Abstract
Seventy-three B/Victoria group strains isolated in the 1996–1997 influenza season were divided into three groups according to the degree of reactivity to monoclonal antibody 8E6. Analysis of nucleotide sequences of the HA1 region clarified that single amino acid substitutions were responsible for the difference in reactivity to 8E6.
Influenza is one of the most important infectious diseases in industrial as well as developing countries. Over the past 20 years, influenza B virus has caused epidemics in humans, as have the H1 and H3 subtypes of influenza A virus. Influenza B virus is isolated only from humans and is characterized by a low rate of antigenic change and cocirculation of antigenic variants; recently, reassortment and insertion-deletion have been reported as strategies for its evolution (3, 7, 9, 11, 14, 16). Influenza B virus strains are divided into two large phylogenetic trees: one is the group that B/Victoria/2/87 represents, and the other is the group that B/Yamagata/16/88 represents (3, 7, 9). B/Victoria group strains were dominant in the 1980s, while B/Yamagata group strains were dominant in the early 1990s. However, B/Victoria group strains reemerged in South China in 1994, and since then, strains of both groups have been isolated in the same season (10, 11). They are antigenically distinct, and the differences in human immune response have been discussed (5, 6). Actually, B/Victoria group strains were not detected in the conventional hemagglutination inhibition (HI) test with ferret serum for B/Yamagata group strains. Therefore, we established a rapid detection system by using specific monoclonal antibodies (MAbs) in peroxidase-antiperoxidase (PAP) staining (10, 12, 15) and analyzed 100 strains of the 1996–1997 influenza season. When the anti-nucleoprotein (NP) or anti-matrix protein (M) MAbs were used, strains of both groups were detected equally well, and when anti-hemagglutinin (HA) MAbs 10B8 and 9E10 were used, strains were clearly distinguishable. Another anti-HA MAb, 8E6, detected only two-thirds of the B/Victoria group strains. Therefore, it was suggested that the strains, isolated from clinical specimens in one season, were actually a mixture of distinct antigenicities (10).
In this study, we used 8E6 in PAP staining, HI tests, and neutralization (NT) tests (12), and we analyzed the heterogeneous antigenicities of B/Victoria group strains isolated in the 1996–1997 influenza season. The results of nucleotide sequencing revealed that point mutations correspond to the variation in antigenicity. A total of 100 influenza B virus strains isolated in Osaka Prefecture were analyzed. Influenza B virus isolates B/Nagasaki/1/87, representative of the B/Victoria group strains of the 1980s, B/Guandong/5/94, representative of the B/Victoria group strains that reemerged in the 1990s, and B/Mie/1/93, representative of the B/Yamagata group strains, were utilized. RNA was obtained from virus-infected Madin-Darby canine kidney (MDCK) cells, and reverse transcription (RT)-PCR and direct sequencing were performed with primers 3′CTACTCATGGTAGTAACATCC (positions 52 to 72) and 5′TGGGAAGCCACCAATCTGAGAAAC (positions 774 to 751) for the former half of the HA1 gene and with primers 3′ACCTCAGGATCTTGCCCTAACG (positions 493 to 514) and 5′TGTGTATCCGTGCCAACCTGCAAT (positions 1194 to 1171) for the latter half.
Table 1 shows the results of PAP staining and NT tests of 100 influenza B virus strains isolated in the 1996–1997 season along with those of the 3 representative strains. B/Nagasaki/1/87 reacted to 8E6 and 10B8 in PAP staining and NT tests, while B/Guandong/5/94 reacted to 10B8 but not to 8E6. In PAP staining, all 73 B/Victoria group strains, which had been identified in a conventional HI test, were detected with 10B8, while 51 of 73 strains were detected by 8E6. When the 73 B/Victoria group strains were screened in the NT test with 8E6 and 10B8 at 5 × 10−3 dilutions of murine ascites, all were neutralized by 10B8 while 33 of 51 strains were neutralized by 8E6. Consequently, the 73 B/Victoria group strains were divided into 3 groups. Group 1 comprises B/Guandong-type strains, which are neither stained nor neutralized with 8E6. Group 3 is made up of B/Nagasaki-type strains, which are stained and neutralized with 8E6. Group 2 is the intermediate group of strains, which are stained but not neutralized with 8E6. Table 2 shows the results of PAP staining, the HI test, the NT test, nucleotide sequencing of the HA1 region, and sequencing of deduced amino acid residues for nine representative strains from the three groups. Differences in the nucleotide sequence were observed only between positions 589 and 596, which correspond to amino acid residue 197 or 199. Amino acid substitutions at these residues have been observed in strains isolated from clinical specimens and laboratory-induced antigenic variants, suggesting that these residues play important roles in the determination of antigenicity (1, 7). Lindstrom et al. reported that these residues are Asn and Ile or Asn and Thr in the strains isolated in 1993 and 1994 after the reemergence of the B/Victoria group, Asn and Asn in the strain isolated in 1996–1997, and Asn and Ala in the strain isolated in 1997–1998 (7). Therefore, it is suspected that group 1 strains existed at the beginning of the 1996–1997 season, while group 2 and group 3 strains appeared later. The collection date of each isolate confirms this notion (Table 2). It has been reported for antigenic variants selected by MAbs and polyclonal antibodies that single amino acid substitutions are sufficient to alter the antigenicity of the HA molecule of influenza virus (1, 2, 4, 8, 13). Our report suggests that neutralizing antibodies induce the virus to create antigenic variants for survival during the epidemic season. When MAbs which neutralize B/Guandong/5/94 but not B/Nagasaki/1/87 are obtained, this will be clearly demonstrated.
TABLE 1.
Results of PAP staining and NT tests of influenza B virus strains isolated in the 1996–1997 season
| Strain | Result of testing with the indicated MAb
|
|||
|---|---|---|---|---|
| PAP staining
|
NT test
|
|||
| 8E6 | 10B8 | 8E6 | 10B8 | |
| Representative strains | ||||
| B/Nagasaki/1/87 | + | + | + | + |
| B/Guandong/5/94 | − | + | − | + |
| B/Mie/1/93 | − | − | − | − |
| B/Victoria group strains isolated in 1996–1997 | ||||
| Group 1 (n = 22) | − | + | − | + |
| Group 2 (n = 18) | + | + | − | + |
| Group 3 (n = 33) | + | + | + | + |
| B/Yamagata group strains isolated in 1996–1997 (n = 27) | − | − | − | − |
TABLE 2.
Summary of the PAP staining, HI test, NT test, and nucleic acid and amino acid sequencing results for B/Victoria group strains isolated in the 1996–1997 season
| Strain | Resulta of:
|
Nucleic acid sequence (589–596) | Amino acid sequence (197, 199)b | Date of collection of specimens | DDBJ no. | |||||
|---|---|---|---|---|---|---|---|---|---|---|
| PAP staining
|
HI test
|
NT test
|
||||||||
| 8E6 | 10B8 | 8E6 | 10B8 | 8E6 | 10B8 | |||||
| Group 1 | ||||||||||
| B/Osaka/728/97 | − | + | <100 | 6,400 | <100 | 102,400 | Asn, Thr | Mar. 17 | AB029623 | |
| B/Osaka/710/97 | − | + | <100 | 6,400 | <100 | 102,400 | 596C→A | —, Asn | Mar. 17 | AB029621 |
| Group 2 | ||||||||||
| B/Osaka/837/97 | + | + | 400 | 6,400 | 100 | 102,400 | 591C→A | Lys, — | Mar. 19 | AB029626 |
| B/Osaka/1146/97 | + | + | 100 | 12,800 | 400 | 102,400 | 591C→A | Lys, — | Apr. 28 | AB029620 |
| Group 3 | ||||||||||
| B/Osaka/854/97 | + | + | 25,600 | 25,600 | 409,600 | 102,400 | 590A→G | Ser, — | Mar. 27 | AB029627 |
| B/Osaka/755/97 | + | + | 6,400 | 6,400 | 51,200 | 51,200 | 595A→G | —, Ala | Mar. 19 | AB029624 |
| B/Osaka/820/97 | + | + | 6,400 | 6,400 | 102,400 | 102,400 | 595A→G | —, Ala | Mar. 24 | AB029625 |
| B/Osaka/983/97 | + | + | 6,400 | 6,400 | 51,200 | 102,400 | 595A→G | —, Ala | Apr. 4 | AB029628 |
| B/Osaka/1036/97 | + | + | 6,400 | 6,400 | 409,600 | 409,600 | 595A→G | —, Ala | Apr. 23 | AB029617 |
| Representative strains | ||||||||||
| B/Nagasaki/1/87 | + | + | 25,600 | 25,600 | 102,400 | 409,600 | 589A→G | Asp, — | ||
| B/Guandong/5/94 | − | + | <100 | 12,800 | <100 | 409,600 | 596C→T | —, Ile | ||
HI and NT test results are expressed as reciprocal of antibody dilution.
Dashes indicate same as B/Osaka/728/97.
B/Yamagata group strains did not react to 8E6 or to 10B8 (Table 1); therefore, we established six MAbs which specifically recognize the HA protein of B/Mie/1/93. All the B/Yamagata group strains were stained with the six MAbs in PAP staining. Two MAbs showed NT activities against 27 strains to the same degree as against B/Mie/1/93 (data not shown). The nucleotide sequencing of the HA1 region of four representative strains showed that 2 of 353 amino acid residues of HA protein were different; however, this did not affect the antigenicities against MAbs. Consequently, in contrast to B/Victoria group strains, B/Yamagata group strains isolated in the 1996–1997 epidemic season were homogeneous, at least as analyzed with the MAbs.
Our results support the idea that single amino acid substitutions are sufficient to alter the antigenicity of the HA molecule of influenza virus and clearly demonstrate that the influenza B virus B/Victoria group strains isolated in one epidemic season were heterogeneous.
Nucleotide sequence accession numbers.
DDBJ accession numbers were assigned to influenza B virus strains isolated in the 1996–1997 season as follows: AB029618 for B/Osaka/1058/97, AB029619 for B/Osaka/1059/97, AB033826 for B/Osaka/1169/97, and AB029622 for B/Osaka/711/97.
Acknowledgments
This work was supported by grants from the Ministry of Education, Science and Culture of Japan (10670376).
We thank Tetsuo Kase (Osaka Prefectural Institute of Public Health) for the 1996–1997 influenza B virus strains, and Yumiko Yamamoto for excellent technical assistance.
REFERENCES
- 1.Berton M T, Naeve C W, Webster R G. Antigenic structure of the influenza B virus hemagglutinin: nucleotide sequence analysis of antigenic variants selected with monoclonal antibodies. J Virol. 1984;52:919–927. doi: 10.1128/jvi.52.3.919-927.1984. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Cleveland S M, Taylor H P, Dimmock N J. Selection of neutralizing antibody escape mutants with type A influenza virus HA-specific polyclonal antisera: possible significance for antigenic drift. Epidemiol Infect. 1997;118:149–154. doi: 10.1017/s0950268896007303. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Kanegae Y, Sugita S, Endo A, Ishida M, Senya S, Osako K, Nerome K, Oya A. Evolutionary pattern of the hemagglutinin gene of influenza B viruses isolated in Japan: cocirculating lineages in the same epidemic season. J Virol. 1990;64:2860–2865. doi: 10.1128/jvi.64.6.2860-2865.1990. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Lambkin R, McLain L, Jones S E, Aldridge S L, Dimmock N J. Neutralization escape mutants of type A influenza virus are readily selected by antisera from mice immunized with whole virus: a possible mechanism for antigenic drift. J Gen Virol. 1994;75:3493–3502. doi: 10.1099/0022-1317-75-12-3493. [DOI] [PubMed] [Google Scholar]
- 5.Levandowski R A, Gross P A, Weksler M, Staton E, Williams M S, Bonelli J. Cross-reactive antibodies induced by a monovalent influenza B virus vaccine. J Clin Microbiol. 1991;29:1530–1532. doi: 10.1128/jcm.29.7.1530-1532.1991. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Levandowski R A, Regnery H L, Staton E, Burgess B G, Williams M S, Groothuis J R. Antibody responses to influenza B viruses in immunologically unprimed children. Pediatrics. 1991;88:1031–1036. [PubMed] [Google Scholar]
- 7.Lindstrom S E, Hiromoto Y, Nishimura H, Saito T, Nerome R, Nerome K. Comparative analysis of evolutionary mechanisms of the hemagglutinin and three internal protein genes of influenza B virus: multiple cocirculating lineages and frequent reassortment of the NP, M, and NS genes. J Virol. 1999;73:4413–4426. doi: 10.1128/jvi.73.5.4413-4426.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Luoh S-M, McGregor M W, Hinshaw V S. Hemagglutinin mutations related to antigenic variation in H1 swine influenza viruses. J Virol. 1992;66:1066–1073. doi: 10.1128/jvi.66.2.1066-1073.1992. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.McCullers J A, Wang G C, He S, Webster R. Reassortment and insertion-deletion are strategies for the evolution of influenza B viruses in nature. J Virol. 1999;73:7343–7348. doi: 10.1128/jvi.73.9.7343-7348.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Nakagawa N, Maeda A, Kase T, Kubota R, Okuno Y. Rapid detection and identification of two lineages of influenza B strains with monoclonal antibodies. J Virol Methods. 1999;79:113–120. doi: 10.1016/s0166-0934(99)00015-4. [DOI] [PubMed] [Google Scholar]
- 11.Nerome R, Hiromoto Y, Sugita S, Tanabe N, Ishida M, Matsumoto M, Lindstrom S E, Takahashi T, Nerome K. Evolutionary characteristics of influenza B virus since its first isolation in 1940: dynamic circulation of deletion and insertion mechanism. Arch Virol. 1998;143:1569–1583. doi: 10.1007/s007050050399. [DOI] [PubMed] [Google Scholar]
- 12.Okuno Y, Tanaka K, Baba K, Maeda A, Kunita N, Ueda S. Rapid focus reduction neutralization test of influenza A and B viruses in microtiter system. J Clin Microbiol. 1990;28:1308–1313. doi: 10.1128/jcm.28.6.1308-1313.1990. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Okuno Y, Isegawa Y, Sasao F, Ueda S. A common neutralizing epitope conserved between the hemagglutinins of influenza A virus H1 and H2 strains. J Virol. 1993;67:2552–2558. doi: 10.1128/jvi.67.5.2552-2558.1993. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Rota P, Wallis T R, Harmon M W, Rota J S, Kendal A P, Nerome K. Cocirculation of two distinct evolutionary lineages of influenza type B virus since 1983. Virology. 1990;175:59–68. doi: 10.1016/0042-6822(90)90186-u. [DOI] [PubMed] [Google Scholar]
- 15.Ueda M, Maeda A, Nakagawa N, Kase T, Kubota R, Takakura H, Ohshima A, Okuno Y. Application of subtype-specific monoclonal antibodies for rapid detection and identification of influenza A and B viruses. J Clin Microbiol. 1998;36:340–344. doi: 10.1128/jcm.36.2.340-344.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Yamashita M, Krystal M, Fitch W M, Palese P. Influenza B virus evolution: co-circulating lineages and comparison of evolutionary pattern with those of influenza A and C viruses. Virology. 1988;163:112–122. doi: 10.1016/0042-6822(88)90238-3. [DOI] [PubMed] [Google Scholar]