Abstract
Cancer dormancy is a state characterized by the quiescence of disseminated cancer cells, and tumor recurrence occurs when such cells re-proliferate after a long incubation period. These cancer cells tend to be treatment resistant and one of the barriers to successful therapeutic intervention. We have previously reported that long-term treatment of cancer cells with linoleic acid (LA) induces a dormancy-like phenotype. However, the mechanism underpinning this effect has not yet been clarified. Here, we investigate the mechanism of LA-induced quiescence in cancer cells. We first confirmed that long-term treatment of the mouse colorectal cancer cell line CT26 with LA induced quiescence. When these cells were inoculated subcutaneously into a syngeneic mouse and fed with an LA diet, the inoculated cancer cells maintained the quiescent state and exhibited markers of dormancy. LA-treated CT26 cells showed reduced oxidative phosphorylation, glycolysis, and energy production as well as reduced expression of the regulatory factors Pgc1α and MycC. MicroRNA expression profiling revealed that LA induced an upregulation in miR-494. The expression of Pgc1α and MycC were both induced by an miR-494 mimic, and the LA-induced decrease in gene expression was abrogated by an miR-494 inhibitor. The expression of miR-494 was enhanced by the mitochondrial oxidative stress produced by LA. In a syngeneic mouse subcutaneous tumor model, growth suppression by an LA diet and growth delay by LA pretreatment + LA diet were found to have similar effects as administration of an miR-494 mimic. In contrast, the effects of LA were abrogated by an miR-494 inhibitor. Analysis of human colorectal cancer tissue revealed that miR-494 was present at low levels in non-metastatic cases and cases with simultaneous liver metastases but was expressed at high levels in cases with delayed liver metastases, which also exhibited reduced expression of PGC1α and MYCC. These results suggest that miR-494 is involved in cancer dormancy induced by high levels of LA intake and that this microRNA may be valuable in targeting dormant cancer cells.
Keywords: linoleic acid, quiescence, dormancy, energy metabolism, delayed metastasis
1. Introduction
The incidence of colorectal cancer (CRC), a leading cause of cancer-related deaths worldwide, has increased in recent years [1]. In the United States, nearly 150,000 cases of colorectal cancer and more than 50,000 deaths were reported in 2020 [1]. Many causes of colorectal cancer are related to lifestyle; Westernization of eating habits, obesity, and a lack of exercise are known risk factors for this cancer. Indeed, colon carcinogenesis is closely related to diet. Inflammation caused by fatty acid metabolism due to the fact of lipid overdose, alcohol abuse, and overconsumption of processed meat is known to increase the risk of tumor progression [2]. Furthermore, n-6 polyunsaturated fatty acids, such as linoleic acid (LA), are known to be involved in colorectal carcinogenesis due to the fact of free radicals generated by cyclooxygenase during prostaglandin E2 production [3,4].
In contrast, when LA is metabolized by 15-lipoxygenase-1, it activates peroxisome proliferator-activated receptor-γ, inhibits cancer cell proliferation and invasion, and induces apoptosis, thereby exerting a tumor suppressive effect [5,6]. Furthermore, long-term treatment with LA has been shown to induce quiescence and dormancy in cancer cells, although it can also result in a treatment-refractory phenotype [7]. Arachidonic acid and epoxyeicosatrienoic acid are also associated with the indication of cancer dormancy [8,9].
Cancer dormancy has been associated with late recurrence and metastasis in cancer patients, and incubation periods can range from years to decades [10]. In colorectal cancer, cases of recurrence have been reported several years after tumor resection at the primary site [11,12]. Dormancy involves quiescence of the tumor at the primary site or the metastatic lesion [13]. Cancer dormancy refers both to tumor mass dormancy (in which cell proliferation and cell death are balanced in the tumor) and to cell dormancy (in which cancer cells are in a quiescent state) [14]. Cellular dormancy can be induced by the extracellular matrix environment, a metastatic niche, a hypoxic microenvironment, and endoplasmic reticulum stress [13]. Tumor dormancy is one of the mechanisms of resistance to various cancer therapies, and the cells exhibit a stem cell-like phenotype that includes chemoresistance, high metastatic potential, and suppression of antitumor immunity [14,15,16,17]. At the same time, cell cycle progression is reduced in these cells, which is a defining feature of quiescent cancer stem cells [18]. However, the mechanism by which dormancy occurs in cancer cells is not entirely clear. Elucidating the mechanisms of cancer dormancy may help to improve treatment responsiveness by stimulating cancer cells to break dormancy after escape from treatment or the host immune system. Conversely, the development of tools to induce continued dormancy may also contribute to cancer control to avoid clinical recurrence.
microRNA (miRNA, miR)-494 is known to be overexpressed in tumors and is involved in angiogenesis by transferring to vascular endothelial cells via exosomes [19,20]. In contrast, in cancer cells, miR-494 has been reported to target MYC and PGC-1α [21,22,23,24,25]. MYC and PGC-1α are key regulatory proteins for glycolysis and oxidative phosphorylation, respectively, suggesting that miR-494 plays an important role in energy metabolism in cancer cells.
In our previous study, we demonstrated that in vitro treatment of cancer cells with LA induced quiescence [7]. In the present study, we used this system to investigate the mechanisms underpinning LA-induced quiescence.
2. Results
2.1. LA Induces Quiescence in CT26 Cells
We have shown in previous studies that long-term treatment with LA induces a quiescent state in cancer cells [7]. In the present study, in order to re-examine this result, we first examined the effect of LA on proliferation using CT26 colon cancer cells. Our results showed that cell proliferation was suppressed in a concentration-dependent manner with an IC50 of 35 μg/mL (Figure 1A). When CT26 cells were treated with the IC50 concentration of LA for an extended period (up to 25 days), cell proliferation was gradually suppressed, leading to the attainment of a quiescent state (Figure 1B). In the cell cycle analysis, long-term LA treatment increased the G0/G1 population and decreased the S and G2/M population without an increase in the under G0/G1 population. To examine the effect in vivo, CT26 cells pretreated with LA at the IC50 concentration (35 μg/mL) were subcutaneously inoculated into syngeneic BALB/c mice (Figure 1C). Tumor growth was suppressed in a concentration-dependent manner when the inoculated mice were fed a diet containing LA. Notably, mice fed with a 10% LA diet did not form palpable tumors. However, tumor cell aggregation was observed in the tissues at the subcutaneous inoculation sites in these mice (Figure 1D), although we did not detect immune cell infiltration or tumor vascularity in the tumor cell aggregations (Figure 1E). The results from MIB1 immunostaining indicated that cancer cell proliferation was significantly suppressed in the 10% LA diet group: 64 ± 5/high-power fields of view (HPF) in control mice vs. 4 ± 0.3/HPF in 10% LA-treated mice (p < 0.001). We also detected intratumoral prostaglandin E2 concentration (Figure 1F). In the CT26 cells in mice fed with a 10% LA diet, the PGE2 concentration was not different from that in the standard diet-fed mice. These results suggest that LA inhibits proliferation in cancer cells.
2.2. LA Treatment Altered Intracellular Energy Metabolism
We next examined the intracellular energy metabolism of CT26 cells treated with LA (35 μg/mL) (Figure 2A,B). LA treatment resulted in a decrease in both oxidative phosphorylation (oxygen consumption rate, OCR) and glycolysis (extracellular acidification rate, ECAR), and basal OCR, ATP production, and maximum OCR all decreased in comparison with the control (Figure 2C–E). Furthermore, matrix analysis of OCR and ECR suggested that LA treatment induced a quiescent cell state (Figure 2F).
Given these LA-induced alterations in the intracellular energy metabolism, we examined the expression of MycC, a gene that promotes glycolysis [26], and peroxisome proliferator-activated receptor γ coactivator 1α (Pgc1α), a gene that promotes oxidative phosphorylation [27]. Our analyses showed that LA treatment repressed the expression of both MycC and Pgc1α (Figure 2G). We also examined miRNA expression in LA-treated CT26 cells using microarray analysis (Table 1), which revealed that the expression of miR-494 increased by approximately two-fold in response to LA treatment (Figure 2H). As the miRNA database suggested that miR-494 targets MycC and Pgc1α, we investigated the effects of an miR-494 inhibitor and mimic on MycC and Pgc1α gene expression (Figure 2I). Treatment with miR-494 mimics suppressed the gene expression of MycC and Pgc1α in the same manner as LA treatment. In contrast, treatment with the LA and miR-494 inhibitor maintained the expression of both genes at the same level as that of the control, suggesting that repression of MycC and Pgc1α might be caused by LA-induced miR-494.
Table 1.
miRNA Name | Ratio (Control vs. Linoleic Acid Treatment) |
---|---|
Upregulated | |
MIR-7 | 5.573878 |
MIR-138-2 | 2.696476 |
MIR-21 | 2.252155 |
MCMV-MIR-M23-1-5P | 2.04248 |
MIR-1902 | 2.002737 |
MIR-494 | 1.96935 |
MIR-188-3P | 1.793792 |
MIR-1949 | 1.667342 |
MIR-493 | 1.656996 |
MIR-720 | 1.607656 |
Downregulated | |
MIR-210 | 0.574341 |
2.3. LA Induces Oxidative Stress
The expression of many miRNAs is regulated by oxidative stresses [28], and we therefore next examined the effect of LA on mitochondrion-derived oxidative stress (Figure 3). We observed that the levels of mitochondrial superoxides and hydroxy radicals were increased by LA treatment (Figure 3A,B) and that the reduction of reactive oxygen species (ROS) by N-acetyl-l-cysteine (NAC) abrogated the LA-induced upregulation of miR-494 expression (Figure 3C). These data suggested that LA-induced ROS might upregulate miR-494. We examined the effect of other unsaturated long-chain fatty acids on miR-494 expression (Figure 3D). Differently from LA, oleic acid (OA), α-linolenic acid (αLA), and eicosapentaenoic acid (EPA) did not affect miR-494 expression. We also examined the miR-494 induction by LA in other CRC cell lines (Figure 3E). In all four CRC cell lines (i.e., CT26, CMT93, Colo320, and HT29), LA treatment increased miR-494 expression.
2.4. miR-494 Induced Quiescence in CT26 Cells in Syngeneic BALB/c Mice
Using a syngeneic mouse subcutaneous model, we examined the effect of the miR-494 mimics or the inhibitor on CT26 cancer cells. Tumor growth of CT26 cells was inhibited by a 10% LA diet, while administration of the miR-494 mimic inhibited tumor growth in a similar manner, including the repression of MycC and Pgc1α (Figure 4A,E). CT26 cells pretreated with LA (100 µg/mL for one week) demonstrated delayed growth in comparison with vehicle-pretreated cells. Treatment with LA or the miR-494 mimic both prolonged the periods of growth suppression in a similar manner (Figure 4B). The repression of MycC and Pgc1α was also more pronounced in these cells compared to cells lacking pretreatment. In contrast, the miR-494 inhibitor abrogated both LA-induced growth inhibition in cells without pretreatment (Figure 4C) and LA-induced growth delay in LA-pretreated cells (Figure D). It also increased the expression of MycC and Pgc1α (Figure 4E). These results indicate that an LA diet or miR-494 mimic inhibited tumor growth by suppressing the expression of MycC and Pgc1α. In contrast, miR-494 inhibitor recovered tumor growth by canceling the LA-induced suppression of MycC and Pgc1α expression.
2.5. miR-494 Expression Is Associated with Delayed Liver Metastasis in CRC Patients
Finally, we analyzed human CRC cases to investigate the clinical significance of miR-494 revealed in vitro and in vivo. We examined the expression of miR-494, MYCC, and PGC1α in primary tumors from 11 cases of CRCs (pT3/pN1) (Figure 5). In the four cases without liver metastasis and the three cases with synchronous liver metastasis, we observed low levels of miR-494 expression and high levels of MYCC and PGC1α expression. In contrast, all four cases with delayed liver metastasis showed miR-494 expression at high levels and low levels of MYCC and PGC1α expression (Figure 5A). In these cases, miR-494 levels demonstrated an inverse correlation with MYCC and PGC1α levels. The mean expression levels of miR-494 in the “delayed metastasis” cases were elevated to 196% of the “no metastasis” or “synchronous metastasis” cases (Figure 5B). In contrast, the levels of MYCC and PGC1α in the “delayed metastasis” cases were reduced to 47% and 41%, respectively, of the “no metastasis” or “synchronous metastasis” cases (Figure 5C). The observation of the increased expression of miR-494 and decreased expression of MYCC and PGC1α in cancer cells in the delayed metastasis cases suggests that the dormancy state may have been similar to that induced by LA or the miR-494 mimic in the mouse model.
These results showed that miR-494 expression was induced by LA, induced quiescence in CRC cells in vitro, induced dormancy in vivo, and correlated with delayed liver metastasis in clinical specimens.
3. Discussion
In this study, we showed that LA induced miR-494 expression via ROS and suppressed the expression of its target genes, MYCC and PGC1α, resulting in decreased energy production and quiescence. These in vitro results were compatible with our findings that cell quiescence is involved in tumor dormancy in animal models and delayed liver metastasis in human CRC.
In the present study, continuous treatment with LA induced dormancy in the mouse colon cancer cell line CT26, resulting in diminished proliferation, angiogenesis, and immune cell infiltration. Similar results have been reported in human colon and gastric cancer cell lines [7]. Dormancy is a quiescent state of the tumor at the primary site or in metastatic disseminated lesions [13]. The induction of quiescence has also been implicated in the increased stem cell phenotype, which is a feature of cancer cell dormancy [13,16]. In a clinical context, studies have reported that cancer dormancy is associated with the development of late recurrence and metastasis with latency periods of years to decades in cancer patients [10] as well as the acquisition of resistance to cancer treatment and escape from antitumor immunity [16], making it a distinct barrier to successful cancer treatment.
Our data revealed that LA-induced quiescence in CT26 cells is suppressing both oxidative phosphorylation and glycolytic energy metabolism. Furthermore, we observed a decrease in the expression of Pgc1α and MycC, which promote energy metabolism. These results suggest that LA suppresses energy metabolism in cancer cells and induces a quiescent metabolic state. These data are in line with previous reports that proteolysis of CMYC and decreased expression of CMYC [29,30] as well as the inhibition of SRC3-related PGC1α [31] are involved in the induction of quiescence. Myc regulates gene expression directly, as in glycolytic genes including lactate dehydrogenase A, or indirectly such as by repressing microRNA miR-23a/b to increase glutaminolysis via glutaminase expression [26]. PGC1α is a co-transcriptional regulation factor that induces mitochondrial biogenesis by activating different transcription factors, including nuclear respiratory factor 1 and nuclear respiratory factor 2, which activate mitochondrial transcription factor A [32]. As a result of enhanced mitochondrial biogenesis, oxidative phosphorylation is enhanced.
We also found that both LA-induced miR-494 expression and the administration of an miR-494 mimic led to the repression of MycC and Pgc1α. miR-494 is a key modulator of the G2-M phase of the cell cycle and suppresses cell growth [24,33]. The MYCC and PGC1α genes have been previously reported to be target genes of miR-494 [21,24,25], suggesting that LA suppresses the expression of both MYCC and PGC1α via the induction of miR-494. In particular, miR-494 is thought to have a strong effect on energy metabolism, because it simultaneously suppresses the expression of these key regulators of energy metabolism.
In this study, we found that miR-494 expression was induced by LA. The ability of fatty acids to regulate miRNA expression has been previously reported for oleic acid, which has been shown to promote the expression and processing of miR-7 and miR-16 [34]. In contrast, our data showed that LA-induced ROS upregulated miR-494 levels. Oxidative stress affects the expression levels of several miRNAs and, conversely, miRNAs regulate many genes involved in the oxidative stress response [35]. The increased expression of miR-494 by oxidative stress may be a negative feedback response to the generation of mitochondria-derived oxidative stress.
In this study, we examined 11 cases of human CRC cases, all at the same invasive depth and with lymph node metastasis. Importantly, we observed a marked increase in miR-494 and a decreased expression of MYCC and PGC1α in patients with liver metastases that occurred more than 2 years after resection of the primary lesion. In such cases, the cancer cells may have been latent in the dormancy state, and while we were unable to determine the patients’ intake of LA, the association between miR-494, MYCC, and PGC1α was confirmed. The involvement of miR-494 in the induction of dormancy is worthy of further analysis using a larger number of cases, especially in the context of breast cancer, in which dormancy is frequently experienced [36]. For examination of serum LA concentration, a prospective examination of colorectal cancer patients is needed in the future.
In this study, we suggest that LA induces quiescence by promoting miR-494 expression, resulting in dormancy of cancer cells. LA is thought to promote carcinogenesis of CRC, and our findings provide a new link between LA and this cancer. Our present findings suggest that miRNA expression may be affected by fatty acid intake in cancer patients, which may be a cause for concern. Breaking the dormancy of cancer is expected to become a new therapeutic target for cancer treatment in the future.
4. Materials and Methods
4.1. Cells
The mouse colon cancer CT26 cell line was provided by Isaiah J. Fidler (MD Anderson Cancer Center, Texas University, Houston, TX, USA). The CMT93 mouse colon cancer cell line was purchased from DS Pharma Inc., (Osaka, Japan). Colo320 and the HT29 human colon cancer cell lines were purchased from Dainihon Pharmaceutical Co. (Tokyo, Japan). The cells were cultured in Dulbecco’s modified Eagle’s medium (Wako Pure Chemical, Osaka, Japan) supplemented with 10% fetal bovine serum (Sigma Chemical Co., St. Louis, MO, USA) at 37 °C in a 5% CO2 atmosphere. LA, OA, αLA, and EPA (Wako) were dissolved in 100% ethanol (20 µg/mL), and the same quantity of 100% ethanol was used for control treatments.
4.2. Cell Growth
Cells (1 × 105) cultured in six 3.5 cm diameter dishes were treated with LA (35 µg/mL). Cell viability was analyzed using the CellTiter AQueous One Solution Cell Proliferation Assay kit (Promega Corporation, Madison, WI, USA). Following treatment with LA, MTS (3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium) solution was added to each well for 1 h at 37 °C in 5% CO2. Thereafter, absorbance at 490 nm was recorded using a microplate reader. Cells (1 × 105) were also cultured with weekly re-seeding to examine the effects of long-term treatment with LA. The number of cells was counted using an autocytometer (Sysmecs, Kobe, Japan), and the experiment was repeated three times.
4.3. Cell Cycle Analysis
For analysis of the cell cycle distribution, the DNA content of individual cells was measured by flow cytometry. Core DNA content was measured using a linear amplification in the FL-2 channel of a FACScan flow cytometer (BD Biosciences, Franklin Lakes, NJ, USA).
4.4. Animal Model
Four-week-old male BALB/c mice were purchased from SLC Japan, Inc. (Shizuoka, Japan). The animals were maintained in a pathogen-free animal facility at 23 °C and 50% humidity, under a 12 h light/dark cycle. The animal study was conducted in accordance with the institutional guidelines approved by the Committee for Animal Experimentation of Nara Medical University, Kashihara, Japan, following current regulations and the standards of the Japanese Ministry of Health, Labor, and Welfare (approval no. 11528). The mice were used for approved experiments according to the institutional guidelines when they were 5 weeks old. To assess the effect of LA on the tumorigenicity of CT26 cells, the cells were pretreated with LA (100 µg/mL) for 5 weeks, with medium exchange and addition of LA every 7 days. Thereafter, 1 × 107 cells were injected subcutaneously into the back of each mouse in each group. Tumor growth at the inoculation site was examined every 3 days after inoculation. After inoculation, the mice were fed either a control diet (CE-2, CLEA Japan, Inc., Tokyo, Japan) or an LA diet (a CE-2 diet containing 2%, 5%, or 10% w/w of LA).
4.5. Immunohistochemistry
Sections (4 µm thick) were immunostained with antibodies against the Ki-67 clone MIB1, lymphocyte common antigen (LCA), CD34 (DAKO Corp., Carpinteria, CA, USA), or single-stranded DNA (ssDNA, Enzo Life Science, Plymouth Meeting, PA, USA). Immunohistochemical staining was performed using the immunoperoxidase technique following antigen retrieval by microwave treatment (500 W, 5 min, 3 times) in citrate buffer (DAKO). After blocking with 3% H2O2–methanol for 10 min, the specimens were incubated with a primary antibody (0.5 μg/mL) for 2 h at room temperature. The specimens were briefly washed with PBS and incubated with a secondary antibody conjugated with peroxidase (0.5 μg/mL, Medical & Biological Laboratories Co., Ltd., Nagoya, Japan) for 1 h at room temperature. The specimens were then washed with PBS and treated with a stable diaminobenzidine solution (DAKO) for color development, followed by counterstaining with Mayer’s hematoxylin solution (Sigma). The number of cells with positive staining for Ki-67 (proliferation marker), CD34 (vessel), and LCA (immune cells) were counted, and the mean value was calculated from the microscopic observation of 30 high-power fields of view.
4.6. Enzyme-Linked Immunosorbent Assay (ELISA)
ELISA kits were used for measuring protein levels of PGE2 (Cayman Chemical Co., Ann Arbor, MI, USA). The assay was performed according to the manufacturer’s instructions, and whole cell lysates were used for the measurements.
4.7. Reverse Transcription-Polymerase Chain Reaction (RT-PCR)
To assess murine mRNA expression, RT-PCR was performed with 2 µg of total RNA extracted using TRI Reagent (Molecular Research Center, Inc., Cincinnati, OH, USA) according to the manufacturer’s protocol. cDNA was synthesized using a High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Carlsbad, CA, USA). The primer sets are listed in Table 2 and were synthesized by Sigma Genosys (Ishikari, Japan). PCR products were electrophoresed on a 2% agarose gel and stained with ethidium bromide. GAPDH mRNA was also amplified for use as an internal control.
Table 2.
Gene Symbol | Reference | Forward Primer (5′–3′) | Reverse Primer (5′–3′) |
---|---|---|---|
Mouse miR-494 | Qi et al. [37] | TGGTGATGGGATTTGAAACATACACGGGAAAC | AGATAGACGGTGTCGCTGTTGAAGTCAG |
Mouse S6 | Qi et al. [37] | CTCGCTTCGGCAGCACA | AACGCTTCACGAATTTGCGT |
Mouse Actb | NM_007393.5 * | ATGTGCCACTCTGACTGGAA | TCCATCGGTCATGCTCTCTC |
Mouse Pgc1α | BC066868.1 * | ATGTGTCGCCTTCTTGCTCT | ATCTACTGCCTGGGGACCTT |
Mouse MycC | AH005318.2 * | GCCCAGTGAGGATATCTGGA | ATCGCAGATGAAGCTCTGGT |
Human ACTB | NM_001101.3 * | GGACTTCGAGCAAGAGATGG | AGCACTGTGTTGGCGTACAG |
Human PGC1α | BC156323.1 * | GTGAAGACCAGCCTCTTTGC | AATCCGTCTTCATCCACAGG |
Human MYCC | NM_002467.4 * | TTCGGGTAGTGGAAAACCAG | CAGCAGCTCGAATTTCTTCC |
* Gene bank ID.
4.8. Detection of miRNAs
A mirVana™ miRNA isolation kit was used to extract miRNAs according to the manufacturer’s protocol (Thermo Fisher Scientific, Waltham, MA, USA). For the quantification of miRNA expression levels, RT-PCR reactions were performed using the TaqMan miRNA reverse transcription kit (Applied Biosystems) and Pri-miRNA Assay kit (Hs04225959_pri, Applied Biosystems) according to the manufacturer’s protocols.
4.9. Seahorse Assay (Mitochondrial Respiration)
To assess the metabolic activity in the CT26 cells, the OCR was measured using a Seahorse XFp Extracellular Flux Analyzer with Seahorse XFp FluxPaks (Agilent Technologies Inc., Santa Clara, CA, USA). The CT26 cells were cultured in regular medium for 72 h before plating the cells for the Seahorse assay in the recommended medium. For these experiments, we measured the OCR of 1 × 104 viable CT26 cells per well.
Seahorse assays were carried out as follows: OCR (pmol/min) was measured before (basal OCR) and after successive injections of 3 µmol/L oligomycin (ATP synthase inhibitor), 2 µmol/L FCCP (carbonyl cyanide-p-trifluoromethoxy phenylhydrazone, an uncoupling protonophore), 0.5 µmol/L rotenone (Complex I inhibitor), and 0.5 µmol/L antimycin A (Complex III inhibitor). From the resulting data, we determined the OCR associated with respiratory ATP synthesis (oligomycin sensitive), the maximum OCR in FCCP-uncoupled mitochondria, the rotenone-sensitive OCR attributable to uncoupled Complex I activity, the antimycin-sensitive Complex II/III activity, and the OCR by mitochondrial functions other than ATP synthesis including the OCRs for mitochondrial membrane potential-driven (proton leak), non-respiratory oxygen consumption, and the respiratory “spare capacity” (excess capacity of the respiratory electron transport chain that is not being used in basal respiration).
4.10. Seahorse Assay (Glycolytic Respiration)
The ECAR of CT26 cells was measured using a modified glycolytic stress test in a Seahorse XFe24 Extracellular Flux Analyzer with Seahorse XFp FluxPaks (Agilent). CT26 cells were cultured in a growth medium in 6-well plates prior to the Seahorse experiments. CT26 cells (1 × 104 cells/well) were plated in XF base medium (Agilent) containing 200 mmol/L L-glutamine and 5 mmol/L HEPES as recommended by the manufacturer of the glycolytic assays. The sensor cartridge apparatus was rehydrated 1 d in advance by adding 1 mL XF Calibrant to each well and incubating at 37 °C until needed. The injection ports of the sensor cartridge apparatus were loaded with the following drugs in chronological order of four injections to meet the indicated final concentrations in the wells: 10 mmol/L glucose, 1 µmol/L oligomycin, 1 µmol/L rotenone plus 5 µmol/L antimycin A (combined injection), and 50 mmol/L 2-deoxyglucose. Treatment with the rotenone/antimycin combination allowed for the assessment of the impact of electron transport on ECAR by respiratory acidification coupled with the passage of some glycolytic pyruvate through the tricarboxylic acid cycle to oxidative phosphorylation.
4.11. Mitochondrial ROS
Mitochondrial ROS was measured using a superoxide-sensitive dye (MitoROS 580, AAT Bioquest Inc., Sunnyvale, CA, USA), which selectively targets mitochondria. Briefly, washed CT26 cells (5 × 104) were loaded with 1× MitoROS 580 dye in the dark for 30 min at 37 °C and then analyzed using a fluorescence microscope (BZ-X710, Keyence, Osaka, Japan). The assay was performed according to the manufacturer’s instructions.
4.12. miRNA Profiling
CT26 cells were treated with LA (50 μg/mL) for 48 h. Total RNA was extracted using TRI Reagent (Molecular Research Center) according to the manufacturer’s instructions. For miRNA profiling, RNA was sent to the miRXplore microarray service provided by Miltenyi Biotech (Bergisch Gladbach, Germany).
4.13. Patients
We obtained frozen tissue samples from 11 patients with CRC with serosal invasion (pT3) and 1–3 regional lymph node metastases (pN1), which were diagnosed at the Department of Molecular Pathology, Nara Medical University, from 2012–2019. Four cases had no distant metastases, three cases showed synchronous liver metastasis, and four cases showed recurrence by liver metastasis more than 2 years after resection of the primary tumors (delayed liver metastasis). As written informed consent was not obtained from the patients for their participation in the present study, all identifying information was removed from patient samples prior to their analysis to ensure strict privacy protection (unlinkable anonymization). All procedures were performed in accordance with the Ethical Guidelines for Human Genome/Gene Research enacted by the Japanese Government and with the approval of the Ethics Committee of Nara Medical University (approval number: 937, 20 October 2014).
4.14. Statistical Analysis
Statistical significance was calculated using a two-tailed Fisher’s exact test and ordinary ANOVA using the InStat software (GraphPad, Los Angeles, CA, USA). A two-sided p-value of <0.05 was considered to indicate statistical significance.
Acknowledgments
The authors thank Tomomi Masutani for expert assistance with the preparation of this manuscript.
Abbreviations
LA | linoleic acid |
CRC | colorectal cancer |
PGC-1α | proliferator-activated receptor γ coactivator 1α |
OCR | oxygen consumption rate |
ECAR | extracellular acidification rate |
ROS | reactive oxygen species |
PGE2 | prostaglandin E2 |
NAC | N-acetyl-L-cysteine |
Author Contributions
Study concept and design: H.K. Acquisition of data: R.O., S.M., N.I. and K.G. Analysis and interpretation of data: R.O., S.M., S.K., R.S., H.O., T.S., Y.N., C.N. and I.K. Drafting and editing of the manuscript: H.K. Critical revision of the manuscript: R.F.-T. All authors have read and agreed to the published version of the manuscript.
Funding
This work was supported by MEXT KAKENHI, grant numbers: 19K16564 (R.F.-T.), 20K21659 (H.K.), 20K11260 (H.O.), 20K17661 (Y.N.), and 21K20808 (S.M.).
Institutional Review Board Statement
All experimental procedures were performed in accordance with the Ethical Guidelines for Human Genome/Gene Research enacted by the Japanese Government and with the approval of the Ethics Committee of Nara Medical University (approval number: 937, 20 October 2014). The animal study was conducted in accordance with the institutional guidelines approved by the Committee for Animal Experimentation of Nara Medical University, Kashihara, Japan, following current regulations and the standards of the Japanese Ministry of Health, Labor, and Welfare (approval no. 11528).
Informed Consent Statement
As written informed consent was not obtained from the patients for their participation in the present study, all identifying information was removed from patient samples prior to their analysis to ensure strict privacy protection (unlinkable anonymization).
Data Availability Statement
Not applicable.
Conflicts of Interest
The authors declare no conflict of interest.
Footnotes
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.
References
- 1.Siegel R.L., Miller K.D., Goding Sauer A., Fedewa S.A., Butterly L.F., Anderson J.C., Cercek A., Smith R.A., Jemal A. Colorectal cancer statistics, 2020. CA Cancer J. Clin. 2020;70:145–164. doi: 10.3322/caac.21601. [DOI] [PubMed] [Google Scholar]
- 2.O’Keefe S.J. Diet, microorganisms and their metabolites, and colon cancer. Nat. Rev. Gastroenterol. Hepatol. 2016;13:691–706. doi: 10.1038/nrgastro.2016.165. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Karpisheh V., Nikkhoo A., Hojjat-Farsangi M., Namdar A., Azizi G., Ghalamfarsa G., Sabz G., Yousefi M., Yousefi B., Jadidi-Niaragh F. Prostaglandin E2 as a potent therapeutic target for treatment of colon cancer. Prostaglandins Other Lipid Mediat. 2019;144:106338. doi: 10.1016/j.prostaglandins.2019.106338. [DOI] [PubMed] [Google Scholar]
- 4.Ullman T.A., Itzkowitz S.H. Intestinal inflammation and cancer. Gastroenterology. 2011;140:1807–1816. doi: 10.1053/j.gastro.2011.01.057. [DOI] [PubMed] [Google Scholar]
- 5.Sasaki T., Fujii K., Yoshida K., Shimura H., Sasahira T., Ohmori H., Kuniyasu H. Peritoneal metastasis inhibition by linoleic acid with activation of PPARγ in human gastrointestinal cancer cells. Virchows Arch. 2006;448:422–427. doi: 10.1007/s00428-005-0110-4. [DOI] [PubMed] [Google Scholar]
- 6.Yuri M., Sasahira T., Nakai K., Ishimaru S., Ohmori H., Kuniyasu H. Reversal of expression of 15-lipoxygenase-1 to cyclooxygenase-2 is associated with development of colonic cancer. Histopathology. 2007;51:520–527. doi: 10.1111/j.1365-2559.2007.02799.x. [DOI] [PubMed] [Google Scholar]
- 7.Ohmori H., Sasahira T., Fujii K., Yi L., Shimomoto T., Kuniyasu H. Linoleic-acid-induced growth suppression induces quiescent cancer cell nests in nude mice. Pathobiology. 2008;75:226–232. doi: 10.1159/000132383. [DOI] [PubMed] [Google Scholar]
- 8.Tang Y., Wang M.T., Chen Y., Yang D., Che M., Honn K.V., Akers G.D., Johnson S.R., Nie D. Downregulation of vascular endothelial growth factor and induction of tumor dormancy by 15-lipoxygenase-2 in prostate cancer. Int. J. Cancer. 2009;124:1545–1551. doi: 10.1002/ijc.24118. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Panigrahy D., Edin M.L., Lee C.R., Huang S., Bielenberg D.R., Butterfield C.E., Barnés C.M., Mammoto A., Mammoto T., Luria A., et al. Epoxyeicosanoids stimulate multiorgan metastasis and tumor dormancy escape in mice. J. Clin. Investig. 2012;122:178–191. doi: 10.1172/JCI58128. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Páez D., Labonte M.J., Bohanes P., Zhang W., Benhanim L., Ning Y., Wakatsuki T., Loupakis F., Lenz H.J. Cancer dormancy: A model of early dissemination and late cancer recurrence. Clin. Cancer Res. 2012;18:645–653. doi: 10.1158/1078-0432.CCR-11-2186. [DOI] [PubMed] [Google Scholar]
- 11.Nagao H., Ijiri K., Hirotsu M., Ishidou Y., Yamamoto T., Nagano S., Takizawa T., Nakashima K., Komiya S., Setoguchi T. Role of GLI2 in the growth of human osteosarcoma. J. Pathol. 2011;224:169–179. doi: 10.1002/path.2880. [DOI] [PubMed] [Google Scholar]
- 12.Janssens J.F., T’Syen M., Verhaegen S., Spaepen K., Verbeeck G. Ultra-late recurrences of gastro-intestinal carcinoma after primary resection: The mechanism of dormancy. Acta Gastro-Enterol. Belg. 2013;76:251–254. [PubMed] [Google Scholar]
- 13.Davis J.E., Jr., Kirk J., Ji Y., Tang D.G. Tumor Dormancy and Slow-Cycling Cancer Cells. Adv. Exp. Med. Biol. 2019;1164:199–206. doi: 10.1007/978-3-030-22254-3_15. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Endo H., Inoue M. Dormancy in cancer. Cancer Sci. 2019;110:474–480. doi: 10.1111/cas.13917. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Felsher D.W. Tumor dormancy: Death and resurrection of cancer as seen through transgenic mouse models. Cell Cycle. 2006;5:1808–1811. doi: 10.4161/cc.5.16.3111. [DOI] [PubMed] [Google Scholar]
- 16.Recasens A., Munoz L. Targeting Cancer Cell Dormancy. Trends Pharmacol. Sci. 2019;40:128–141. doi: 10.1016/j.tips.2018.12.004. [DOI] [PubMed] [Google Scholar]
- 17.De Angelis M.L., Francescangeli F., La Torre F., Zeuner A. Stem Cell Plasticity and Dormancy in the Development of Cancer Therapy Resistance. Front. Oncol. 2019;9:626. doi: 10.3389/fonc.2019.00626. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Francescangeli F., Contavalli P., De Angelis M.L., Careccia S., Signore M., Haas T.L., Salaris F., Baiocchi M., Boe A., Giuliani A., et al. A pre-existing population of ZEB2(+) quiescent cells with stemness and mesenchymal features dictate chemoresistance in colorectal cancer. J. Exp. Clin. Cancer Res. 2020;39:2. doi: 10.1186/s13046-019-1505-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Orso F., Quirico L., Dettori D., Coppo R., Virga F., Ferreira L.C., Paoletti C., Baruffaldi D., Penna E., Taverna D. Role of miRNAs in tumor and endothelial cell interactions during tumor progression. Semin. Cancer Biol. 2020;60:214–224. doi: 10.1016/j.semcancer.2019.07.024. [DOI] [PubMed] [Google Scholar]
- 20.Lande K., Gupta J., Ranjan R., Kiran M., Torres Solis L.F., Solís Herrera A., Aliev G., Karnati R. Exosomes: Insights from Retinoblastoma and Other Eye Cancers. Int. J. Mol. Sci. 2020;21:7055. doi: 10.3390/ijms21197055. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Shams R., Asadzadeh Aghdaei H., Behmanesh A., Sadeghi A., Zali M., Salari S., Padrón J.M. MicroRNAs Targeting MYC Expression: Trace of Hope for Pancreatic Cancer Therapy. A Systematic Review. Cancer Manag. Res. 2020;12:2393–2404. doi: 10.2147/CMAR.S245872. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Yuan J., Wang K., Xi M. MiR-494 Inhibits Epithelial Ovarian Cancer Growth by Targeting c-Myc. Med. Sci. Monit. 2016;22:617–624. doi: 10.12659/MSM.897288. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.He W., Li Y., Chen X., Lu L., Tang B., Wang Z., Pan Y., Cai S., He Y., Ke Z. MiR-494 acts as an anti-oncogene in gastric carcinoma by targeting c-myc. J. Gastroenterol. Hepatol. 2014;29:1427–1434. doi: 10.1111/jgh.12558. [DOI] [PubMed] [Google Scholar]
- 24.Liu Y., Li X., Zhu S., Zhang J.G., Yang M., Qin Q., Deng S.C., Wang B., Tian K., Liu L., et al. Ectopic expression of miR-494 inhibited the proliferation, invasion and chemoresistance of pancreatic cancer by regulating SIRT1 and c-Myc. Gene Ther. 2015;22:729–738. doi: 10.1038/gt.2015.39. [DOI] [PubMed] [Google Scholar]
- 25.Lemecha M., Morino K., Imamura T., Iwasaki H., Ohashi N., Ida S., Sato D., Sekine O., Ugi S., Maegawa H. mir-494-3p regulates mitochondrial biogenesis and thermogenesis through PGC1-α signalling in beige adipocytes. Sci. Rep. 2018;8:15096. doi: 10.1038/s41598-018-33438-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Dang C.V., Le A., Gao P. MYC-induced cancer cell energy metabolism and therapeutic opportunities. Clin. Cancer Res. 2009;15:6479–6483. doi: 10.1158/1078-0432.CCR-09-0889. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Lu J. The Warburg metabolism fuels tumor metastasis. Cancer Metastasis Rev. 2019;38:157–164. doi: 10.1007/s10555-019-09794-5. [DOI] [PubMed] [Google Scholar]
- 28.Kura B., Szeiffova Bacova B., Kalocayova B., Sykora M., Slezak J. Oxidative Stress-Responsive MicroRNAs in Heart Injury. Int. J. Mol. Sci. 2020;21:358. doi: 10.3390/ijms21010358. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Doisneau-Sixou S.F., Sergio C.M., Carroll J.S., Hui R., Musgrove E.A., Sutherland R.L. Estrogen and antiestrogen regulation of cell cycle progression in breast cancer cells. Endocr. Relat. Cancer. 2003;10:179–186. doi: 10.1677/erc.0.0100179. [DOI] [PubMed] [Google Scholar]
- 30.Studzinski G.P. Oncogenes, growth, and the cell cycle: An overview. Cell Tissue Kinet. 1989;22:405–424. doi: 10.1111/j.1365-2184.1989.tb00226.x. [DOI] [PubMed] [Google Scholar]
- 31.Hu M., Zeng H., Chen S., Xu Y., Wang S., Tang Y., Wang X., Du C., Shen M., Chen F., et al. SRC-3 is involved in maintaining hematopoietic stem cell quiescence by regulation of mitochondrial metabolism in mice. Blood. 2018;132:911–923. doi: 10.1182/blood-2018-02-831669. [DOI] [PubMed] [Google Scholar]
- 32.Jornayvaz F.R., Shulman G.I. Regulation of mitochondrial biogenesis. Essays Biochem. 2010;47:69–84. doi: 10.1042/bse0470069. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Ohdaira H., Sekiguchi M., Miyata K., Yoshida K. MicroRNA-494 suppresses cell proliferation and induces senescence in A549 lung cancer cells. Cell Prolif. 2012;45:32–38. doi: 10.1111/j.1365-2184.2011.00798.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Kumar S., Downie Ruiz Velasco A., Michlewski G. Oleic Acid Induces MiR-7 Processing through Remodeling of Pri-MiR-7/Protein Complex. J. Mol. Biol. 2017;429:1638–1649. doi: 10.1016/j.jmb.2017.05.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Konovalova J., Gerasymchuk D., Parkkinen I., Chmielarz P., Domanskyi A. Interplay between MicroRNAs and Oxidative Stress in Neurodegenerative Diseases. Int. J. Mol. Sci. 2019;20:6055. doi: 10.3390/ijms20236055. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.De Angelis M.L., Francescangeli F., Zeuner A. Breast Cancer Stem Cells as Drivers of Tumor Chemoresistance, Dormancy and Relapse: New Challenges and Therapeutic Opportunities. Cancers. 2019;11:1569. doi: 10.3390/cancers11101569. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Qi Y., Qian R., Jia L., Fei X., Zhang D., Zhang Y., Jiang S., Fu X. Overexpressed microRNA-494 represses RIPK1 to attenuate hippocampal neuron injury in epilepsy rats by inactivating the NF-κB signaling pathway. Cell Cycle. 2020;19:1298–1313. doi: 10.1080/15384101.2020.1749472. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
Not applicable.