Right predominant electrical remodeling in a pure model of pulmonary hypertension promotes reentrant arrhythmias

Abstract

Background:

Electrophysiological (EP) properties have been studied mainly in the monocrotaline (MCT) model of pulmonary arterial hypertension (PAH). Findings are confounded by major extra-pulmonary toxicities which preclude the ability to draw definitive conclusions regarding the role of PAH per-se in EP remodeling.

Objective:

To investigate the EP substrate and arrhythmic vulnerability of a new model of PAH that avoids extra-cardiopulmonary toxicities.

Methods:

Sprague-Dawley rats underwent left pneumonectomy (Pn) followed by injection of the VEGF inhibitor Sugen-5416 (Su/Pn). 5-wks later, cardiac-MRI was performed in-vivo, optical AP mapping ex-vivo and molecular analyses in-vitro.

Results:

Su/Pn rats exhibited RV hypertrophy and were highly prone to pacing-induced VT/VF. Underlying this susceptibility was disproportionate RV-sided prolongation of AP duration, which promoted formation of right-sided AP alternans at physiological rates. While propagation was impaired at all rates in Su/Pn, the extent of conduction slowing was most severe immediately prior to emergence of inter-ventricular lines of block and onset of VT/VF. Measurement of the cardiac wavelength revealed a decrease in Su/Pn relative to CTRL. Nav1.5 and total-Cx43 expression were not altered while Cx43 phosphorylation was decreased in PAH. Col1a1 and Col3a1 transcripts were upregulated coinciding with myocardial fibrosis. Once generated, VT/VF was sustained by multiple reentrant circuits with lower frequency of RV activation due to wavebreak formation.

Conclusion:

In this pure model of PAH, we document RV-predominant remodeling that promotes multi-wavelet reentry underlying VT. The Su/Pn model represents a severe form of PAH that allows the study of EP properties without the confounding influence of extra-pulmonary toxicity.

INTRODUCTION

Pulmonary arterial (PA) hypertension (PAH) is a chronic condition, characterized by a mean PA pressure >25mmHg. Uncorrected, the resultant increase in afterload on the right heart leads to right ventricular (RV) failure and death. Beyond dysregulated hemodynamics, our group and others have demonstrated considerable electrophysiological (EP) remodeling and enhanced arrhythmogenesis in rodent models of this disease. Specifically, we recently characterized the monocrotaline (MCT) model as a surrogate of PAH.¹ MCT is a pyrollizidine alkaloid, which is converted to MCT pyrrole by the cytochrome P450 of the liver, a metabolite that increases the pulmonary vascular resistance and thus PA pressure.^2–4 Despite being one of the most widely utilized animal models for investigating basic mechanisms of PAH, the multiplicity of actions of MCT, including its potent extrapulmonary toxicity and associated liver failure, precludes the ability to draw definitive conclusions from those studies regarding the role of pulmonary remodeling, per se, in cardiac dysfunction. Indeed, the range of phenotypes that are encountered in MCT-induced PAH, including consistent vasoconstriction, interstitial pulmonary edema, myocarditis, and hepatotoxicity, deviate from those typically found in patients with the disease.²

For these reasons, models that are more faithful to the human phenotype have been recently pursued. One such approach, on the basis of increased flow velocity and inhibited compensatory angiogenesis,⁵ is that of surgical left pneumonectomy combined with administration of SU-5416, a selective tyrosine kinase inhibitor of the vascular endothelial growth factor (VEGF) receptor⁶ and previous antitumor candidate.⁷ Indeed, recent reports indicate that this model induces hallmark features of the human disease, including RV mechanical dysfunction, plexiform lesion formation, vascular inflammation, inhibited endothelial apoptosis and enhanced proliferation.^8–10 Yet, the EP consequences of pure pulmonary remodeling and the potential for increased arrhythmia susceptibility, in this combined SU-5416 and pneumonectomy (Su/Pn) model remain unknown.

METHODS

All experiments involving animal handling were reviewed and approved by the Institutional Animal Care and Use Committee and adhered to the Guide for the Care and Use of Laboratory Animals published by the U.S. National Institutes of Health. Adult male Sprague Dawley rats (N=27) underwent either no intervention (CTRL, N=13) or left pneumonectomy (Pn) followed 1-week later by administration of SU-5416 (Su, 20 mg/kg), to increase pulmonary pressure (N=14) in a model herein referred to as Su/Pn. Briefly, animals were intubated and anesthetized with isoflurane (4%). Left thoracotomy was performed as described previously.¹¹ The left pulmonary artery, pulmonary vein, and bronchus were ligated, and the left lung was removed. The chest was closed, and the animals recovered with 0.1 mg/kg of subcutaneous buprenorphine every 12 hours for 3 days for pain control. 1-week following surgery, 20mg/kg SU-5416 was injected subcutaneously. At the 5-week terminal time-point (Figure 1A), rats underwent cardiac magnetic resonance imaging (MRI) and were euthanized by high dose pentobarbital (150mg/Kg, IP) with rapid thoracotomy and heart excision for electrophysiological (EP), molecular, and/or histological analyses.

Figure 1. Experimental design.

A. Schematic depicting the experimental design. Sprague Dawley rats underwent left pneumonectomy and received one-week later SU-5416 (20 mg/kg). Five weeks after surgery, MRI and hemodynamics were performed and rats were sacrificed. A subset of hearts were then excised for ex vivo optical action potential mapping studies or prepared for subsequent molecular, biochemical, and histological assays. B. Pulmonary artery systolic pressure (PASP), diastolic pressure (PADP), and mean pulmonary pressure (mPAP) measured in the indicated groups. n=5–6 rats per group. C. (Left) Representative H&E-stained sections of small pulmonary arteries from the indicated groups. Scale bar: 50μm. (Right) Percentage of the medial thickness of small arteries in relation to the cross-sectional diameter. n=5 rats per group. D. (Left) Representative wheat germ agglutinin (WGA)-staining of midventricular sections to assess hypertrophy of cardiac myocytes. Scale bar: 50 μm. (Right) Quantitative analysis; n=5 rats/group. E. Quantitative real-time PCR analysis of a molecular marker for cardiac myocyte hypertrophy (Nppb, Natriuretic Peptide B). n=5 rats/group. *** P<0.001 by T test.

Optical action potential mapping of ex-vivo perfused hearts

Hearts from CTRL and Su/Pn rats were perfused ex-vivo with Tyrode’s solution at 37°C as detailed previously.^{12, 13} Both atria were surgically excised; thereby allowing reliable ventricular pacing over a wide range of stimulation frequencies (PCL 300ms to 60ms). Perfusion pressure was continuously monitored in real time and maintained at ~65 mmHg by regulating perfusion flow. Su/Pn and CTRL hearts were placed in a custom-built plexiglass tissue bath, and the anterior surface was positioned against the glass imaging window.^{12, 14, 15} Movement artifact was suppressed with 10μM blebbistatin delivered over a 10min interval at the onset of the protocol. Hearts were stained with the voltage-sensitive dye di-4-ANEPPS allowing measurements of optical action potentials using an 80×80 pixel CCD camera as previously detailed.^{1, 13} High-resolution (1.0-ms temporal, 0.11-mm spatial) optical action potentials were measured simultaneously from 6400 sites spanning a 9×9mm² region covering both ventricles during each recording. To improve signal quality, 4×4 pixel spatial binning was performed yielding an array of 400 (20×20) high-fidelity optical action potentials that were amenable for accurate automated analyses.

Electrophysiological Measurements

Hearts from CTRL (N=5) and Su/Pn (N=6) rats underwent pacing at progressively shorter pacing cycle lengths (PCLs) ranging from 300 to 60ms or until sustained ventricular tachycardia/fibrillation (VT/VF) was generated and maintained without exogenous pacing for at least 30-seconds. Conduction velocity (CV) was measured by averaging the magnitude of the velocity vectors along the transverse axis of impulse propagation. The critical conduction velocity (CV_c) was defined as the last measurable CV at the fastest rate before induction of VT/VF or the end of the experimental protocol if VT/VF could not be induced. Action potential duration (APD₇₅) was defined as the difference between the repolarization (at 75% relative to the amplitude) and activation times at each site. Mean LV and RV APD₇₅ values were measured and the interventricular APD gradient (LV-RV) was determined.

Real Time Polymerase Chain Reaction

Total RNA was isolated using TRIzol Reagent (Zymo Research). 100ng of total RNA was used for the reverse transcription according to the manufacturer’s instructions (High-Capacity cDNA Reverse Transcription Kit, Thermo Fisher Scientific). Quantitative real time PCR amplification of cDNA was performed using the PerfeCTa SYBR Green FastMix (Quantabio). Sequences of primers used for real-time PCR were as follows:

Gene	Forward Primer (5’→ 3’)	Reverse Primer (5’→ 3’)
Nppb	ACAATCCACGATGCAGAAGCT	GGGCCTTGGTCCTTTGAGA
Col1a1	AATGGTGCTCCTGGTATTGC	GGTTCACCACTGTTGCCTTT
Col3a1	GGGATCCAATGAGGGAGAAT	GGCCTTGCGTGTTTGATATT
Fibronectin	CCGGTGGCTGTCAGTCAGA	CCGTTCCCACTGCTGATTTATC
Gja1	TATTCGTGTCTGTGCCCACC	CTGCTTCAGGTGCATCTCCA
Scn5a	GCTGGCTGGACTTCCTGATT	CGCAGTGTCCTCAGTGACTT
Kcnd2	CCACTGCACATCACCTCCAT	GTAGCTCAGGAGATGCGGTC
Kcnd3	GCTGTCTCGGTCATCACCAA	GTGAAGATCATGACGCACGC
Kcnj2	CATACCCGACAACAGTGCAG	GTCCGCCAGGTACCTCTGT
Kcnq1	GCATCACACCTCCCAGAAAT	CTGGCATGTCCCAGCTTTAT
Kcnh2	GCTTCCTGTGTTTGGTGGAT	CCCTACCATGTCCTTCTCCA

Magnetic Resonance Imaging

The Bruker Instruments rodent-only MRI scanner was used to perform high resolution in-vivo cardiac MR imaging of CTRL (N=8) and Su/Pn (N=8) rats. This advanced 7-Tesla 89-mm bore MRI system operates at a proton frequency of 400-MHz. The system is equipped with dual respiratory and cardiac sensors connected to a monitoring and gating system. Briefly, rat anesthesia was maintained at 1–1.5% throughout the duration of the scan. Each animal was imaged for 1.5 hours. Specific views acquired were standard for cardiac MRI including 2 chamber views, 4 chamber views and full short axis consisting of 1.2mm slice thickness from the basal-to-apical cardiac regions. All images were loaded into an advanced cardiac MR software analysis suite (SEGMENT, http://medviso.com/cmr/) and scored by two blinded observers. Standardized and advanced calculations of both left and right ventricles were acquired including chamber mass, volumes, ejection fraction, cardiac output, dimensions and strain.

Hemodynamic measurements

Animals were anaesthetized with 3–4% isoflurane, intubated via a tracheotomy, and mechanically ventilated. Next, the thoracic cavity was opened and a catheter (Transonic Systems Inc.) was inserted directly into the right ventricle or the pulmonary artery. Heart rate, pulmonary artery systolic pressure, pulmonary artery diastolic pressure, right ventricular end-systolic and diastolic pressures were measured directly. Hemodynamic data were recorded using an ADVantage P–V Control Unit (Transonic Systems).

Lung tissue histology

Lungs were inflated with OCT/PBS (50/50), then embedded in OCT, frozen and sectioned. 8-μm sections were fixed with 1% PFA. Sections were stained using H&E. Pulmonary arterioles located distal to terminal bronchioles were identified. The external diameter and the cross-sectional medial wall thickness were measured in arteries either ≤50μm or >50μm in external diameter. For each animal, medial thickness of at least 20 arteries was measured. Fibrosis and collagen deposition were examined in frozen lung tissue sections (8μm) that were fixed in 1% PFA and stained with Masson’s Trichrome stain. Collagen deposition was quantified using Image J software.

Right ventricular histology

The hearts were dissected immediately after sacrifice. The weight ratio of the right ventricle (RV) to the left ventricle (LV) plus septum (S) was calculated as an index of right ventricular hypertrophy [RV/(LV+S)]. For the analysis of collagen deposition, OCT sections of right ventricular myocardium (8-μm) were stained with Sirius Red and Fast Green as previously described.¹⁶ Collagen content was calculated as the percentage of the area in each section that was stained with Sirius Red. The cross-sectional area in cardiomyocytes was determined on 8-μm thick tissue sections of RV myocardium stained with Alexa Fluor 647–labeled wheat-germ agglutinin (WGA) (Thermofisher) and DAPI (Life Technologies).

Statistical Analyses

Data are presented as mean ±SEM. Fisher’s exact test was used to compare differences in VT/VF propensity between Su/Pn and CTRL groups. Comparisons between Su/Pn and CTRL groups in terms of each electrophysiological, hemodynamic or morphometric parameter, protein or mRNA expression levels were performed using the student’s t-test. Each figure legend contains specifics of the statistical test including N numbers used for each comparison.

RESULTS

Su/Pn model recapitulates hallmark features of PAH

We began by systematically characterizing the major cardiopulmonary manifestations of the Su/Pn model (Figure 1A). In comparison with CTRL, Su/Pn rats exhibited markedly increased PA systolic and diastolic pressures and mean PA pressure consistent with PAH (Figure 1B). In addition, morphometric analysis of the walls of the distal pulmonary arteries from Su/Pn rats revealed a significant increase in medial thickness (Figure 1C). Histological analysis of RV tissue by WGA staining demonstrated an increase in cardiomyocyte size (Figure 1D). A concomitant rise in the mRNA expression of the hypertrophy-associated marker gene Nppb confirmed the induction of hypertrophy in the RV (increase by > 10-fold, Figure 1E) and to a much lesser extent in the LV (Nppb increase by approx. 1.5-fold, not shown) in Su/Pn relative to CTRL. Altogether, these results indicate that Su/Pn in rats induces significant PAH with associated histopathological cardiac remodeling, indicative of an advanced disease phenotype.

Su/Pn induces right ventricular hypertrophy and dysfunction

Cardiac MRI was performed to assess the development of cardiac hypertrophy and dysfunction five weeks after surgery. These measurements revealed a significant (by ~50%) decrease in the tricuspid annular plane systolic excursion (TAPSE) (Figure 2A). Increased ventricular mass was also observed in both ventricular chambers, but with a much more pronounced increase in the right (>400%) compared to left (~20%) ventricles (Figure 2B). Similarly, the Fulton index was significantly increased in Su/Pn rats (Figure 2C). An increase in RV width (but not RV length, Figure 2D) was accompanied by a marked rise in RV end-systolic and end-diastolic volumes in Su/Pn animals (Figure 2E). Significant RV volumetric overloading and septal wall abnormalities resulted in a compromised LV structure with decreased loading volume. Reduced RV ejection fraction in the wake of preserved LV function was detected in Su/Pn hearts along with a decrease in cardiac output (Figure 2F). In accordance with the MRI measurements, morphometric analysis of the Fulton index further confirmed the development of RV hypertrophy (Figure 2G).

Figure 2. Sugen/Pneumonectomy leads to right ventricular hypertrophy and dysfunction.

A. Tricuspid annular plane systolic excursion (TAPSE), B. right and left ventricular masses and C. Fulton index assessed by MRI (n=8 rats/group). D. Right and left ventricular length and width (n=8 rats/group). E. Right and left ventricular end-diastolic and end-systolic volumes (n=8 rats/group). F. (Left) MRI analyses of ejection fraction as a measure of right and left ventricular function. (Right) Cardiac output. n=8 rats/group. G. Morphometric analysis of right ventricular weight, left ventricular weight and Fulton index in Su/Pn and CTRL rats. n=5 rats/group. NS: not significant, *P<0.05; ***P<0.001, ****P<0.0001 by T-test.

Su/Pn hearts exhibit increased susceptibility to sustained ventricular arrhythmias

Having established a robust model of PAH-related cardiac dysfunction, we next examined indices of EP remodeling and propensity for ventricular arrhythmias. First, we challenged both CTRL and Su/Pn hearts with steady-state pacing at progressively more rapid rates down to a pacing cycle length (PCL) of 60ms or the induction of VT/VF. Remarkably, all Su/Pn hearts that underwent this mild arrhythmia induction protocol exhibited sustained VT/VF compared to none of the CTRL hearts (6/6 vs 0/5, respectively) (Figure 3A&B). Shown in Figure 3C is a representative map of the local activation frequency during VT/VF in a Su/Pn heart with select LV and RV action potential traces showing more rapid and regular activation in the former versus latter. Detailed analysis revealed significantly greater local activation frequency during VT/VF in the LV apex and LV base compared to their RV counterparts (Figure 3D). Close examination of the regional distribution of action potentials prior to induction of VT/VF revealed consistent presence of AP alternans selectively in the RV of Su/Pn but not CTRL hearts (Figure 4).

Figure 3. Experimental design, Incidence and mode of induction of VT/VF.

A. Incidence of pacing-induced VT/VF in CTRL and Su/Pn hearts (n=0/5 CTRL and 6/6 Su/Pn). **P=0.0022 with Fisher’s exact test. B. Mode of VT/VF induction. Representative AP traces recorded from the RV of CTRL (black) and Su/Pn (red) hearts during pacing at progressively shorter PCLs leading to initiation of sustained VT/VF in Su/Pn. C. Regional distribution of local activation frequency during ongoing VT/VF (left) and representative LV and RV action potential traces documenting more rapid and regular activation patterns in the former compared to latter. D. Average frequency of activation during VT/VF in the LV and RV apical and basal regions. **P<0.01 by T-test.

Figure 4. Right-sided AP Alternans in Su/Pn hearts.

Top. Representative AP traces chosen on the mapping field from LV to RV side of a Su/Pn heart at different pacing cycle lengths showing the presence of right-sided alternans preceding VT/VF. Bottom. Representative AP traces from CTRL and Su/Pn hearts at PCL 90ms showing the presence of alternans only in Su/Pn hearts.

Su/Pn hearts exhibit disproportionate right-sided APD prolongation

Having identified a heightened propensity for arrhythmias in the hearts of Su/Pn rats, we next examined the EP substrate. We observed an overall prolongation of APD in Su/Pn hearts especially at slow pacing rates that were driven predominantly by a disproportionate increase of the APD in the right versus left ventricles (Figure 5A&B). This unmasked a large inter-ventricular APD gradient (negative value reflecting LV < RV) at basal but not rapid pacing rates in Su/Pn hearts (Figure 5C). To assess whether changes in APD were related to remodeling of repolarizing ion channels, we quantified the expression of the pore-forming α-subunits of the transient outward K-current known to contribute significantly to AP repolarization in rodents. Consistent with APD prolongation, we found markedly decreased mRNA and protein expression of both Kv4.2 (KCND2) and Kv4.3 (KCND3) in the RV of Su/Pn rats (Figure 5D).

Figure 5. AP remodeling in CTRL and Su/Pn hearts.

A&B. Average rate-dependent RV and LV APD₇₅ in CTRL (black) and Su/Pn (red) hearts. C. Average inter-ventricular APD₇₅ gradient in CTRL (black) and Su/Pn (red) hearts. N=5 CTRL, 6 Su/Pn. *P <0.05, **P <0.01, ***P <0.001, ****P <0.0001 with student’s t-test. D. qPCR and western blot analysis of K-channel subunits KCND2 (Kv4.2) and KCND3 (Kv4.3) in the RV of CTRL and Su/Pn rats. N = 5 rats per group. *P<0.05; **P<0.01; ***P<0.001 by T-test.

Su/Pn hearts exhibit fibrosis-dependent myocardial conduction slowing

As shown in Figures 6A, Su/Pn hearts exhibit significantly slower conduction velocity (CV) at all PCLs tested. While conduction was impaired (by ~35%) at the basal PCL of 300ms, differences in CV between Su/Pn and CTRL hearts increased with heart rate elevation (PCL shortening). Ultimately, functional lines of block emerged at rapid rates in Su/Pn hearts prior to VT/VF initiation (Figure 6B). Analysis of the critical CV (CV_c) obtained either at the fastest steady-state pacing rate prior to VT/VF induction in Su/Pn hearts or at the end of the pacing protocol (i.e PCL 60ms) in CTRL hearts revealed significantly slower CV_c in Su/Pn compared to CTRL hearts (Figure 6C). Analysis of the critical wavelength (product of APD and CV at the fastest rate prior to induction of VT/VF) revealed significantly shorter λ in the Sn/Pn group compared to CTRL (Figure 6D).

Figure 6. Myocardial conduction slowing and molecular determinants.

A. Rate-dependence of CV in CTRL (black, n=5) and Su/Pn (red, n=6) hearts. B. Representative isochrone maps of CTRL and Su/Pn hearts at PCL of 300ms, 140ms, and 100ms showing emergence of lines of conduction block that delay RV activation. This was followed by induction of sustained VT/VF (trace below) C. Comparison of mean critical conduction velocity (CV_C) between CTRL and Su/Pn groups (n=5 CTRL and n=6 Su/Pn). D. Comparison of the critical wavelength (λ, cm) of both CTRL and Su/Pn hearts in which λ is product of critical CV and average APD₇₅ (N=5 CTRL, N=5 Su/Pn). *P <0.05, **P <0.01, ***P <0.001, measured with T-test.

We next examined the putative molecular mechanisms underlying CV slowing in this model. We found that the mRNA and protein expression (Fig 7A) of SCN5a/Nav1.5 were unchanged in Su/Pn hearts. While total Cx43 expression was not altered, its S368 phosphorylated component was markedly reduced in Su/Pn (Figure 7B). Next, we assessed the extent of myocardial fibrosis. Quantitative real-time PCR analysis of Col1a1 and Col3a1 showed increased mRNA levels of these fibrosis-associated markers in the RV (Figure 7C). Finally, sirius red staining confirmed presence of substantial interstitial fibrosis in RV sections of Su/Pn but not CTRL hearts (Figure 7D).

Figure 7. Molecular and cellular determinant of conduction slowing.

A. qPCR analysis of Nav1.5/SCN5a in the RV of Su/Pn and CTRL. B. Protein expression of total and phosphorylated (at S368) components of Cx43. C. qPCR quantification of markers for fibrosis in RV tissue from CTRL and Su/Pn. Col1a1 and Col3a1 mRNAs were assessed. N=5–6 rats/group. D. (Left) Representative Sirius Red/Fast Green-stained sections (left) and quantification of fibrosis (right); N=5 rats/group. **P<0.01; ***P<0.001; by T-test.

DISCUSSION

Pulmonary hypertension carries a 5-year mortality rate of 40–60% depending on the specific disease etiology.¹⁶ The overlap between pulmonary hypertension and cardiovascular disease is epitomized by the fact that RV failure is the major cause of death in PAH. Indeed, increasing clinical and experimental lines of evidence are pointing to the relevance of arrhythmias and sudden cardiac death in PAH related morbidity and mortality.¹⁷ While mechanisms underlying arrhythmias in the settings of LV hypertrophy and failure have been extensively studied, the same is not true for RV failure. Despite elucidation of mechanical and structural remodeling that promote RV failure in PAH, arrhythmic vulnerability is far less understood and likely to be underappreciated.

Establishment of the MCT rat model for PAH has facilitated recent investigation of its electrophysiology. However, given the important off-target effects of MCT such as LV myocarditis, the underlying cause of severe arrhythmia induction in previous reports,^18–22 including our own,¹ must be called into question: Is heightened arrhythmia vulnerability in these studies caused directly by PAH-induced RV remodeling per se, or does it rather stem from off-target effects related to MCT toxicity? To address this, we investigated the EP properties of a relatively pure model of PAH-related myocardial dysfunction caused by combined pneumonectomy followed by SU-5416 administration. Indeed, our current findings shed light on the importance of PAH in the establishment of RV-sided electrical remodeling that favors the induction of VT/VF and likely contributes to sudden cardiac death. Our major findings are as follows: 1) Su/Pn hearts are exquisitely prone to rapid pacing-induced VT/VF. 2) Underlying this differential susceptibility is disproportionate RV-sided APD prolongation. 3) This, in turn, promotes the formation of right-sided AP alternans at physiological rates in Su/Pn but not CTRL. 4) While propagation is impaired at all rates in Su/Pn, the most profound decrease in conduction velocity emerges prior to VT/VF initiation. 5) Once generated, VT/VF is sustained by reentrant circuits likely facilitated by the short wavelengths.

Electrical Remodeling in the Su/Pn model

A major finding of our current report is the RV-biased nature of EP remodeling in Su/Pn rats which is much more evident than that of the standard MCT model.¹ Indeed, we uncovered highly preferential APD prolongation in the RV versus LV in this model. Contributing to the chamber-specific APD prolongation were transcriptional changes in the main pore-forming subunit encoding the transient outward K-current. Future studies are needed to determine mechanisms underlying the transcriptional regulation of key repolarizing ion channels in PAH with focus on potential changes in transcription factors that contribute to right-left asymmetry and/or changes in the microRNAome profile. Moreover, studies are also needed to define post-transcriptional regulation of ion channel function in the RV and LV of PAH.

We and others have emphasized the role of APD prolongation in the pathogenesis of malignant arrhythmias. This, we found, was caused by increased transmural or transepicardial APD gradients in multiple disease settings including LV hypertrophy¹² and non-ischemic dilated cardiomyopathy.^{15, 23} Moreover, Volders et al.²⁴ have elegantly documented the importance of inter-ventricular APD heterogeneity driven by preferential left-sided APD prolongation in animal models of hypertrophy, including the canine AV block model. Steeper steady-state APD restitution in the RV vs LV of Su/Pn hearts gave rise to a large interventricular APD gradient at relatively slow (basal) but not fast heart rates, and hence were not directly related to the pathogenesis of VT/VF in our study. The extent to which the inter-ventricular APD gradient may promote pause-dependent arrhythmias warrant further testing in future studies.

Another major finding of the present report was the clear evidence of APD alternans at physiological rates in Su/Pn but not CTRL hearts. The clinical relevance of this finding is borne out of recent reports of increased microvolt T-wave alternans on the surface ECG of patients with PAH²⁵. In fact, Danilowicz-Szymanowicz et al.²⁶ reported similar levels of microvolt T-wave alternans in patients with RV remodeling driven by PAH as those with severe LV dysfunction due to left-sided heart failure. In our study, APD alternans seemed to follow the basal inter-ventricular APD gradient as they developed exclusively in the RV and not the LV of Su/Pn hearts. While our findings suggest the potential importance of impaired repolarization possibly due to K-channel downregulation as a potentiating factor of APD alternans in this model, whether or not this association is rooted in mechanistic links remains unresolved. Multiple factors such as known differences in intracellular calcium cycling of RV myocytes in PAH likely contributed to the RV-sided nature of APD alternans,²⁷ and this issue will require direct investigation in our model.

Nonetheless, the functional significance of APD alternans in PAH-related VT/VF is evident by the fact that RV-sided alternans always preceded the onset of pacing-induced VT/VF in this model and likely contributed to wavebreak formation that led to lower frequency of activation on the right side during ongoing VT/VF. Of note, our current findings of APD alternans at elevated rates suggest the importance of non-invasive testing for T-wave alternans during exercise as a potential harbinger of sudden cardiac death in patients with documented PAH.

Finally, as with other structural heart diseases that favor arrhythmias, CV slowing was an important feature of Su/Pn hearts. While conduction was moderately impaired at basal rates, the severity of CV slowing was significantly increased at rapid rates leading to the formation of functional lines of block culminating in VT/VF. CV slowing was the driver of wavelength shortening at those rates. This likely facilitated the stabilization of reentrant activation patterns that maintained VT/VF in this model. We and others have found gap junction remodeling to be a major factor in CV slowing in the context of LV hypertrophy¹² and failure,^{14, 15}. As with our previous studies, we found that loss of Cx43 phosphorylation, as opposed to reduced total expression of the protein was the likely factor contributing to conduction slowing in this model. Of note, previous studies in the rat model of aortic banding induced LVH revealed that Cx43 dephosphorylation at Ser-368 is a late event that correlates with severe remodeling and conduction slowing. This strongly suggests that the PAH-induced molecular and functional remodeling that we observed in Su/Pn rats reflect an advanced disease stage.

Altogether, the main findings of this work highlight the Su/Pn model as a pure model of PAH that recapitulates the histopathological features, morphological cardiac remodeling and cardiac dysfunction present in PAH patients. Indeed, the Su/Pu model represents a severe form of PAH that allows the study of electrophysiological properties without the confounding influence of extra-pulmonary toxicity in standard models. We document highly-selective RV-sided EP remodeling that facilitates the initiation of multi-wavelet micro-reentry underlying VT/VF.