, and parE showed mutations in the following nucleotide positions – gyrA gene: 248 C→T, 255 C→T, 259 G→A, 273 C→A, 300 TT→C, 333 T→C, 408 C→T; gyrB gene: 1074 AA→G, 1176 C→T, 1242 T→C, 1245 G→A, 1260 G→A, and 1266 G→A; and parC gene: 239 G→T, 251 A→G, 263 T→A, 273 A→G and in codon 432 G→A. There were variations seen in 15 nucleotide regions of the parE gene: 1134 C→T, 1149 C→T, 1164 T→C, 1173 G→A, 1185 G→A, 1188 G→A, 1189 T→C, 1197 C→T, 1201 C→T, 1209 T→C, 1224 C→T, 1239 G→A, 1243 G→A, 1265 C→T, and in codon 1308 G→T. Alignment of the representative sequences along with the prototype strain showing the mutation regions is depicted in Fig. 3. The resultant mutations of QRDR target gene sequences from this study were submitted to the NCBI, National Institutes of Health (NIH), USA, and NCBI accession numbers (MK174284, MK174285, MK174286, MK174287, MK174288, MK174289, MK182573, MK190415, and MK190416) were obtained for the submitted sequences.
Fig. 3.
Alignment of sequences showing the site of mutations in gyrA, gyrB, parC, and parE genes. Alignment of nucleotide sequences for gyrA, gyrB, parC, and parE regions with the prototype E. coli strain (representative samples). In this alignment, only part of the variable region is shown. Dots indicate identity, and dashes indicate deletions. The alignment was carried out using BioEdit software (NC000913—prototype sequence; GA, GB, PC, and PE clinical isolates representing gyrA, gyrB, parC, and parE genes, respectively) (E. coli [strain K12] NC000913, MG1655; reference proteome; https://www.uniprot.org/proteomes/UP000000625; K12/MG1655/ATCC 47076; last modified: October 14, 2018). There were seven mutations seen in the following nucleotide position in the gyrA gene: 248 C→T, 255 C→T, 259 G→A, 273 C→A, 300 TT→C, 333 T→C, and 408 C→T. Six mutations were seen in the gyrB gene: 1074 AA→G, 1176 C→T, 1242 T→C, 1245 G→A, 1260 G→A, and 1266 G→A. Five mutations were seen in the parC gene: 239 G→T, 251 A→G, 263 T→A, 273 A→G, and in codon 432 G→A. Fifteen variations were seen in 15 nucleotide regions of the parE gene: 1134 C→T, 1149 C→T, 1164 T→C, 1173 G→A, 1185 G→A, 1188 G→A, 1189 T→C, 1197 C→T, 1201 C→T, 1209 T→C, 1224 C→T, 1239 G→A, 1243 G→A, 1265 C→T, and in codon 1308 G→T. The sequences have been submitted to the NCBI with the following accession numbers: MK174284, MK174285, MK174286, MK174287, MK174288, MK174289, MK182573, MK190415, and MK190416. NCBI, National Center for Biotechnology Information.
Discussion
Increase in antibiotic resistance is one of the most pressing concerns in public health. The synthetic products of quinolones and fluoroquinolones have been most commonly used in clinical practice for treatment of severe infections. In this study, the prevalence of ciprofloxacin resistance was found to be 42.5%, whereas the resistance pattern was found to be 76% and 80% in other regions of India.11,12
Most studies from India reported E. coli as the predominant QNR isolate. We also had a similar observation of E. coli predominance (64%), but other organisms such as Klebsiella spp., Enterobacter spp., Acinetobacter spp., Pseudomonas spp., P. vulgaris, Citrobacter spp., and S. typhi were also demonstrated to be resistant to ciprofloxacin. Kakkar et al7 had recently reported ciprofloxacin resistance mostly in S. typhi, but we had isolated only 3 CR S. typhi isolates (0.76%) from blood. In the present study, E. coli was the major CRI from urine; 24.55% of them were ESBL producers, and 35.29% were found to be multidrug resistant. Rajivgandhi et al13 had also reported high prevalence of CR Gram negative bacilli (GNB) in ESBL-positive isolates from samples of patients with UTI. As per reports of similar studies, CRIs also exhibited multidrug resistance, and previous or excessive fluoroquinolone use was one of the risk factors.14,15 Regarding Plasmid-mediated quinolone resistance (PMQR) genes, only 4.61% isolates were amplified for the QnrB gene here. Although Qnr confers low level quinolone resistance; its clinical importance lies in its ability to supplement resistance due to mutations in DNA gyrase, topoisomerase IV, porin or efflux pumps and selection of chromosomal mutation.16 No correlation of MIC with the mechanism of QNR could be drawn as 99.23% isolates had an MIC >32 μgm. This high rise in MIC (>32 μgm) could be due to cumulative impact of the mutations in these genes, which has been observed in majority of our isolates.
Mutations have been detected in transposons and/or integrons that are often colocated with other resistance determinants such as ESBL, AmpC-type β-lactamase, and carbapenemase genes in MDR plasmids of significantly varying sizes and incompatibility groups.17 We also examined the mutations in gyrA, gyrB, parC, and parE genes in the QRDR target region of CRIs by sequencing. The gyrA target was amplified in 35.4% of isolates, where there were seven mutations detected. Of these, five were synonymous mutations, that is, no change in the reading frame, and two were non-synonymous mutations at codons Ser-83 → Leu and Asp-87 → Asn. Both of these isolates had MIC beyond the measurable limit, that is, >32 μgm/ml, indicative of high-level resistance to ciprofloxacin. Our data are consistent with earlier reports of point mutations resulting in amino acid substitution at Ser-83 and mutation at Asp-87 in the gyrA gene, associated with increased MIC of fluoroquinolone in E. coli strains.18,19,20 In addition to this, point mutations were seen at codons Val-85, Arg-91, Tyr-100, Ser-111, and Ala-136 of the gyrA gene as well. Silent mutations at codons 85, 100, and 111 in gyrA were also reported by other studies.12 Regarding gyrB, seven silent mutations were seen at codons 358, 392, 414, 415, 420, 422, and 475. Other studies have reported change in the reading frame due to mutation at codon Ser-494 in the gyrB gene.21 Mutations at codons Asp-426 and Glu-447 in the gyrB gene were reported to be associated with quinolone resistance in E. coli.22 Recently, a novel mutation at codon Glu466 of gyrB was reported to be associated with fluoroquinolone resistance.23 However, none of the mutations found here in gyrB resulted in change in the reading frame. Five mutations were detected in the parC gene. Of these, three non-synonymous mutations in the Ser-80 → Ile, Glu-84→ Gly, and Leu-88→ Gln position were associated with change in the reading frame. Our data are consistent with other studies that reported point mutations by amino acid substitution at Ser-80 and Glu-84 positions in the parC gene in association with fluoroquinolone resistance in E. coli,12,24 whereas the mutation at codon 88 is novel to our study. Our finding of less frequent detection of resistance mutation in the gyrB and parE subunits in comparison with gyrA and parC was consistent with earlier reports.25,26 There were fifteen mutations detected in the parE gene in this study; all of them were silent mutations. The variations were seen at codons 378, 383, 388, 391, 395, 396, 397, 399, 401, 403, 408, 413, 414, 421, and 436. Studies have reported amino acid changes at codon Pro-424 [24] and codon Asp420 in parE genes.27 But none of the amino acid changes in the parE gene were detected in our study. In E. coli, the most common mutation site in gyrA is at Ser-83, followed by Asp-87, both key residues for quinolone binding. Although high-level resistance phenotypes have been reported with single gyrA mutations at the Ser-83 position, an accumulation of mutations in one or both target enzymes has been shown to cause increasing levels of quinolone resistance.25,26,17 Previous studies have shown association of high-level fluoroquinolone resistance with double mutations in gyrA and parC in E. coli.28 We also found mutations in codons 83 and 87 of gyrA and 80 and 84 of parC along with some unique mutations. In our study, presence of mutations resulting in amino acid changes in gyrA and parC simultaneously in a single isolate was observed in the catheterized urine sample of an ICU patient with prolonged hospital stay.
Conclusion
QNR was detected in 42.5% gram-negative isolates (predominantly E. coli) especially from IPDs. Chromosome-mediated resistance was the maximum resistance observed in our study. Although these mechanisms have been studied, many details remain to be clarified, and the exact contribution of less studied mechanisms such as the metabolic regulation of drug resistance, the bacterial stress responses, or even quorum sensing and biofilm formation still needs further elucidation. However, clinicians should be informed to avoid empirical use of quinolones and adherence to the complete course and duration in case of specific therapy. Furthermore, studies with a large population involving geographical regions will be of value in obtaining the true picture of this antibiotic resistance pattern. To the best of our knowledge, this is the first report for mutations in the fluoroquinolone-resistant targets identified in this region. These targets could be of use for understanding virulence of the organisms and for development of new antibiotics in future.
Conflicts of interest
The authors have none to declare.
Acknowledgments
The authors acknowledge the head of All India Institute of Medical Sciences (AIIMS), Bhubaneswar, Odisha, India, for granting the intramural fund and the Chairman of the Institute Ethics Committee for granting ethical clearance to carry out this work (T/IM-F/Micro/15/03; dated May 6, 2016).
References
- 1.Redgrave L.S., Sutton S.B., Webber M.A., Piddock L.J. Fluoroquinolone resistance: mechanisms, impact on bacteria, and role in evolutionary success. Trends Microbiol. 2014;22(8):438–445. doi: 10.1016/j.tim.2014.04.007. [DOI] [PubMed] [Google Scholar]
- 2.Fair R.J., Tor Y. Antibiotics and bacterial resistance in the 21st century. Perspect Med Chem. 2014;6:25–64. doi: 10.4137/PMC.S14459. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Ball P. Quinolone generations: natural history or natural selection? J AntimicrobChemother. 2000;46:17–24. doi: 10.1093/oxfordjournals.jac.a020889. [DOI] [PubMed] [Google Scholar]
- 4.Dalhoff A. Global fluoroquinolone resistance epidemiology and implictions for clinical use. Interdiscip Perspect Infect Dis. 2012;2012:976273. doi: 10.1155/2012/976273. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Hooper D.C. Mechanisms of action of antimicrobials: focus on fluoroquinolones. Clin Infect Dis. 2001;32:S9–S15. doi: 10.1086/319370. [DOI] [PubMed] [Google Scholar]
- 6.Davies J., Davies D. Origins and evolution of antibiotic resistance. Microbiol Mol Biol Rev. 2010;74:417–433. doi: 10.1128/MMBR.00016-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Kakkar M., Walia K., Vong S., Chatterjee P., Sharma A. Antibiotic resistance and its containment in India. BMJ. 2017;5(358):j2687. doi: 10.1136/bmj.j2687. [DOI] [PubMed] [Google Scholar]
- 8.Tacconelli E., Sifakis F., Harbarth S., et al. EPI-Net COMBACTE-MAGNET Group. Surveillance for control of antimicrobial resistance. Lancet Infect Dis. 2018;18:e99–e106. doi: 10.1016/S1473-3099(17)30485-1. [DOI] [PubMed] [Google Scholar]
- 9.Practical Medical Microbiology Collee J.G., Marmion B.P., Fraser A.G., Simmons A. 14th ed. Churchill Livingstone; New York: 1996. Mackie and McCartney's; p. 978. [Google Scholar]
- 10.Clinical and Laboratory Standards Institute (CLSI) Clinical and Laboratory Standards Institute; Wayne, PA: 2016. Performance Standards for Antimicrobial Susceptibility Testing; Twenty-Sixth Informational Supplement. CLSI Document M100-S26. [Google Scholar]
- 11.Tripathi A., Dutta S.K., Majumdar M., Dhara L., Banerjee D., Roy K. High prevalence and significant association of ESBL and QNR genes in pathogenic klebsiellapneumoniae Isolates of Patients from Kolkata, India. Indian J Microbiol. 2012;52(4):557–564. doi: 10.1007/s12088-012-0281-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Dasgupta N., Paul D., Chand D.D., Chetri S., Chakravarty A., Bhattacharjee A. Observation of a new pattern of mutations in gyrA and parC within Escherichia coli exhibiting fluroquinolone resistance. Indian J Med Microbiol. 2018;36:131–135. doi: 10.4103/ijmm.IJMM_17_181. [DOI] [PubMed] [Google Scholar]
- 13.Rajivgandhi G., Maruthupandy M., Ramachandran G., Priyanga M., Manoharan N. Detection of ESBL genes from ciprofloxacin resistant Gram negative bacteria isolated from urinary tract infections (UTIs) Front Lab Med. 2018;2(1):5–13. [Google Scholar]
- 14.Saito R., Okugawa S., Kumita W., et al. Clinical epidemiology of ciprofloxacin Resistant Proteus mirabilis isolated from urine samples of Hospitalized patients. Clin Microbiol Infect. 2007;13:1204–1206. doi: 10.1111/j.1469-0691.2007.01826.x. [DOI] [PubMed] [Google Scholar]
- 15.Rajivgandhi G., Vijayarani J., Kannan M., Murugan A., Vijayan N., Manoharan N. Isolation and identification of biofilm forming uropathogens from urinary tract infection and its antimicrobial susceptibility patternInt. J Adv Life Sci. 2014;7(2):352–363. [Google Scholar]
- 16.Martínez-Martínez L., Pascual A., García I., Tran J., Jacoby G.A. 1998. Abstr. 38th intersci. Conf. Antimicrob. Agents Chemother.,abstr. C-99. [Google Scholar]
- 17.Correia S., Hebraud M., Chafsey I., et al. Impacts of experimentally induced and clinically acquired quinolone resistance on the membrane and intracellular subproteomes of Salmonella Typhimurium DT104B. J Proteomics. 2016;145:46–59. doi: 10.1016/j.jprot.2016.04.001. [DOI] [PubMed] [Google Scholar]
- 18.Minarini L.A., Darini A.L. Mutations in the quinolone resistance-determining regions of gyrA and parC in Enterobacteriaceae isolates from Brazil. Braz J Microbiol. 2012;43:1309–1314. doi: 10.1590/S1517-838220120004000010. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Kumar M., Dahiya S., Sharma P., et al. Structure based in silico analysis of quinolone resistance in clinical isolates of Salmonella Typhi from India. PLoS One. 2015;11(5) doi: 10.1371/journal.pone.0126560. 10. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Sood S., Agarwal M., Bala M., et al. Exploring quinolone resistance-determining region in Neisseria gonorrhoeae isolates from across India. Indian J Med Res. 2017;146:S64–S69. doi: 10.4103/ijmr.IJMR_730_15. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.González I., Georgiou M., Alcaide F., Balas D., Liñares J., de la Campa A.G. Fluoroquinolone resistance mutations in the parC, parE, and gyrA genes of clinical isolates of viridans group streptococci. Antimicrob Agents Chemother. 1998;42:2792–2798. doi: 10.1128/aac.42.11.2792. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Yoshida H., Bogaki M., Nakamura M., Yamanaka L.M., Nakamura S. Quinolone resistance-determining region in the DNA GyrasegyrB gene of Escherichia coli. Antimicrob Agents Chemother. 1991;35:1647–1650. doi: 10.1128/aac.35.8.1647. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Al-Emran, Heisig H.M., Dekker A., et al. Detection of a novel gyrB mutation associated with fluoroquinolone-non susceptible Salmonella entericaserovar typhimurium isolated from a bloodstream infection in Ghana. Clin Infect Dis. 2016;15(62):S47–S49. doi: 10.1093/cid/civ790. [DOI] [PubMed] [Google Scholar]
- 24.Röderova M., Papousek I., Dolejska M., et al. Characteristics of quinolone resistance in Escherichia coli isolates from humans, animals, and the environment in the Czech republic. Front Microbiol. 2017;7:2147. doi: 10.3389/fmicb.2016.02147. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Hooper D.C., Jacoby G.A. Topoisomerase inhibitors: fluoroquinolone mechanisms of action and resistance. Cold Spring Harb Perspect Med. 2016;6:a025320. doi: 10.1101/cshperspect.a025320. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Hopkins K.L., Davies R.H., Threlfal E.J. Mechanisms of quinolone resistance in Escherichia coli and Salmonella: recent developments. Int J Antimicrob Agents. 2005;25:358–373. doi: 10.1016/j.ijantimicag.2005.02.006. [DOI] [PubMed] [Google Scholar]
- 27.Bebear C.M., Renaudin J., Charron A., et al. Mutations in the gyrA, parC, and parE genes associated with fluoroquinolone resistance in clinical isolates of Mycoplasma hominis. Antimicrob Agents Chemother. 1999;43:954–956. doi: 10.1128/aac.43.4.954. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Santhosh K.S., Deekshit V.K., Venugopal M.N., Karunasagar I., Karunasagar I. Multiple antimicrobial resistance and novel point mutation in fluoroquinolone-resistant Escherichia coli isolates from Mangalore, India. Microb Drug Resist. 2017;23:994–1001. doi: 10.1089/mdr.2016.0142. [DOI] [PubMed] [Google Scholar]