Skip to main content
Springer logoLink to Springer
. 2022 Jan 9;204(2):130. doi: 10.1007/s00203-021-02623-w

Penicillinase plasmid Australia type in Neisseria gonorrhoeae isolated in Poland

Szymon Walter de Walthoffen 1,✉
PMCID: PMC8743264  PMID: 34999997

Abstract

Purpose

Neisseria gonorrhoeae is an etiological agent of gonorrhea which remains a major public health problem the mechanisms that determine resistance to drugs of the beta-lactam class, which are recommended for the treatment of gonorrhea, are currently the most important problem in its treatment. Chromosomal mutations are responsible for resistance to ceftriaxone and cefepime. The possibility of mutations in the gene encoding beta-lactamase (blaTEM) in the penicillinase plasmid may also turn out to be a serious threat.

Methods

The occurrence of resistance encoded on penicillinase plasmid has been investigated. For this purpose, the susceptibility of bacteria was determined and the gene for resistance to beta-lactams as well as the plasmids themselves was typed.

Results

Of the 333 strains tested, 21 (6.3%) had the beta-lactamase gene and produced penicillinase. Two of the beta-lactamase: TEM-1 and TEM-135 occurred among the tested strains of N. gonorrhoeae. Most of the known penicillinase plasmid types of N. gonorrhoeae were demonstrated: the Asian, the African, the Toronto/Rio plasmids and Australian variants.

Conclusions

In the first 3 years, TEM-1 beta-lactamases dominated in N. gonorrhoeae, which were replaced by TEM-135 in the following years of the study. Not all molecular methods are capable of varying the types of penicillinase plasmids. A particularly noteworthy observation is the fact that the Australia-type of penicillinase plasmid (3270 bp) was identified for the first time in Europe, and the second time in the world.

Electronic supplementary material

The online version of this article (10.1007/s00203-021-02623-w) contains supplementary material, which is available to authorized users.

Keywords: Neisseria gonorrhoeae, Drug resistance, Beta-lactamase, Penicillinase plasmids

Introduction

Neisseria gonorrhoeae is the etiological agent of gonorrhea which remains a major public health problem. According to the World Health Organization (WHO), there were 87 million cases of gonorrhea worldwide in 2016 (Unemo et al. 2017; Walter de Walthoffen 2021). Gonorrhea often occurs together with other sexually transmitted diseases (Mlynarczyk-Bonikowska et al. 2014; Skulska et al. 2015; Młynarczyk-Bonikowska et al. 2015). Infectious diseases including gonorrhoea are to be covered by an epidemiological surveillance network according to COMMISSION IMPLEMENTING DECISION (EU) 2018/945 of 22 June 2018. N. gonorrhoeae has developed multiple resistance mechanisms, which is related to the history of the introduction of new antibiotics into gonorrhoea therapy. Currently, the most significant problem is the production of mechanisms determining resistance to drugs from the group of oxyimino-cephalosporins (Extended spectrum beta-lactamases, ESCs) which are recommended for the treatment of gonorrhea. Chromosomal mutations are responsible for resistance to ceftriaxone and cefepime. Also of great danger is the possibility of a mutation in the penicillinase plasmid, the gene encoding beta-lactamase (blaTEM) and that mutation can result in the formation of an ESBL-type enzyme (Arlet et al. 1999; Huang and Palzkill 1997; Ohnishi et al. 2010; Muhammad et al. 2014). Currently, gonococcal strains with plasmid- and/or chromosomally mediated resistance to penicillin are common globally (Unemo and Shafer 2014).

Typically, plasmids are irrelevant to their hosts and they only impose an energy burden that can slow cell growth (Kües and Stahl 1989). There is also a correlation between plasmid size and decreased viability at high concentrations of ampicillin to which resistance is caused by plasmids (Diaz Ricci and Hernández 2000; Cheah et al. 1987). Therefore, the occurrence of smaller plasmids (usually in higher copy numbers) in a population of N. gonorrhoeae strains may raise a concern about the accelerated evolution of the genes they encode that determine resistance to beta-lactam antibiotics (Walter de Walthoffen 2021).

In penicillinase-producing strains of N. gonorrhoeae (PPNG), 7 types of plasmids have been described and they have the blaTEM gene in their sequence and they differ in the number of nucleotide base pairs: Asian (7426 base pairs (bp))(Yeung et al. 1986), African (5598 bp) (Alergant et al. 1976; Phillips 1976), Toronto/Rio (5154 bp) (Yeung et al. 1986), and detected in single cases: Nîmes (6798 bp) (Gouby et al. 1986), New Zealand (9309 bp) (Brett 1989), Johannesburg (4865 bp) (Müller et al. 2011), Australia (3269 bp) (Trembizki et al. 2014; Whiley et al. 2014). These plasmids containing the beta-lactamase gene evolved by deletion or insertion of a plasmid fragment. The African and Toronto/Rio-type plasmid was created as a result of various deletions in the Asian plasmid sequence. The Australian plasmid was created as a result of the deletion in the Toronto/Rio plasmid, and the insertion in the Asian plasmid led to the creation of the New Zealand plasmid. The Nîmes-type plasmid was created as a result of the insertion in the African plasmid. These plasmids play an important role in the epidemiology of the spread of PPNG (Pagotto et al. 2000; Lewis 2010) and in the international spread of high-level penicillin resistance (Unemo and Shafer 2011; Berthold 1995).

Materials and methods

Bacterial isolates

A total of 333 Neisseria gonorrhoeae isolates obtained from the Department of Diagnostics of Sexually Transmitted Diseases, Department of Dermatology and Venereology of the Medical University of Warsaw were tested. These strains were isolated from clinical specimens in the years 2010–2014.

N. gonorrhoeae strains were cultured on PolyVitex VCAT3 Chocolate Agar (bioMerieux) and incubated in incubator HCP 105 (Memmert) at 37 °C in a humidified environment with 5% CO2 for 24–48 h. N. gonorrhoeae was identified using criteria including positive oxidase, acid production from glucose, and Gram-negative staining tests. Confirmed N. gonorrhoeae strains were plated on Mueller Hinton Chocolate Agar (MHCA) (Becton Dickinson) and cultured as previously described conditions before the antimicrobial susceptibility test. Isolates were stored at -80° using the Microbank™ system (Pro Lab Diagnostics).

Antimicrobial susceptibility testing

Benzylpenicillin minimum inhibitory concentrations (MICs) (0.008–64.0 mg/L) for N. gonorrhoeae were determined by dilution of the antibiotic method (E-test™) in medium (bioMerieux).

Inoculum of N. gonorrhoeae was established by suspending overnight cultures on MHCA medium in 0.9% McFarland's 0.5 standard density saline. The inoculum was inoculated with swabs onto MHCA-containing plates and then E-test™ was placed.

The plates were incubated for 18–24 h at 37 °C in anaerostats, in a gas atmosphere containing 15% O2, 75–80% N2, 5–10% CO2. The Cefinase™ identification test (bioMerieux) was used to detect beta-lactamase-producing Neisseria gonorrhoeae strains (PPNG) [29]. The MIC was calculated according to the European Committee for Antimicrobial Susceptibility Testing (EUCAST) guidelines EUCAST "European Committee on Antimicrobial Susceptibility Testing Breakpoint tables for interpretation of MICs and zone diameters Version 8.1, valid from 2018–05–15".

DNA isolation

DNA was extracted from bacterial suspensions of PPNG strains using a Genomic Mini DNA extraction kit (A&A Biotechnology, Poland). The method is based on the fact that nucleic acids bind to the silica membrane in the presence of chaotropic salts.

PCR detection of blaTEM gene

The PCR reaction was performed on a C 1000TM ThermalCycler (BIO-RAD, USA). Each 25 µL sample contained 1.5 µL of test DNA, 2.5 µL of 10 × buffer (MBI Fermentas, Lithuania), 2.5 µL of 1.5 mM MgCl2 (MBI Fermentas, Lithuania), 0.1 µL of 1.25 U Taq DNA polymerase (MBI Fermentas, Lithuania), 1 µL of 200 µM dNTPs (MBI Fermentas, Lithuania), 0.5 µL of each primer (oligo.pl, Institute of Biochemistry and Biophysics of the Polish Academy of Sciences IBB PAS, Warsaw), 16.4 µL of deionized H2O. The following parameters were used in the PCR reaction: 94 °C, 5 min; 35 cycles of 94 °C, 30 s, 57 °C, 30 s, 72 °C, 1 min. The primers with the following sequences were used: F,5′-GTCGCCCTTATTCCCTTTTTTG-3′; R, 5′-TAGTGTATGCGGCGACCGAG-3′ (Nakayama et al. 2012). Electrophoresis in 1% agarose gel (BioRad) was used to visualize the products against size standards (GeneRuler 1 kb DNA Ladder, Fermentas). PCR products stained by ethidium bromide were visualized in a Gel DOC TM XR + Imaging System BIO-RAD instrument.

Plasmid typing

Plasmid typing was used to determine the polymorphism of mobile genetic elements. The methods used for typing differentiate plasmids by size and on the basis of deletions or insertions in plasmids encoding beta-lactamase in N. gonorrhoeae strains. The methods used for typing include whole plasmid amplification, multiplex PCR and plasmid DNA sequencing.

In this study, the method developed by Pagotto et al. (2000) with modification by Ohnishi et al. (2010) and own method were used. The total DNA isolated from the test strains and the following primers bla-IR, 5'-TCGTGGTGTCACGCTC GTCG; bla-IF; 5'-CTGCAGCAATGGCAACAACGTTG were used for analysis.

Each 50 µL sample contained 3 µL of test DNA, 25 µL of GPB LA DNA polymerase (GenoPlastBiochemicals, Poland)—a kit for amplification of macromolecular DNA fragments, 1 µL of each primer, 20 µL of deionized H2O. The following parameters were used in the PCR reaction: 94 °C, 5 min; 10 cycles 94 °C, 20 s, 65 °C, 30 s, 68 °C, 50 s; 20 cycles of 94 °C, 20 s, 65 °C, 30 s, 68 °C, 1 min. The final elongation was carried out at 72 °C, 10 min. To visualize the products, 2% agarose gel electrophoresis was used, in the presence of 1 kb DNA size standards, under the following conditions: 120 V, 400 mA, 240 min, room temperature. After electrophoretic separation, the gel was stained in 150 ml of 1xTBE buffer with 1.5 µl of 10 µg/ml ethidium bromide for 30 min. The stained gel was photographed and documented in the chamber of the transilluminator previously described.

A multiplex PCR method developed by H. Palmer using four primers: BL1 5'-TACTCAATCGGTAATTGGCT-3'; BL2 5'-CACCTATAAATCTCGCAAGC-3'; BL3 5'-CCATAGTGTTGAGTATTGCGAA-3'; BL4 5'-TCATTCGTGCGTTCTAGGA-3' (Palmer et al. 2000) was used for the detection of deletions or insertions in penicillinase plasmids, The total volume of the reaction mixture was 25 µL and contained 1.5 µL of test DNA, 2.5 µL of 10 × buffer (MBI Fermentas, Lithuania), 2.5 µL of 1.5 mM MgCl2 (MBI Fermentas, Lithuania), 0.1 µL of 1.25 U Taq DNA polymerase (MBI Fermentas, Lithuania), 1 µL of 200 µM dNTPs (MBI Fermentas, Lithuania), 0.5 µL of each primer, 15.5 µL of deionized H2O. The following parameters were used in the PCR reaction: 94 °C, 3 min; 31 cycles of 94 °C, 20 s, 64 °C, 20 s, 72 °C, 1 min. The amplification of the smallest possible products, which allows to detect deletions in the plasmid, is possible by a properly designed elongation phase, and the predicted product size allows detection of a specific plasmid type: BL2 + BL3—958 bp—the Asian plasmid, BL1 + BL3—1191 bp—the African plasmid, BL2 + BL4—650 bp—the Toronto/Rio plasmid. Electrophoresis in 1% agarose gel, 1 kb DNA size standard (Fermentas) was used to visualize the products. PCR products stained with ethidium bromide were visualized in a transilluminator.

Next-Generation Sequencing (NGS) was commissioned and performed for the isolated plasmid DNA of strain NG200 and received resultant was the Sanger method was confirmed in the laboratory of DNA sequencing and Oligonucleotide Synthesis of the Institute of Biochemistry and Biophysics of the Polish Academy of Sciences (IBB PAS). Plasmid DNA was sheared mechanically to appropriate fragments which were used for Paired-End TruSeq libraries construction (KAPA Biosystems, USA) following the manufacturer's instructions. Libraries were sequenced using MiSeq instrument (Illumina, San Diego, CA). The obtained sequence reads were filtered by quality using FastX toolkit (http://hannonlab.cshl.edu/fastx_toolkit) and assembled using Newbler v3.0 software (Roche, USA) resulting in high-quality draft genome assemblies. All of the possible sequence errors and miss assemblies were further manually corrected using Seqman software (DNAStar, USA). Sequencing coverage was 433x.

Identification of the blaTEM genes

The PCR method developed by V. Speldooren for E. coli beta-lactamase was used to detect the TEM gene (Speldooren et al. 1998). To obtain the complete TEM beta-lactamase sequence (861 bp), three pairs of primers were used for amplification:

blaTEM-A 5′-ATAAAATTCTTGAAGAC 7-3′

blaTEM-B 5′-AAAACTCTCAAGGATCTT 382-3′

blaTEM-C 5′-AAAGATGCTGAAGATCA 301-3′

blaTEM-D 5′-TTTGGTATGGCTTCATTC 726-3′

blaTEM-E 5′-TTACCAATGCTTAATCA 652-3′

blaTEM-F 5′-TTTTTTGCACAACATGGG 1069–3′

The primers were designed to yield three products representing fragments of the entire blaTEM gene. The sequences of these products have complementary (common) fragments, allowing the sequenced products to be combined. The flanking primers are compatible with the sequence preceding the beta-lactamase encoding gene blaTEM-A, and the sequence following blaTEM-F.

In the PCR reaction, the same proportions of reactants were used for amplification as for penicillin plasmid identification. The following parameters were used in the reaction: 94 °C, 5 min; 36 cycles of 94 °C, 30 s, 42 °C, 1 min, 72 °C, 1 min. The final elongation was 10 min. The resulting PCR products were purified prior to sequencing by the EXO SAP method. The composition of the reaction mixture: 5 µl amplified DNA fragment, 0,5 µl EXO nuclease I, 1 µl Alkaline phosphatase. The purification was carried out in a thermocycler under the following conditions: Incubation I 37 °C for 15 min, Incubation II 85 °C for 15 min.

The purified products were sequenced in the DNA Sequencing and Oligonucleotide Synthesis Laboratory of the Institute of Biochemistry and Biophysics of the Polish Academy of Sciences using the same primers used for the PCR reaction. The sequencing results were analyzed using FinchTV version 1.4.0 and Serial Cloner 1.3.0 which was used to assemble the complete sequence of the blaTEM gene. The obtained nucleotide sequences of the tested beta-lactamases were compared with the database https://blast.ncbi.nlm.nih.gov.

Typing of N. gonorrhoeae strains using the NG-MAST method

NG-MAST is a typing method for N. gonorrhoeae strains that relies on the analysis of two highly polymorphic genes: porB (490 bp) and tbpB (390 bp). The following primers were used for amplification:

Por-F5’ 350 CAAGAAGACCTCGGCAA 366 3',

Por-R-5’ 1086 CCGACAACCACTTGGT 1071 3'

TbpB-F-5’ 1098 CGTTGTCGGCAGCGCGAAAAC 1118 3’,

TbpB-F-5′ 1686 TTCATCGGTGCGCTCGCCTTG 1666 3’.

The total volume of the reaction mixture was 50 µL and contained 2 µL of test DNA, 5 µL of 10 × buffer (MBI Fermentas, Lithuania), 5 µL of 1.5 mM MgCl2 (MBI Fermentas, Lithuania), 0.2 µL of 1.25 U Taq DNA polymerase (MBI Fermentas, Lithuania), 2 µL of 200 µM dNTPs (MBI Fermentas, Lithuania), 1 µL of each primer, 15.5 µL of deionized H2O. The following parameters for the porB gene were used in the PCR reaction: 94 °C, 4 min; 25 cycles of 94 °C, 30 s, 58 °C, 30 s, 72 °C, 1 min, and the following parameters were used for the tbpB gene: 94 °C, 4 min; 25 cycles 94 °C, 30 s, 69 °C, 1 min, 72 °C, 1 min. To obtain a pure PCR product for sequencing purposes, the purification was performed using the EXO SAP method as discussed above, and the products were sequenced using the same primers used in the PCR reaction at the DNA Sequencing and Oligonucleotide Synthesis Laboratory of the IBB PAS. The sequencing results were analyzed using FinchTV version 1.4.0 software and compared with the database at www.ng-mast.net.

Results and discussion

Among 333 strains isolated between 2010 and 2014, 21 (6.3%) possessed the beta-lactamase gene and produced penicillinase.

The determination of the type of penicillinase plasmid encoding beta-lactamases was performed using a multiplex PCR method detecting deletions in the plasmid. One (5%) of the 21 beta-lactamase-producing strains did not have a deletion in the plasmid and was classified as the Asian type (958 bp) based on the similarity in size of the amplified gene fragment. The deletions in the penicillinase plasmid were detected in 20 strains. The 13 strains (62%) producing beta-lactamase yielded a product size corresponding to the African plasmid (1191 bp), and 7 strains (33%) yielded a product size corresponding to Toronto/Rio plasmid (658 bp) (Fig. 1).

Fig. 1.

Fig. 1

Analysis of plasmids encoding beta-lactamase by amplified plasmid fragment size. W—GeneRuler 1 kb size standard, 1—Strain number NG1, 2- Strain number NG2, 3- Strain number NG6, 4- Strain number NG13, 5- Strain number NG24, 6- Strain number NG28, 7- Strain number NG32, 8- Strain number NG58, 9- Strain number NG112, 10- Strain number NG113, 11- Strain number NG119, 14- Strain number NG171, 21- Strain number NG328—type Africa (1191 bp), 12- Strain number NG162, 13- Strain number NG169, 15- Strain number NG200, 17- Strain number NG236, 18- Strain number NG306, 19- Strain number NG308, 20- Strain number NG315—Toronto / Rio type (658 bp), 16- Strain number NG206—Asia type (958 bp)

To confirm the above results, the whole plasmid amplification was performed for all 21 beta-lactamase producing strains. The results overlapped for 20 strains. Thirteen strains (62%) had an amplified plasmid size corresponding to the African type (7426 bp), in six strains (28%) the amplified plasmid was classified into the Toronto/Rio type (5154 bp), and one (5%) into the Asian type (742 bp). One NG200 test strain (no.15 in Fig. 1) (5%) had a plasmid size close to the 3500 bp size standard (Fig. 2).

Fig. 2.

Fig. 2

Analysis of beta-lactamase-encoding plasmid types by plasmid size. 1, 7—GeneRuler 1 kb size standard, 2, 6—Strain number NG200—type Australia (a product in size of about 3250 bp), 3—Strain number NG206—Asia type (a product in size of about 7500 bp), 4—Strain number NG162—Toronto/Rio type (a product in size of about 5000 bp), 5—Strain number NG1—type Africa (a product in size of about 5500 bp)

For strain NG200, the deletion detected by multiplex PCR developed by H. Palmer indicated a Toronto/Rio plasmid of 5154 bp (no. 15 in Fig. 1) (Palmer et al. 2000). In contrast, the actual plasmid size obtained by amplification of the entire plasmid was approximately 3500 bp (Fig. 2). NGS was performed for the isolated plasmid DNA of strain NG200 in the Institute of Biochemistry and Biophysics of the Polish Academy of Sciences. By sequencing this strain, three different plasmids of size were identified: 39,071 bp, 3270 bp, 4207 bp, while only the 3270 bp plasmid contained the beta-lactamase coding sequence. The sequence of the plasmid coding for the beta-lactamase is in Appendix A in Supplementary material. The comparison of the obtained sequence in Serial Cloner 1.3.0 and SnapGene programs, allowed to classify the penicillinase plasmid of strain NG200 to the Australian type, based on similarity to the type to Australian GenBank KJ842484. The collective results of the obtained results are presented in Table 1

Table1.

Comparison of the NG-MAST type with the type of penicillinase plasmid, the type of TEM enzyme and the MIC of penicillin and ceftriaxone

No Strain number Data Type of Plasmid Type of beta-lactamases ST NG-MAST MIC Penicillin mg/L MIC Ceftriaxone mg/L
1 NG1 2010 Afryka TEM-1 1478 8 0.004
2 NG2 2010 Afryka TEM-1 1478 4 0.002
3 NG6 2010 Afryka TEM-1 1478 32 0.002
4 NG13 2010 Afryka TEM-1 5421 8 0.002
5 NG24 2010 Afryka TEM-1 5421 4 0.004
6 NG28 2010 Afryka TEM-1 5421 4 0.004
7 NG32 2011 Afryka TEM-1 5421 4 0.002
8 NG58 2011 Afryka TEM-1 21 8 0.002
9 NG112 2012 Afryka TEM-1 1478 8 0.008
10 NG113 2012 Afryka TEM-1 3061 8 0.004
11 NG119 2012 Afryka TEM-1 21 8 0.002
12 NG162 2013 Toronto/Rio TEM-135 5624 256 0.004
13 NG169 2013 Toronto/Rio TEM-135 5624 256 0.004
14 NG171 2013 Afryka TEM-1 5793 4 0.004
15 NG200 2013 Australia TEM-135 5624 32 0.004
16 NG206 2013 Azja TEM-135 12,649 256 0.032
17 NG236 2014 Toronto/Rio TEM-135 5624 64 0.004
18 NG306 2014 Toronto/Rio TEM-135 5624 64 0.004
19 NG308 2014 Toronto/Rio TEM-135 5624 256 0.004
20 NG315 2014 Toronto/Rio TEM-135 5624 16 0.004
21 NG328 2014 Afryka TEM-1 16,014 8 0.004

The complete plasmid sequence of strain NG200 [Genbank number (appendix)], obtained during differentiation of the atypical Australian plasmid, showed mutations relative to the available sequence of the originally identified Australian plasmid: GenBank KJ842484 (Trembizki et al. 2014). The Australian plasmid variant (3269 bp) was detected in the PPNG strain studied. There is an adenine insertion at position 1806 in the sequence of the NG200 strain tested relative to the GenBank sequence: KJ842484. This mutation is located in the sequence encoding the replication initiator protein of the RepB family plasmid (GenBank: ARC00143.1) which also has topoisomerase I activity. The Rep 3 region of the RepB protein is responsible for initiating protein replication, whereas the RAMP I III region is responsible for the production of RAMP proteins (Repeat Associated Mysterious Proteins) which are involved in the regulation of the flow of genetic information CRISPR/ssCas (Clustered Regularly-Interspaced Short Palindromic Repeats) by interference (silencing) of genes (Wang and Li 2012).

Using two different electrophoresis-based PCR methods, differences in detected plasmid types were observed. In the multiplex PCR method detecting deletions in the plasmid, the penicillinase plasmid of strain NG200 was classified as the Toronto/Rio type, while using the whole penicillinase plasmid amplification method this result was not confirmed. Only sequencing of the plasmid confirmed that it was an Australian-type variant. The electrophoresis-based PCR techniques mentioned above do not accurately differentiate between N. gonorrhoeae plasmid types beyond the most commonly detected types: the Asian, the African, the Toronto/Rio types. Jo-AnneDillon et al., as authors of one of these methods themselves, noted that other types of penicillinase plasmids can only be identified by close genetic similarity as the Asian, the African or the Toronto/Rio plasmids (Dillon et al. 1999). The simultaneous use of two different methods based on electrophoresis (Ohnishi et al. 2010) confirmed the occurrence of the most common plasmid types and allowed to distinguish them from non-standard plasmid types. The most accurate method for differentiating penicillinase plasmid types appears to be the whole plasmid sequencing.

N. gonorrhoeae strains, producing TEM beta-lactamase, isolated in 2010—2012 had lower penicillin MIC values than strains isolated in 2013—2014. Differences in MIC values between years correlated with the type of mutation conditioning the TEM-1/TEM-135 enzyme. The results of the obtained types of TEM beta lactamase enzymes are presented in Table 1. Due to the small sample size (n = 21), non-parametric Mann–Whitney U tests were used in the statistical analysis, with the p value lower than the critical significance level (p < 0,05). It was observed that the effect of the type of beta-lactamase produced by the tested strains was significant for penicillin sensitivity with a significance level of p = 0.000263. No correlation was observed between beta-lactamase type and sensitivity to ceftriaxone p = 0.192600.

Most of the known penicillinase plasmid types of N. gonorrhoeae were demonstrated: the Asian, the African, the Toronto/Rio plasmids and the Australian variant that has been detected in Europe for the first time and which so far has only been detected in Australia (Trembizki et al. 2014). The Asian, the African, and the Toronto/Rio plasmid types are common worldwide, including in Europe. In France, in PPNG strains isolated between 2010 and 2012, the most common carrier of the beta-lactamase gene is the African plasmid (157/176, 89.2%) in N. gonorrhoeae., the Asian-type (13/176, 7.4%) and the Toronto/Rio (6/176, 3.4%) (Micaëlo et al. 2017). Michelle J. Cole et al. identified in PPNG strains isolated in 2012 in England and Wales the same strains as in France but the Asian plasmid was predominant in the tested strains. The Toronto/Rio plasmid encoding the TEM-135 beta-lactamase was predominant in PPNG strains isolated between 2012 and 2014 in Poland, while no European country reported such predominance (Cole et al. 2015). The African plasmid is predominant worldwide as shown by a study conducted by Ibrahim Muhammad et al. on 139 strains isolated between 2000 and 2011 in 15 European countries (n = 40), African countries (n = 22), Northern and Southern countries (n = 10), Asian countries (n = 33) and Western Pacific countries (n = 31). The African penicillinase plasmid was present in 67.6% of isolates, the Toronto/Rio plasmid in 18.7% of isolates and the Asian plasmid in 13.7% of isolates. No other types of plasmids encoding TEM beta-lactamase were detected in this study (Muhammad et al. 2014). Global studies confirm the dominance of the African plasmid in Bangladesh where more than 90% of isolates from 1997 to 2006 had this plasmid (Ahmed et al. 2010). In studies on strains isolated between 2006 and 2010 in Brazil, only one plasmid type was detected in PPNG strains – the African plasmid (Uehara et al. 2011). In a study by Ricardo Gianecini et al. from Argentina, the prevalence of PPNG isolates was 16.6% in 2008 and increased to 23.2% in 2012. And the plasmid profile revealed two types of circulating plasmids, with the African plasmid dominating 69% among 143 PPNG strains (Gianecini et al. 2015a, b).

Conclusion

Differences in MIC values between and in type of penicillinase plasmids years correlated with the type of mutation conditioning the TEM-1/TEM-135 enzyme.

The detection of deletions or insertions in penicillinase plasmids using the multiplex PCR method developed by H. Palmer does not completely differentiate the types of penicillinase plasmids. The best method for obtaining a single result is the whole plasmid sequencing.

The Australian plasmid described in this paper was detected for the first time in Europe and for the second time in the world. Further evolution of gonococci may lead to the development of small plasmids encoding beta-lactamases with an extended substrate spectrum without causing a high energy burden on cells, but it may increase the MIC values for antibiotics.

Electronic supplementary material

Below is the link to the electronic supplementary material.

Acknowledgements

The author would like to thank Prof. Andrzej Młynarczyk, Department of Medical Microbiology, Medical University of Warsaw, Warsaw, Poland for mental support and Jan Gawor, Laboratory of DNA Sequencing and Oligonucleotide Synthesis, Institute of Biochemistry and Biophysics, Polish Academy of Sciences for assistance with sequencing NGS. The author wishes to thank a Polish clinical microbiologist for N. gonorrhoeae strains.

Funding

This work was supported by the research project of the Medical University of Warsaw, Poland (Grant Number: 1M20/PM1/17/17).

Availability of data and material

Most of the data is presented in the publication as well as in the appendix. Data on the susceptibility and sequence of beta-lactamase genes will be provided to the interested parties.

Code availability

Not applicable.

Declarations

Conflict of interest

The authors report no conflicts of interest.

Ethical approval

Clinical N. gonorrhoeae strains were collected as part of routine hospitals surveillance. Ethical approval and informed consent were not required.

Consent to participate

Not applicable.

Consent for publication

Not applicable.

Footnotes

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

  1. Ahmed MU, Chawdhury FAH, Hossain M, et al. Monitoring antimicrobial susceptibility of Neisseria gonorrhoeae isolated from Bangladesh during 1997–2006: emergence and pattern of drug-resistant isolates. J Heal Popul Nutr. 2010;28:443–449. doi: 10.3329/jhpn.v28i5.6152. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Alergant CD, Arya OP, Annels EH, et al. Penicillinase-producing Gonococci in Liverpool. Lancet. 1976;25:1379–1382. doi: 10.1016/s0140-6736(76)91919-x. [DOI] [PubMed] [Google Scholar]
  3. Arlet G, Goussard S, Courvalin P, Philippon A. Sequences of the genes for the TEM-20, TEM-21, TEM-22, and TEM-29 extended-spectrum β-lactamases. Antimicrob Agents Chemother. 1999;43:969–971. doi: 10.1128/AAC.43.4.969. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Berthold U. Preventive medicine and public health. J Am Med Assoc. 1995;273:1712–1714. doi: 10.1001/jama.1995.03520450082043. [DOI] [Google Scholar]
  5. Brett M. A novel gonococcal β-lactamase plasmid. J Antimicrob Chemother. 1989;23:653–654. doi: 10.1093/jac/23.4.653. [DOI] [PubMed] [Google Scholar]
  6. Cheah UE, Weigand WA, Stark BC. Effects of recombinant plasmid size on cellular processes in Escherichia coli. Plasmid. 1987;18:127–134. doi: 10.1016/0147-619X(87)90040-0. [DOI] [PubMed] [Google Scholar]
  7. Cole MJ, Spiteri G, Jacobsson S, et al. Is the tide turning again for cephalosporin resistance in Neisseria gonorrhoeae in Europe? Results from the 2013 European surveillance. BMC Infect Dis. 2015;15:1–8. doi: 10.1186/s12879-015-1013-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Diaz Ricci JC, Hernández ME. Plasmid effects on Escherichia coli metabolism. Crit Rev Biotechnol. 2000;20:79–108. doi: 10.1080/07388550008984167. [DOI] [PubMed] [Google Scholar]
  9. Dillon JR, Li H, Yeung K, Aman TA. A PCR assay for discriminating Neisseria gonorrhoeae beta-lactamase-producing plasmids. Mol Cell Probes. 1999;13:89–92. doi: 10.1006/mcpr.1998.0216. [DOI] [PubMed] [Google Scholar]
  10. Gianecini R, Oviedo C, Guantay C, et al. Prevalence of bla TEM-220 gene in Penicillinase-producing Neisseria gonorrhoeae strains carrying Toronto/Rio plasmid in Argentina, 2002–2011. BMC Infect Dis. 2015;15:571. doi: 10.1186/s12879-015-1294-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Gianecini R, Oviedo C, Littvik A, et al. Identification of TEM-135 beta-lactamase in Neisseria gonorrhoeae strains carrying African and Toronto plasmids in Argentina. Antimicrob Agents Chemother. 2015;59:717–720. doi: 10.1128/AAC.03838-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Gouby A, Bourg G, Ramuz M. Previously undescribed 6.6-kilobase R plasmid in penicillinase-producing Neisseria gonorrhoeae. Antimicrob Agents Chemother. 1986;29:1095–1097. doi: 10.1128/AAC.29.6.1095. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Huang W, Palzkill T. A natural polymorphism in beta-lactamase is a global suppressor. Proc Natl Acad Sci USA. 1997;94:8801–8806. doi: 10.1073/pnas.94.16.8801. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Kües U, Stahl U. Replication of plasmids in gram-negative bacteria. Microbiol Rev. 1989;53:491–516. doi: 10.1128/mr.53.4.491-516.1989. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Lewis DA (2010) The Gonococcus fights back: is this time a knock out? Sex Transm Infect 86:415LP – 421. 10.1136/sti.2010.042648 [DOI] [PubMed]
  16. Micaëlo M, Goubard A, La Ruche G, et al. Molecular epidemiology of penicillinase-producing Neisseria gonorrhoeae isolates in France. Clin Microbiol Infect. 2017;23:968–973. doi: 10.1016/j.cmi.2017.04.010. [DOI] [PubMed] [Google Scholar]
  17. Mlynarczyk-Bonikowska B, Serwin AB, Golparian D, et al. Antimicrobial susceptibility/resistance and genetic characteristics of Neisseria gonorrhoeae isolates from Poland, 2010–2012. BMC Infect Dis. 2014 doi: 10.1186/1471-2334-14-65. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Młynarczyk-Bonikowska B, Skulska E, Walter de Walthoffen S, et al (2015) The Neisseria gonorhoeae and Chlamydia trachomatis coinfection in patients of Department of Dermatology and Venereology Medical University of Warsaw. Med Dosw Mikrobiol 67 [PubMed]
  19. Muhammad I, Golparian D, Dillon J-AR, et al. Characterisation of bla TEM genes and types of β-lactamase plasmids in Neisseria gonorrhoeae—the prevalent and conserved bla TEM-135 has not recently evolved and existed in the Toronto plasmid from the origin. BMC Infect Dis. 2014;14:454. doi: 10.1186/1471-2334-14-454. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Müller EE, Fayemiwo SA, Lewis DA. Characterization of a novel β-lactamase-producing plasmid in Neisseria gonorrhoeae: sequence analysis and molecular typing of host gonococci. J Antimicrob Chemother. 2011;66:1514–1517. doi: 10.1093/jac/dkr162. [DOI] [PubMed] [Google Scholar]
  21. Nakayama SI, Tribuddharat C, Prombhul S, et al. Molecular analyses of TEM genes and their corresponding penicillinase-producing Neisseria gonorrhoeae isolates in Bangkok, Thailand. Antimicrob Agents Chemother. 2012;56:916–920. doi: 10.1128/AAC.05665-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Ohnishi M, Ono E, Shimuta K, et al. Identification of TEM-135 beta-lactamase in penicillinase-producing Neisseria gonorrhoeae strains in Japan. Antimicrob Agents Chemother. 2010;54:3021–3023. doi: 10.1128/AAC.00245-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Pagotto F, Aman A-T, Ng L-K, et al. Sequence analysis of the family of penicillinase-producing plasmids of Neisseria gonorrhoeae. Plasmid. 2000;43:24–34. doi: 10.1006/plas.1999.1431. [DOI] [PubMed] [Google Scholar]
  24. Palmer HM, Leeming JP, Turner A. A multiplex polymerase chain reaction to differentiate beta-lactamase plasmids of Neisseria gonorrhoeae. J Antimicrob Chemother. 2000;45:777–782. doi: 10.1093/jac/45.6.777. [DOI] [PubMed] [Google Scholar]
  25. Phillips I. Beta-lactamase-producing, penicillin-resistant gonococcus. Lancet. 1976;25:656–657. doi: 10.1016/S0140-6736(76)92466-1. [DOI] [PubMed] [Google Scholar]
  26. Skulska E, Walthoffen SW De, Malejczyk M (2015) Porównanie metody Real-Time PCR i hodowli bakteryjnej w laboratoryjnej diagnostyce rzeżączki u pacjentów Kliniki Dermatologii i Wenerologii Warszawskiego Uniwersytetu Medycznego The Comparison of Real-Time PCR and bacterial culture in laboratory diagnosti, 29–38 [PubMed]
  27. Speldooren V, Heym B, Labia R, Nicolas-Chanoine MH. Discriminatory detection of inhibitor-resistant β-lactamases in Escherichia coli by single-strand conformation polymorphism-PCR. Antimicrob Agents Chemother. 1998;42:879–884. doi: 10.1128/AAC.42.4.879. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. The WHO Western Pacific Gonococccal Antimicrobial Surveillance Program Surveillance of antibiotic resistance in Neisseria gonorrhoeae in the WHO Western Pacific Region. Commun Dis Intell. 2003;29:62–64. [Google Scholar]
  29. Trembizki E, Buckley C, Lawrence A, et al. Characterization of a novel Neisseria gonorrhoeae penicillinase-producing plasmid isolated in Australia in 2012. Antimicrob Agents Chemother. 2014;58:4984–4985. doi: 10.1128/AAC.02993-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Uehara AA, Amorin ELT, Ferreira MDF, et al. Molecular characterization of quinolone-resistant Neisseria gonorrhoeae isolates from Brazil. J Clin Microbiol. 2011;49:4208–4212. doi: 10.1128/JCM.01175-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Unemo M, Shafer WM. Antibiotic resistance in Neisseria gonorrhoeae: origin, evolution, and lessons learned for the future. Ann N Y Acad Sci. 2011;1230:1–15. doi: 10.1111/j.1749-6632.2011.06215.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Unemo M, Shafer WM. Antimicrobial resistance in Neisseria gonorrhoeae in the 21st Century: past, evolution, and future. Clin Microbiol Rev. 2014;27:587–613. doi: 10.1128/CMR.00010-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Unemo M, Bradshaw CS, Hocking JS, et al. Sexually transmitted infections: challenges ahead. Lancet Infect Dis. 2017 doi: 10.1016/S1473-3099(17)30310-9. [DOI] [PubMed] [Google Scholar]
  34. Walter de Walthoffen S (2021) Problems of infection with Neisseria gonorrhoeae. Med Ogólna i Nauk o Zdrowiu. 10.26444/monz/132804
  35. Wang R, Li H. The mysterious RAMP proteins and their roles in small RNA-based immunity. Protein Sci. 2012;21:463–470. doi: 10.1002/pro.2044. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Whiley D, Trembizki E, Buckley C, et al. Penicillinase-producing plasmid types in Neisseria gonorrhoeae clinical isolates from Australia. Antimicrob Agents Chemother. 2014;58:7576–7578. doi: 10.1128/AAC.04120-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Yeung KH, Dillon JR, Pauzé M, Wallace E. A novel 4.9-kilobase plasmid associated with an outbreak of penicillinase-producing Neisseria gonorrhoeae. J Infect Dis. 1986;153:1162–1165. doi: 10.1093/infdis/153.6.1162. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Data Availability Statement

Most of the data is presented in the publication as well as in the appendix. Data on the susceptibility and sequence of beta-lactamase genes will be provided to the interested parties.

Not applicable.


Articles from Archives of Microbiology are provided here courtesy of Springer

RESOURCES