Skip to main content
Communications Biology logoLink to Communications Biology
. 2022 Jan 10;5:5. doi: 10.1038/s42003-021-02945-x

JIP3 links lysosome transport to regulation of multiple components of the axonal cytoskeleton

N M Rafiq 1,2,3,4, L L Lyons 1,2,3, S Gowrishankar 1,2,3,4,6, P De Camilli 1,2,3,4,5,, S M Ferguson 1,2,3,
PMCID: PMC8748971  PMID: 35013510

Abstract

Lysosome axonal transport is important for the clearance of cargoes sequestered by the endocytic and autophagic pathways. Building on observations that mutations in the JIP3 (MAPK8IP3) gene result in lysosome-filled axonal swellings, we analyzed the impact of JIP3 depletion on the cytoskeleton of human neurons. Dynamic focal lysosome accumulations were accompanied by disruption of the axonal periodic scaffold (spectrin, F-actin and myosin II) throughout each affected axon. Additionally, axonal microtubule organization was locally disrupted at each lysosome-filled swelling. This local axonal microtubule disorganization was accompanied by accumulations of both F-actin and myosin II. These results indicate that transport of axonal lysosomes is functionally interconnected with mechanisms that control the organization and maintenance of the axonal cytoskeleton. They have potential relevance to human neurological disease arising from JIP3 mutations as well as for neurodegenerative diseases associated with the focal accumulations of lysosomes within axonal swellings such as Alzheimer’s disease.

Subject terms: Cellular neuroscience, Microtubules


Rafiq et al. report that disruption of JIP3-dependent control of axonal lysosome transport in human neurons results in unexpected changes to the organization of multiple cytoskeletal proteins. This study provides new insights that improve our understanding of intellectual disabilities caused by mutations in JIP3, and are relevant for neurodegenerative diseases associated with accumulations of lysosomes such as the Alzheimer’s disease

Introduction

Neurons face major demands arising from their extreme size, polarity and longevity. Axons in particular stand out due to their length, which requires both long-range transport for delivery of cargoes to and from distant locations combined with mechanisms to ensure structural integrity13. These challenges create unique vulnerabilities that are reflected in the numerous neurodevelopmental and neurodegenerative diseases arising from defects in axonal transport and maintenance46. The unique morphology and functions of axons requires specialized organization of multiple cytoskeletal components. Axonal microtubules, which provide the tracks on which motors can transport organelles and other cargoes over long distances, are polarized with their plus ends towards the distal axon and regulated by the binding of various microtubule binding proteins710. The membrane associated periodic actin-spectrin lattice provides structural support to ensure axon integrity and non-muscle myosin II-dependent contractility coordinates the passage of organelles through the narrow confines of axons1115.

The vast majority of axonal proteins are synthesized in the neuronal cell body and proximal dendritic regions, and are subsequently transported into axons to meet their structural, signaling, and metabolic demands and to support synaptic transmission16. Conversely, efficient retrograde transport from the axon periphery back to the cell body is required for the clearance of old or damaged proteins, as well as of material taken up by endocytosis, via endocytic and autophagic pathways17,18. This transport is primarily mediated by immature lysosomes and auto-lysosomes, which have a low content of lysosomal hydrolases and whose fate is to mature into fully degradative lysosomes in cell bodies by fusing with hydrolases-enriched vesicles delivered from the trans-Golgi network18. The massive accumulation of these organelles at the distal side of focal blocks of axonal transport reveals that such lysosomes are the major retrograde axonal cargo19.

A similar build-up of immature lysosomes is observed in axon swellings surrounding amyloid Aβ deposits at Alzheimer’s disease amyloid plaques (both in human patients and in mouse models of the disease), which are putative sites of APP processing2022. A link between accumulation of axonal lysosomes due to their impaired transport and amyloidogenic APP processing was further supported by studies of neurons and mice with loss of JIP3 function23. JIP3 is a motor interacting protein that is preferentially expressed in neurons and is thought to couple cargos such as lysosomes to dynein, the microtubule minus-end directed motor24. JIP3 loss-of-function mutations in multiple animal species result in the build-up of lysosomes within axons23,25,26. For example, primary cultures of mouse JIP3 knockout neurons exhibit a striking increase in the overall abundance of axonal lysosomes with focal accumulations within axonal swellings that are strikingly similar to the lysosome-filled axonal swellings observed at amyloid plaques23. These changes raised questions about the relationship between lysosomes and the axonal cytoskeleton with potential implications for Alzheimer’s disease.

To address these questions, we used human JIP3 KO iPSC-derived cortical glutamatergic neurons that we recently established as a cellular model for investigating the impact of JIP3 depletion on neuronal cell biology27. Surprisingly, we found that axons with lysosome-filled swellings had a massive disruption in their actin-spectrin and myosin-II lattice organization that was not restricted to just the local site of the swelling but which occurred throughout each affected JIP3 KO axon. The additional KO of JIP4 further enhanced this phenotype, consistent with an overlapping role of the two proteins27. Axonal swellings filled with lysosomes were not static but formed and resolved over the course of several hours. Intriguingly, their formation coincided with local microtubule disorganization. Our observations support a model wherein perturbed axonal lysosome transport induced by loss of JIP3 (or JIP3 and JIP4) is closely linked to a broad disruption of the neuronal cytoskeleton.

Results

Global disruption of the membrane periodic skeleton in axons with lysosome-filled axonal swellings

The axonal plasma membrane is supported by an organized cytoskeletal network containing actin filaments and spectrin tetramers12,28,29. This actin-spectrin network, which has been linked to axonal mechanical stability3,13 and signaling30, was also recently shown to undergo transient local expansion to facilitate the transport of large cargoes in narrow axons31. The important role of this cytoskeletal scaffold in controlling axon diameter suggested that lysosome-filled axonal swellings of JIP3 KO neurons might require major rearrangement to this network. To address this question, human induced pluripotent stem cells (iPSCs), which can be differentiated into layer 2/3 cortical glutamatergic neurons (i3Neurons)27,32 were used in this study. The KO of JIP3 in this human i3Neuron model system robustly develops lysosome-filled axonal swellings similar to those observed in primary cultures of mouse JIP3 KO cortical neurons while overcoming practical challenges arising from the neonatal lethality in the JIP3 KO mouse model (Fig. 1a–c)23,27.

Fig. 1. Lysosome-filled axonal swellings in JIP3 KO axons correlate with global disruption of the membrane periodic skeleton.

Fig. 1

a, b Airyscan imaging of control i3Neurons and JIP3 KO i3Neurons (13 days of differentiation). Yellow arrowheads highlight lysosome-positive axonal swellings in the KO neurons (scale bars, 15 μm). c Percentage of i3Neurons containing at least one lysosome-positive axonal swelling represented as mean ± SD, pooled from four independent experiments (n ≥ 32 per experiment, 13 days of differentiation). d, e STED microscopy images of βII-spectrin immunofluorescence in the axons of control i3Neurons (day 17). (Scale bars, d: 5 μm; e: 1 μm). f Graph demonstrating the longitudinal distance between peaks in the βII-spectrin signal from the boxed region in (e). g Airyscan microscopy images of control i3Neurons show regular distribution of lysosomes (LAMP1, white) and intact periodic membrane skeletons (βII-spectrin, green). h JIP3 KO i3Neurons (day 15) exhibit disruption in the spectrin organization in axons positive for lysosome accumulations (scale bars, 5 μm). i Percentage of swollen axons with disrupted periodic membrane skeleton represented as mean ± SD pooled from three independent experiments (≥20 axons analyzed per experiment). Lysosomes and the periodic membrane skeleton were labeled with LAMP1 and βII-spectrin antibodies, respectively. j Graph depicting the mean βII-spectrin fluorescence intensity of JIP3 KO neurites with and without lysosome-filled axonal swellings (≥35 µm in length) represented as mean ± SD, pooled from three independent experiments (n ≥ 20 in total). Note the possible contribution of some dendrites to the “No swellings” group. k, l Immunoblots showing levels of βII-spectrin in control and JIP3 KO i3Neurons (day 15); ribosomal protein S6 was used as loading control (k), and their normalized expression levels is shown in (l). m STED microscopy images of myosin-II filaments (green) show a periodic distribution similar to that of F-actin (magenta) in control i3Neurons. n Myosin-II and actin organization is lost in JIP3 KO i3Neurons (day 15) and both were enriched at the lysosome-positive axonal swellings (white). Lysosomes and myosin-II filaments were labeled with antibodies against LAMP1 and non-muscle myosin-IIA respectively, while rhodamine phalloidin was used to label F-actin. Scale bars, 5 μm. p-values were calculated using two-tailed Student’s t-test.

We next tested whether the axons of i3Neurons develop a membrane associated periodic skeleton similar to that observed in rodent neuron primary culture models29,33. Stimulated emission depletion (STED) super-resolution fluorescence microscopy of control i3Neurons after labeling with antibodies against the C-terminus of βII-spectrin, revealed a periodic spectrin lattice (180–200 nm intervals) (Fig. 1d-f), in agreement with previous studies in other neuron culture systems33,34. In the control i3Neurons, this periodic spectrin organization was apparent by 9 days of differentiation and then persisted as the neurons aged (out to 21 days in this study; Fig. 1d). This lattice was also observed in JIP3 KO neurons by 9 days of differentiation, a stage at which they have undergone extensive axon growth but do not yet display lysosome accumulations (Supplementary Fig. 1a). In contrast, in older JIP3 KO i3Neurons that developed lysosome-filled axonal swellings, the axonal spectrin lattice was disrupted (Fig. 1g–j). This striking disruption was not limited to the local site of lysosome accumulation but occurred throughout the entire affected axon (Fig. 1g–j). This phenotype was even observed in axons with very sparse swellings (Supplementary Fig. 1b). No difference was observed in the overall protein levels of βII-spectrin between control and JIP3 KO i3Neurons (Fig. 1k, l). The apparent loss of βII-spectrin signal in the microscopy experiments, therefore, most likely reflects the dispersal and washout of unassembled spectrin under the extraction conditions employed to enable super-resolution imaging of the rings formed by βII-spectrin. Consistent with the disruption of the spectrin periodic skeleton, the periodic organization of axonal F-actin was also lost and F-actin instead accumulated at the swellings (Fig. 1m, n). Collectively, this data indicates that the axonal actin-spectrin lattice still formed in JIP3 KO i3Neurons but later disassembled in parallel with the development of lysosome accumulations.

Non-muscle myosin-II associates with F-actin within the actin-spectrin lattice and controls axon radial contractility11,31. We, therefore, examined the impact of the absence of JIP3 on the sub-cellular localization of myosin-II (Fig. 1m, n). In control i3Neurons, myosin-II filaments displayed a periodic pattern with occasional gaps along the axonal shaft (Fig. 1m). This organization was completely lost in the axons of JIP3 KO i3Neurons that had lysosome-filled axonal swellings (Fig. 1n). In these axons, the myosin-II signal, like F-actin, was instead most prominent within the swellings.

Lysosome-filled axonal swellings coincide with sites of abnormal microtubules organization

The assembly of the actin/spectrin-based axonal periodic scaffold is dependent on intact microtubules (Zhong et al.34). Given the drastic disruption of this scaffold in the swollen axons of JIP3 KO i3Neurons (as well as the essential role for microtubules in long range axonal transport of organelles), we next investigated microtubule organization. Remarkably, the sites at which lysosomes accumulate in JIP3 KO axons coincided with local disorganization of microtubules, as assessed by α-tubulin immunofluorescence (Fig. 2a–c). The disorganization of microtubules was further exacerbated in older JIP3 KO i3Neurons (Fig. 2d–f). The majority of microtubules within the swellings were bent and looped, while axonal regions immediately adjacent to the swellings contained microtubules that were organized in the typical parallel bundles of control axons (Fig. 2b). This disruption of the normal parallel arrangement of microtubules throughout axons was even more striking in cultures of JIP3 + JIP4 double KO i3Neurons, where as previously reported27, lysosome-filled swellings were larger and more abundant (Fig. 2g–i). Of note, while lysosomes strongly accumulate in JIP3 KO i3Neurons and JIP3 + JIP4 double KO i3Neurons, mitochondria and synaptic vesicles are also present in these lysosome-positive swellings, but to a much lesser degree (Supplementary Fig. 2a–f).

Fig. 2. Lysosome-filled axonal swellings in JIP3 KO axons coincide with sites of abnormal microtubule organization.

Fig. 2

a, b Airyscan imaging of LAMP1 (green) and α-tubulin (magenta) immunofluorescence in control and JIP3 KO i3Neurons (day 13), respectively (scale bars, 5 μm). c Percentage of swollen axons with abnormally looped microtubules presented (mean ± SD; pooled from three independent experiments, ≥30 axons per experiment). d, e Control and JIP3 KO i3Neurons after 22 days of differentiation labeled for microtubules (SiR-tubulin; yellow arrowheads highlight examples of severe microtubule looping; scale bars, 5 μm). f The percentage of neurites (mean ± SD) with disorganized microtubules pooled from four independent experiments of 22 day old cultures (≥34 neurites per experiment). g, h Lysotracker (green) and SiR-Tubulin (magenta) in control and JIP3 + JIP4 double KO i3Neurons (day 12) respectively (scale bars, 5 μm). i The percentage of neurites (mean ± SD) with disorganized microtubules pooled from four independent experiments (≥22 neurites per experiment). p-values in all experiments were calculated using two-tailed Student’s t-tests.

Microtubules undergo several distinct post-translational modifications3537, which reflect microtubule age and the activities of multiple tubulin-modifying enzymes38,39. Immunofluorescent labeling revealed acetylation of axonal microtubules in both control and JIP3 KO i3Neurons, and there were no noticeable differences in the acetylation status of looped versus parallelly-organized microtubules in the KO neurons (Fig. 3a–c). In contrast, when microtubule tyrosination status was examined, the looped microtubules were found to be predominantly detyrosinated (Fig. 3d–f). While the mechanisms that underlie the relationship between looping and detyrosination of microtubules remain uncertain, it is possible that detyrosinated microtubules are more stable, potentially through inhibited binding of the depolymerizing kinesin (MCAK) to microtubules40,41. In addition, as CAP-Gly domain containing proteins, such as the p150Glued subunit of dynactin, prefer tyrosinated microtubules and tyrosinated microtubules have been proposed to be preferred tracks for initiating movement of axonal LAMP1-positive organelles (lysosomes)42,43, accumulation of detyrosinated microtubules within axonal swellings could have an impact on lysosome transport at such sites.

Fig. 3. Microtubule loops in JIP3 KO axonal swellings are primarily detyrosinated.

Fig. 3

a, b Airyscan microscopy images of acetylated-α-tubulin, (green) and total microtubules (magenta) in control and JIP3 KO i3Neurons (day 13) respectively. Scale bars, 5 μm. c Fraction of acetylated and non-acetylated microtubules in JIP3 KO i3Neurons (pooled data from 2 experiment with ≥19 swellings analyzed per experiment). d, e Airyscan microscopy images of neurites from both control (d) and JIP3 KO i3Neurons (day 13) (e) consist of parallel microtubule bundles that are either detyrosinated (green) or tyrosinated (magenta) in control and JIP3 KO i3Neurons, respectively. Scale bars, 5 μm. f Fraction of detyrosinated and tyrosinated microtubules in JIP3 KO i3Neurons (pooled from three independent experiments with ≥18 swellings analyzed per experiment).

Axonal swellings are highly dynamic

We next performed long-term live cell imaging of lysosomes and microtubules in JIP3 KO i3Neurons to examine the dynamics of the axonal swellings. For the purpose of microtubule visualization, we employed low concentrations of the SiR-tubulin dye. This probe yielded a fluorescent microtubule pattern highly similar to the pattern of anti-α tubulin immunofluorescence (Fig. 2a, b) including the appearance of microtubule loops within axonal swellings (Fig. 2b, d, e). Time-lapse imaging of JIP3 KO i3Neurons stably expressing LAMP1-GFP (lysosome marker) and labeled with SiR-tubulin revealed that lysosome-filled axonal swellings form and resolve over a time scale of several hours (3.77 ± 1.71 h; Fig. 4a–d, Supplementary Movie 1). The close spatial and temporal relationship between lysosome accumulation and microtubule looping within these axonal swellings prevented definitive conclusions regarding a cause-effect relationship between these events (Fig. 4b, c).

Fig. 4. Lysosome-positive axonal swellings are dynamic in JIP3 KO neurons.

Fig. 4

a Representative image of JIP3 KO i3Neurons (day 15) stably expressing LAMP1-GFP (green) and labeled with SiR-tubulin (magenta) at the beginning of a 12-h time lapse imaging time course (Airyscan microscopy). Scale bar, 5 μm. b Images from the boxed area in (a) at the indicated time points. Scale bar, 2 μm. c Kymograph of the region (marked by white line in b; scale bar, 2 h). d Scatter dot plot (mean ± SEM) depicting the duration of 41 swellings pooled from 7 independent experiments.

To test whether microtubule perturbations can directly influence the focal accumulation of lysosomes, we acutely treated JIP3 KO i3Neurons with a low dose of taxol (10 nM) for 1 h, as a higher concentration (1 µM) of taxol showed apparent toxicity in these neurons. We found that low doses of taxol efficiently mobilized large fractions of lysosomes from the axonal swellings within a period of 1 h (Supplementary Fig. 3a, b). These results support a coordinated role for JIP3 in the maintenance of lysosome transport and regulation of microtubule behavior.

To test the specificity of the phenotypes observed in JIP3 KO i3Neurons, we performed genome editing on JIP3 KO iPSCs to remove the 1 bp insertion in our JIP3 KO line and thus restore JIP3 expression (JIP3 Rescue). JIP3 expression was restored in the neurons derived from these JIP3 Rescue iPSCs (Fig. 5a). Furthermore, these JIP3 Rescue i3Neurons did not exhibit lysosome-positive focal swellings nor any disruptions to the microtubule organization (Fig. 5b–e). In addition, the disruptions to the axonal spectrin lattice in swollen JIP3 KO axons (Fig. 1g–i) were not found in JIP3 Rescue i3Neurons, as indicated by the βII-spectrin staining (Fig. 5f–j). Collectively, these results demonstrate that both the lysosome accumulations and the cytoskeletal disorganization arose specifically due to the loss of JIP3 rather than any off-target effect of the genome editing strategy that was employed to generate the JIP3 KO line.

Fig. 5. Rescue of JIP3 KO phenotypes.

Fig. 5

a Immunoblots showing levels of JIP3 in control, JIP3 KO and JIP3 Rescue (gene-edited to WT) i3Neurons (day 17). Ribosomal protein S6 immunoblots served as loading controls. bd Airyscan imaging of Lysotracker (green) and Sir-tubulin (magenta) in control (b), JIP3 KO (c) and JIP3 Rescue d) i3Neurons (day 17), respectively (scale bars, 5 μm). e Percentage of i3Neurons containing at least one lysosome-positive axonal swelling represented as mean ± SD, pooled from three independent experiments (n ≥ 20 per experiment, 17 days of differentiation). fh Airyscan microscopy images of lysosomes (white) and βII-spectrin (green) in control (f), JIP3 KO (g) and JIP3 Rescue (h) i3Neurons (Day 17), respectively. (yellow arrowheads highlight lysosome-filled swellings; scale bars, 5 μm). Lysosomes and the periodic membrane skeleton were labeled with LAMP1 and βII-spectrin antibodies, respectively. i Percentage of swollen axons with disrupted periodic membrane skeleton represented as mean ± SD pooled from two independent experiments (≥8 analyzed per experiment). p-values were calculated using two-tailed Student’s t-tests.

Discussion

Our investigation of the relationships between lysosome axonal transport and multiple components of the axonal cytoskeleton in neurons that lack JIP3, or both JIP3 and its paralogue JIP4, revealed that focal lysosome accumulations are accompanied by major disruptions in organization of the axonal membrane associated periodic skeleton. Furthermore, the accumulation of lysosomes in focal swellings of mutant neurons coincided both spatially and temporally with local microtubule disorganization. These observations reveal major unexpected relationships between axonal lysosome transport and the organization of multiple aspects of the axonal cytoskeleton. They furthermore raise new questions about the chain of events that link lysosome transport, microtubule organization and the cytoskeletal machinery that controls axon diameter.

Although impacts of JIP3 depletion on axonal lysosome abundance and/or transport have been observed in multiple species23,25,26,44, broader effects of JIP3 mutation on the axonal abundance of multiple organelles have also been reported4549. Our new observations of the dramatic cytoskeleton disruption that correlates with focal lysosome accumulations in both JIP3 KO (and JIP3 + JIP4 double KO) neurons provide a potential explanation for the broad requirement for JIP3/4 for the axonal transport of multiple organelles that would not require a direct involvement of JIP3/4 in the transport of each class of organelles.

The focal accumulations of lysosomes coincide spatially and temporally with local disorganization of microtubules in JIP3 KO i3Neurons and the overall severity of this phenotype is further exacerbated in the JIP3+JIP4 double KO i3Nneurons. Our initial interpretation of these lysosome phenotypes was that lysosomes fall off their microtubule tracks due to a loss of JIP3+4-dependent connections to motors. The surprising discovery that these sites of lysosome accumulation were accompanied by extensive looping of microtubules suggests a more complex relationship between lysosome transport and microtubule organization. It remains to be determined whether this reflects an impact of forces exerted on microtubules by lysosome movement versus a potential signaling mechanism controlled by JIP3.

It was particularly striking that the dynamic formation of local axonal swellings with lysosome accumulation and microtubule looping in JIP3 KO neurons was accompanied by a widespread disruption of the integrity of the axonal membrane associated periodic skeleton. This all-or-none effect is consistent with two distinct interpretations. One is that the focal swellings elicit changes that are propagated along the entire axonal shaft. Another is that loss of JIP3 results in an age-dependent disruption of the periodic actin/spectrin-based scaffold that facilitates formation of the focal swellings where lysosomes accumulate. Interestingly, the assembly of the axonal membrane associated periodic skeleton is dependent on microtubule integrity34,50, suggesting that the cytoskeletal changes observed in JIP3 + JIP4 KO neurons may be interconnected. Interaction between the periodic membrane skeleton and microtubules may occur via several linker proteins, including ankyrins, which bind both spectrin and microtubules34,51,52. More recently, dynein has been implicated in the maintenance of the actin-spectrin cytoskeleton at the axon initial segment through endocytosis-related mechanisms53. This provides another means through which the integrity of the actin-spectrin rings can be regulated by motor proteins. The elucidation of the precise sequence of events will require further experimentation.

The phenotypes that we observed in JIP3 KO axons are reminiscent of axonal beading that arises in response to multiple forms of axonal perturbation5456. It was recently shown that changes in the local tension of the axonal membrane leads to the propagation of such “beads”57. Myosin-II filaments within the periodic membrane skeleton contribute to contractility and may control tension homeostasis along the axonal shaft31. Hence, if the dilations are upstream events, the all-or-none disruption of the axonal periodic scaffold within swollen JIP3 KO axons may be a consequence of tensional instability along the axons.

Loss of JIP3 could also have signaling consequences that could propagate beyond its direct subcellular site of action. In addition to interactions with motors, JIP3 (and JIP4) also intersect with signaling in the JNK pathway by acting as a scaffold that regulates the subcellular position and activity of DLK and JNK25,5860. Additionally, transport defects could impede the ability of lysosomes to act as sites for nutrient and growth factor-dependent activation of the mTORC1 signaling pathway61,62.

In conclusion, our findings have revealed new reciprocal interrelations between lysosome transport and the structure and the dynamics of the axonal cytoskeleton. The stalling of lysosomes during their retrograde journey correlated with profound changes in axons. A priority for future work will be to determine cause-effect relationships between the multiple tightly linked changes that we have observed here. In addition to advancing our knowledge about fundamental aspects of cell function, these studies may provide new insight into mechanisms relevant to Alzheimer’s disease pathology as well as to human intellectual disabilities arising from mutations in the MAPK8IP3/JIP3 gene63,64.

Methods

Human iPSC culture and neuronal differentiation

Human iPSCs were differentiated into cortical i3Neurons according to a previously described protocol based on the doxycycline inducible expression of Ngn232. Briefly, the iPSCs were cultured on human embryonic stem cell (hESC)-qualified Matrigel (Corning) and fed with fresh mTeSR™1 medium (STEMCELL Technologies) on alternate days. Rho-kinase (ROCK) inhibitor Y-27632 (EMD Millipore, 10 μM) was added to the iPSC cultures on the first day of plating and replaced with fresh media without ROCK inhibitor on the following day. For neuronal differentiation, iPSCs were dissociated with Accutase (STEMCELL Technologies) and re-plated at a density between 1.5–3 × 105 cells on matrigel-coated dishes in induction medium (KnockOut DMEM/F-12 (Thermo Fisher Scientific) containing 1% N2-supplement [Gibco], 1% NEAA [Gibco], 1% GlutaMAX [Gibco]) and 2 μg/mL doxycycline [Sigma]). After 3 days, pre-differentiated i3Neurons were dispersed using Accutase and plated on poly-L-ornithine (Sigma, 1 μg/ml) and laminin (Thermo Fisher Scientific, 10 μg/ml) coated 35 mm glass-bottom dishes (MatTek) or 6-well plates (Corning) for imaging and immunoblotting, respectively. These i3Neurons were cultured and maintained in cortical medium (induction medium supplemented with 2% B27 (Gibco), 10 ng/mL BDNF (PeproTech), 10 ng/mL NT-3 (PeproTech) and 1 μg/mL laminin). Fresh cortical media was added to the existing media every 5 days. The iPSCs and i3Neurons were kept at 37 °C with 5% CO2 in an enclosed incubator.

CRISPR–Cas9 mediated rescue of JIP3 KO iPSCs

A CRISPR-based homologous recombination strategy was used to correct the 1 bp insertion in the JIP3 KO iPSC line. Briefly, 1 × 105 JIP3 KO iPSCs were plated on Matrigel-coated 6-well plate and transfected the following day using the Lipofectamine Stem transfection reagent (Thermo Fisher Scientific) and the following two components: 3 µg of px458 plasmid (Addgene plasmid #48138) containing a small guide RNA encoded within the following sense (5′CACCGGGCGGCGTGGTGGTGTTACC3′) and antisense (5′AAAC GGTAACACCACCACGCCGCCC 3′) sequences that was designed to selectively target the JIP3 KO sequence containing the 1 bp insertion and a 140 bp single stranded DNA oligonucleotide repair template (5 µl of 100 µM stock) that overlapped the gRNA-targeted region. The sequence of the DNA template was the following: 5′GCCGCGCTGGCGGCGGCGGTGGCCGCGATGATGGAGATCCAGATGGACGAGGGCGGCGGCGTGGTGGTGTACCAGGACGACTACTGCTCCGGCTCGGTGATGTCGGAGCGGGTGTCGGGCCTGGCGGGCTCCATCTACCG 3′. Transfected (GFP-positive) cells were enriched by fluorescence activated cell sorting (FACS) 2 days later. Sorted cells were expanded and then serially diluted to yield single cell-derived clonal populations. 40 clones were selected and screened using PCR amplification of genomic DNA flanking the sgRNA target site followed by sequencing of the amplicons using the primers described in Gowrishankar, et al.27.

Live cell imaging and drug treatments

Live imaging of control, JIP3 KO and JIP3+4 KO i3Neurons27 was performed on day 10–22 post-differentiation in cortical medium supplied with 5% CO2 and maintained at 37 °C. I3Neurons stably-expressing LAMP1-GFP27 or LysoTracker-labeled i3Neurons were used to visualize lysosome dynamics. For lysotracker and mitotracker labeling, i3Neurons were stained with 30 nM LysoTracker™ Green DND-26, 10 nM LysoTracker™ Deep Red or 100 nM MitoTracker™ Deep Red (Thermo Fisher Scientific) for 3 min, washed twice with fresh cortical media, and then imaged immediately. To label synaptic vesicles, i3Neurons were transfected with 4 μl Lipofectamine Stem Transfection Reagent (Thermo Fisher Scientific) in 200 μL OptiMEM medium mixed with 3 μg synaptophysin-GFP plasmid and incubated for 10 min. The Lipofectamine-DNA complex was added to the imaging dish, followed by media replacement with fresh cortical media on the following day. For Taxol treatment, i3Neurons were labeled with lysotracker as described above and then treated with 10 nM or 1 μM taxol (Sigma) for 1 h.

Immunofluorescence

For i3Neuron samples involving actin and spectrin staining, cells were fixed and extracted for 1 min using a solution of 0.3% (v/v) glutaraldehyde and 0.25% (v/v) Triton X-100 in cytoskeleton buffer (CB, 10 mM MES pH 6.1, 150 mM NaCl, 5 mM EGTA, 5 mM glucose and 5 mM MgCl2), post-fixed for 15 min in 2% (v/v) glutaraldehyde in CB at 37 °C, and then washed twice in phosphate-buffered saline (PBS) according to a previously described protocol33. For microtubule staining, cells were fixed and extracted for 15 min using a solution of 4% (v/v) paraformaldehyde, 0.2% (v/v) glutaraldehyde and 0.25% (v/v) Triton X-100 in CB at 37 °C, and then washed twice in PBS. For removal of free aldehyde groups, cells were quenched with fresh 1 mg/ml sodium borohydride in CB (Sigma) for 10 min, and then washed thrice in PBS. Cells were further blocked for 30 min in 5% bovine serum albumin (BSA, Sigma) in phosphate-buffered saline (PBS) and then incubated overnight at 4 °C with the following antibodies: anti-α-tubulin (Sigma, catalog no. T6199, dilution 1:500); anti-LAMP1 (Cell Signaling Technology, catalog no. 9091, dilution 1:500) or (Developmental Studies Hybridoma Bank, clone 1D4B, dilution 1:500); anti-βII-spectrin (BD Transduction Laboratories, Clone 42/B-Spectrin II, dilution 1:250); anti-non muscle heavy chain of myosin-IIA (Sigma, catalog no. M8064, dilution 1:500); anti-acetyl α-tubulin (Cell Signaling Technology, catalog no. 5335, dilution 1:250); anti-detyrosinated α-tubulin (Abcam, catalog no. ab48389, dilution 1:250); anti-tyrosinated α-tubulin (Millipore Sigma, clone YL1/2, dilution 1:250). Cells were washed with PBS thrice and incubated with Alexa Fluor-conjugated secondary antibodies (Thermo Fisher Scientific) for 1 h at room temperature, followed by three washes in PBS. F-actin was visualized by Alexa Fluor 488 or rhodamine-conjugated phalloidin (Thermo Fisher Scientific, dilution 1:100).

Immunoblotting

Control, JIP3 KO and JIP3 + 4 KO i3Neurons were grown on six-well plates (3 × 105 cells/well). After differentiation in cortical media, i3Neurons (typically 17 days) were washed with ice-cold PBS and then lysed in lysis buffer (50 mM Tris pH 7.4, 150 mM NaCl, 1 mM EDTA, and 1% Triton X-100) supplemented with cOmplete™ EDTA-free protease inhibitor cocktail (Roche) and PhosSTOP phosphatase inhibitor cocktail (Roche), followed by centrifugation at 13,000 × g for 6 min. The supernatant was collected and incubated at 95 °C for 5 min in SDS sample buffer containing 1% 2-mercaptoethanol (Sigma). The extracted proteins were separated by SDS-PAGE in Mini-PROTEAN TGX precast polyacrylamide gels (Bio-Rad) and transferred to nitrocellulose membranes (Bio-Rad) at 100 V for 1 h or 75 V for 2 h (for high molecular weight proteins: >150 kDa). Subsequently, the nitrocellulose membranes were blocked for 1 h with 5% non-fat milk (AmericanBIO) in TBST (tris-buffered saline [TBS] + 0.1% tween 20), then incubated overnight at 4 °C with primary antibodies: anti-JIP3 (Novus Biologicals, catalog no. NBP1-00895, dilution 1:500); anti-S6 Ribosomal Protein (S6, Cell Signaling Technology, catalog no. 2217, dilution 1:2500); anti-βII-spectrin (BD Transduction Laboratories, Clone 42/B-Spectrin II, dilution 1:1000).

Subsequently, the nitrocellulose membranes were washed 3 times (10 min each) in TBST and probed by incubation for 1 h with the secondary antibodies conjugated with horseradish peroxidase. The membranes were then washed three times (15 min at room temperature each), developed using Pierce™ ECL western blotting substratum (Thermo Fisher Scientific) and imaged by a Versa-Doc imaging system (Bio-Rad).

Uncropped images of the immunoblots presented in Fig. 1k and Fig. 5a of this paper are shown in Supplementary Fig. 4.

Fluorescence microscopy

Two types of high-resolution microscopes were used in this study. The LSM 880 inverted confocal laser scanning microscope with Airyscan (Carl Zeiss Microscopy) accompanied with 63×/1.40 numerical aperture (NA) plan-apochromat differential interference contrast (DIC) oil immersion objective and 32-channel gallium arsenide phosphide (GaAsP)-photomultiplier tubes (PMT) area detector and 488 nm, 561 nm and 633 laser lines was used in this study. Images were acquired and processed using ZEN imaging software (Zeiss). The Leica TCS SP8 gated STED super-resolution confocal microscope (Leica Microsystems) is coupled with Leica harmonic compound (HC) plan apochromatic (PL APO) 100×/1.40 oil STED objective and Leica gated HyD hybrid detector. Briefly, a white light excitation laser accompanied with 592 nm, 660 nm and 775 nm depletion lasers was used in this study. Images were acquired using LAS X software (Leica Microsystems) and final images were deconvolved using Huygens deconvolution software (Huygens Essentials, Scientific Volume Imaging).

Quantification and statistical analysis

Images were pseudocolor-coded, adjusted for brightness and contrast, cropped and/or rotated using the open-source image processing software FIJI (ImageJ)65. Dendrites and axons were identified by visual tracking of the length of the neurite. Percentage of neurites were quantified using the FIJI plugin “NeuronJ” and/or the FIJI segmented lines + ROI manager tool to determine the total number of neurites. For quantification of βII-spectrin intensity, neurites of at least 35 μm in length were semi-automatically traced and quantified using “NeuronJ” to determine the mean fluorescence value (8-bit) of the traced segments. In the case of JIP3 KO i3Neurons where βII-spectrin intensity is markedly reduced, LAMP1 staining was used to trace the swollen axons as described above. The traced segments were then overlayed to the βII-spectrin channel for subsequent quantification.

Immunoblot data were processed using Image Lab software (Bio-Rad) and quantified using the “Gels” ImageJ plugin. The methods for statistical analysis and sizes of the samples (n) are specified in the results section or figure legends for all of the quantitative data. Student’s t test or Mann–Whitney test was used when comparing two datasets. Differences were accepted as significant for P < 0.05. Prism version 9 (GraphPad Software) was used to plot, analyze and represent the data.

Reporting summary

Further information on research design is available in the Nature Research Reporting Summary linked to this article.

Supplementary information

Supplemental Material (1.6MB, pdf)
42003_2021_2945_MOESM2_ESM.pdf (411KB, pdf)

Description of Additional Supplementary Files

Supplementary Movie 1 (22MB, mov)
Supplementary Data 1 (22.6KB, xlsx)
Reporting Summary (1.9MB, pdf)

Acknowledgements

We are grateful to Michael Ward (NINDS) for his contribution of the human iPSCs with doxycycline-inducible Ngn2 expression and his generous advice on their use. Agnes Roczniak-Ferguson played a key role in establishing iPSC genome editing and neuronal differentiation in our lab. Christopher Lovejoy provided helpful feedback on analysis of cytoskeleton phenotypes. This research was supported in part by the Dementia Discovery Foundation (S.M.F. and P.D.C.), the NIH (NS36251 to P.D.C.; AG062210 TO SMF), and the Kavli Foundation (P.D.C.).

Author contributions

N.B.M.R., L.L.L., P.D.C., and S.M.F. designed experiments. N.B.M.R. and L.L.L. performed all experiments. S.G. developed key reagents. N.B.M.R., P.D.C., and S.M.F. prepared the manuscript.

Peer review information

Communications Biology thanks the anonymous reviewers for their contribution to the peer review of this work. Primary Handling Editors: Tiago Dantas and Karli Montague-Cardoso.

Data availability

All data generated or analyzed during this study are included in this published article (and its Supplementary Information files: Supplementary Material and Supplementary Data 1). Raw datasets generated during and/or analyzed during the current study are available from the corresponding authors on reasonable request.

Code availability

Custom-written code used to analyse the data in the current study is available from the corresponding authors on reasonable request.

Competing interests

The authors declare no competing interests.

Footnotes

Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Contributor Information

P. De Camilli, Email: pietro.decamilli@yale.edu

S. M. Ferguson, Email: shawn.ferguson@yale.edu

Supplementary information

The online version contains supplementary material available at 10.1038/s42003-021-02945-x.

References

  • 1.Maday S, Twelvetrees AE, Moughamian AJ, Holzbaur EL. Axonal transport: cargo-specific mechanisms of motility and regulation. Neuron. 2014;84:292–309. doi: 10.1016/j.neuron.2014.10.019. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Lorenzo DN, et al. betaII-spectrin promotes mouse brain connectivity through stabilizing axonal plasma membranes and enabling axonal organelle transport. Proc. Natl Acad. Sci. USA. 2019;116:15686–15695. doi: 10.1073/pnas.1820649116. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Hammarlund M, Jorgensen EM, Bastiani MJ. Axons break in animals lacking beta-spectrin. J. Cell Biol. 2007;176:269–275. doi: 10.1083/jcb.200611117. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Coleman MP, Hoke A. Programmed axon degeneration: from mouse to mechanism to medicine. Nat. Rev. Neurosci. 2020;21:183–196. doi: 10.1038/s41583-020-0269-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Millecamps S, Julien JP. Axonal transport deficits and neurodegenerative diseases. Nat. Rev. Neurosci. 2013;14:161–176. doi: 10.1038/nrn3380. [DOI] [PubMed] [Google Scholar]
  • 6.Sleigh, J. N., Rossor, A. M., Fellows, A. D., Tosolini, A. P. & Schiavo, G. Axonal transport and neurological disease. Nat. Rev. Neurol.10.1038/s41582-019-0257-2 (2019). [DOI] [PubMed]
  • 7.Barnes AP, Polleux F. Establishment of axon-dendrite polarity in developing neurons. Annu Rev. Neurosci. 2009;32:347–381. doi: 10.1146/annurev.neuro.31.060407.125536. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Kapitein LC, Hoogenraad CC. Which way to go? Cytoskeletal organization and polarized transport in neurons. Mol. Cell Neurosci. 2011;46:9–20. doi: 10.1016/j.mcn.2010.08.015. [DOI] [PubMed] [Google Scholar]
  • 9.Stiess M, Bradke F. Neuronal polarization: the cytoskeleton leads the way. Dev. Neurobiol. 2011;71:430–444. doi: 10.1002/dneu.20849. [DOI] [PubMed] [Google Scholar]
  • 10.Dent EW, Gertler FB. Cytoskeletal dynamics and transport in growth cone motility and axon guidance. Neuron. 2003;40:209–227. doi: 10.1016/s0896-6273(03)00633-0. [DOI] [PubMed] [Google Scholar]
  • 11.Costa, A. R. et al. The membrane periodic skeleton is an actomyosin network that regulates axonal diameter and conduction. Elife9, 10.7554/eLife.55471 (2020). [DOI] [PMC free article] [PubMed]
  • 12.Vassilopoulos S, Gibaud S, Jimenez A, Caillol G, Leterrier C. Ultrastructure of the axonal periodic scaffold reveals a braid-like organization of actin rings. Nat. Commun. 2019;10:5803. doi: 10.1038/s41467-019-13835-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Krieg M, Dunn AR, Goodman MB. Mechanical control of the sense of touch by beta-spectrin. Nat. Cell Biol. 2014;16:224–233. doi: 10.1038/ncb2915. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Wang, G. et al. Structural plasticity of actin-spectrin membrane skeleton and functional role of actin and spectrin in axon degeneration. Elife8, 10.7554/eLife.38730 (2019). [DOI] [PMC free article] [PubMed]
  • 15.Leterrier C. Putting the axonal periodic scaffold in order. Curr. Opin. Neurobiol. 2021;69:33–40. doi: 10.1016/j.conb.2020.12.015. [DOI] [PubMed] [Google Scholar]
  • 16.McEwen BS, Grafstein B. Fast and slow components in axonal transport of protein. J. Cell Biol. 1968;38:494–508. doi: 10.1083/jcb.38.3.494. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Kulkarni A, Chen J, Maday S. Neuronal autophagy and intercellular regulation of homeostasis in the brain. Curr. Opin. Neurobiol. 2018;51:29–36. doi: 10.1016/j.conb.2018.02.008. [DOI] [PubMed] [Google Scholar]
  • 18.Ferguson SM. Axonal transport and maturation of lysosomes. Curr. Opin. Neurobiol. 2018;51:45–51. doi: 10.1016/j.conb.2018.02.020. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Tsukita S, Ishikawa H. The movement of membranous organelles in axons. Electron microscopic identification of anterogradely and retrogradely transported organelles. J. Cell Biol. 1980;84:513–530. doi: 10.1083/jcb.84.3.513. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Gowrishankar S, et al. Massive accumulation of luminal protease-deficient axonal lysosomes at Alzheimer’s disease amyloid plaques. Proc. Natl Acad. Sci. USA. 2015;112:E3699–E3708. doi: 10.1073/pnas.1510329112. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Nixon RA. Endosome function and dysfunction in Alzheimer’s disease and other neurodegenerative diseases. Neurobiol. Aging. 2005;26:373–382. doi: 10.1016/j.neurobiolaging.2004.09.018. [DOI] [PubMed] [Google Scholar]
  • 22.Blazquez-Llorca L, et al. High plasticity of axonal pathology in Alzheimer’s disease mouse models. Acta Neuropathol. Commun. 2017;5:14. doi: 10.1186/s40478-017-0415-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Gowrishankar S, Wu Y, Ferguson SM. Impaired JIP3-dependent axonal lysosome transport promotes amyloid plaque pathology. J. Cell Biol. 2017;216:3291–3305. doi: 10.1083/jcb.201612148. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Vilela F, et al. Structural characterization of the RH1-LZI tandem of JIP3/4 highlights RH1 domains as a cytoskeletal motor-binding motif. Sci. Rep. 2019;9:16036. doi: 10.1038/s41598-019-52537-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Drerup CM, Nechiporuk AV. JNK-interacting protein 3 mediates the retrograde transport of activated c-Jun N-terminal kinase and lysosomes. PLoS Genet. 2013;9:e1003303. doi: 10.1371/journal.pgen.1003303. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Edwards SL, et al. An organelle gatekeeper function for Caenorhabditis elegans UNC-16 (JIP3) at the axon initial segment. Genetics. 2013;194:143–161. doi: 10.1534/genetics.112.147348. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Gowrishankar S, et al. Overlapping roles of JIP3 and JIP4 in promoting axonal transport of lysosomes in human iPSC-derived neurons. Mol. Biol. Cell. 2021;32:1094–1103. doi: 10.1091/mbc.E20-06-0382. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Han B, Zhou R, Xia C, Zhuang X. Structural organization of the actin-spectrin-based membrane skeleton in dendrites and soma of neurons. Proc. Natl Acad. Sci. USA. 2017;114:E6678–E6685. doi: 10.1073/pnas.1705043114. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.He J, et al. Prevalent presence of periodic actin-spectrin-based membrane skeleton in a broad range of neuronal cell types and animal species. Proc. Natl Acad. Sci. USA. 2016;113:6029–6034. doi: 10.1073/pnas.1605707113. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Zhou R, Han B, Xia C, Zhuang X. Membrane-associated periodic skeleton is a signaling platform for RTK transactivation in neurons. Science. 2019;365:929–934. doi: 10.1126/science.aaw5937. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Wang, T. et al. Radial contractility of actomyosin rings facilitates axonal trafficking and structural stability. J. Cell Biol.219, 10.1083/jcb.201902001 (2020). [DOI] [PMC free article] [PubMed]
  • 32.Fernandopulle MS, et al. Transcription factor-mediated differentiation of human iPSCs into neurons. Curr. Protoc. Cell Biol. 2018;79:e51. doi: 10.1002/cpcb.51. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Xu K, Zhong G, Zhuang X. Actin, spectrin, and associated proteins form a periodic cytoskeletal structure in axons. Science. 2013;339:452–456. doi: 10.1126/science.1232251. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Zhong, G. et al. Developmental mechanism of the periodic membrane skeleton in axons. Elife3, 10.7554/eLife.04581 (2014). [DOI] [PMC free article] [PubMed]
  • 35.Baas PW, Ahmad FJ, Pienkowski TP, Brown A, Black MM. Sites of microtubule stabilization for the axon. J. Neurosci. 1993;13:2177–2185. doi: 10.1523/JNEUROSCI.13-05-02177.1993. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Baas PW, Black MM. Individual microtubules in the axon consist of domains that differ in both composition and stability. J. Cell Biol. 1990;111:495–509. doi: 10.1083/jcb.111.2.495. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Nirschl JJ, Ghiretti AE, Holzbaur ELF. The impact of cytoskeletal organization on the local regulation of neuronal transport. Nat. Rev. Neurosci. 2017;18:585–597. doi: 10.1038/nrn.2017.100. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Janke, C. & Magiera, M. M. The tubulin code and its role in controlling microtubule properties and functions. Nat. Rev. Mol. Cell Biol.10.1038/s41580-020-0214-3 (2020). [DOI] [PubMed]
  • 39.Park JH, Roll-Mecak A. The tubulin code in neuronal polarity. Curr. Opin. Neurobiol. 2018;51:95–102. doi: 10.1016/j.conb.2018.03.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Peris L, et al. Motor-dependent microtubule disassembly driven by tubulin tyrosination. J. Cell Biol. 2009;185:1159–1166. doi: 10.1083/jcb.200902142. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Sirajuddin M, Rice LM, Vale RD. Regulation of microtubule motors by tubulin isotypes and post-translational modifications. Nat. Cell Biol. 2014;16:335–344. doi: 10.1038/ncb2920. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Peris L, et al. Tubulin tyrosination is a major factor affecting the recruitment of CAP-Gly proteins at microtubule plus ends. J. Cell Biol. 2006;174:839–849. doi: 10.1083/jcb.200512058. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Nirschl JJ, Magiera MM, Lazarus JE, Janke C, Holzbaur E. alpha-Tubulin Tyrosination and CLIP-170 Phosphorylation Regulate the Initiation of Dynein-Driven Transport in Neurons. Cell Rep. 2016;14:2637–2652. doi: 10.1016/j.celrep.2016.02.046. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Cason, S. E. et al. Sequential dynein effectors regulate axonal autophagosome motility in a maturation-dependent pathway. J. Cell Biol.220, 10.1083/jcb.202010179 (2021). [DOI] [PMC free article] [PubMed]
  • 45.Byrd DT, et al. UNC-16, a JNK-signaling scaffold protein, regulates vesicle transport in C. elegans. Neuron. 2001;32:787–800. doi: 10.1016/s0896-6273(01)00532-3. [DOI] [PubMed] [Google Scholar]
  • 46.Noma, K., Goncharov, A., Ellisman, M. H. & Jin, Y. Microtubule-dependent ribosome localization in C. elegans neurons. Elife6, 10.7554/eLife.26376 (2017). [DOI] [PMC free article] [PubMed]
  • 47.Sato T, et al. JSAP1/JIP3 and JLP regulate kinesin-1-dependent axonal transport to prevent neuronal degeneration. Cell Death Differ. 2015;22:1260–1274. doi: 10.1038/cdd.2014.207. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Brown HM, Van Epps HA, Goncharov A, Grant BD, Jin Y. The JIP3 scaffold protein UNC-16 regulates RAB-5 dependent membrane trafficking at C. elegans synapses. Dev. Neurobiol. 2009;69:174–190. doi: 10.1002/dneu.20690. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Sure GR, et al. UNC-16/JIP3 and UNC-76/FEZ1 limit the density of mitochondria in C. elegans neurons by maintaining the balance of anterograde and retrograde mitochondrial transport. Sci. Rep. 2018;8:8938. doi: 10.1038/s41598-018-27211-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Qu Y, Hahn I, Webb SE, Pearce SP, Prokop A. Periodic actin structures in neuronal axons are required to maintain microtubules. Mol. Biol. Cell. 2017;28:296–308. doi: 10.1091/mbc.E16-10-0727. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Leterrier C, et al. End-binding proteins EB3 and EB1 link microtubules to ankyrin G in the axon initial segment. Proc. Natl Acad. Sci. USA. 2011;108:8826–8831. doi: 10.1073/pnas.1018671108. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Bennett V, Davis J. Erythrocyte ankyrin: immunoreactive analogues are associated with mitotic structures in cultured cells and with microtubules in brain. Proc. Natl Acad. Sci. USA. 1981;78:7550–7554. doi: 10.1073/pnas.78.12.7550. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Torii, T. et al. NuMA1 promotes axon initial segment assembly through inhibition of endocytosis. J. Cell Biol.219, 10.1083/jcb.201907048 (2020). [DOI] [PMC free article] [PubMed]
  • 54.Fernandez P, Pullarkat PA. The role of the cytoskeleton in volume regulation and beading transitions in PC12 neurites. Biophys. J. 2010;99:3571–3579. doi: 10.1016/j.bpj.2010.10.027. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Bar-Ziv R, Tlusty T, Moses E, Safran SA, Bershadsky A. Pearling in cells: a clue to understanding cell shape. Proc. Natl Acad. Sci. USA. 1999;96:10140–10145. doi: 10.1073/pnas.96.18.10140. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Kilinc D, Gallo G, Barbee KA. Mechanical membrane injury induces axonal beading through localized activation of calpain. Exp. Neurol. 2009;219:553–561. doi: 10.1016/j.expneurol.2009.07.014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Datar A, et al. The roles of microtubules and membrane tension in axonal beading, retraction, and atrophy. Biophys. J. 2019;117:880–891. doi: 10.1016/j.bpj.2019.07.046. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Ghosh AS, et al. DLK induces developmental neuronal degeneration via selective regulation of proapoptotic JNK activity. J. Cell Biol. 2011;194:751–764. doi: 10.1083/jcb.201103153. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Kelkar N, Gupta S, Dickens M, Davis RJ. Interaction of a mitogen-activated protein kinase signaling module with the neuronal protein JIP3. Mol. Cell Biol. 2000;20:1030–1043. doi: 10.1128/mcb.20.3.1030-1043.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Kulkarni SS, et al. UNC-16 alters DLK-1 localization and negatively regulates actin and microtubule dynamics in Caenorhabditis elegans regenerating neurons. Genetics. 2021;219:iyab139. doi: 10.1093/genetics/iyab139. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Liu, G. Y. & Sabatini, D. M. mTOR at the nexus of nutrition, growth, ageing and disease. Nat. Rev. Mol. Cell Biol. 10.1038/s41580-019-0199-y (2020). [DOI] [PMC free article] [PubMed]
  • 62.Ferguson SM. Beyond indigestion: emerging roles for lysosome-based signaling in human disease. Curr. Opin. Cell Biol. 2015;35:59–68. doi: 10.1016/j.ceb.2015.04.014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63.Iwasawa S, et al. Recurrent de novo MAPK8IP3 variants cause neurological phenotypes. Ann. Neurol. 2019;85:927–933. doi: 10.1002/ana.25481. [DOI] [PubMed] [Google Scholar]
  • 64.Platzer, K. et al. De Novo Variants in MAPK8IP3 cause intellectual disability with variable brain anomalies. Am. J. Hum. Genet.10.1016/j.ajhg.2018.12.008 (2018). [DOI] [PMC free article] [PubMed]
  • 65.Schindelin J, et al. Fiji: an open-source platform for biological-image analysis. Nat. Methods. 2012;9:676–682. doi: 10.1038/nmeth.2019. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplemental Material (1.6MB, pdf)
42003_2021_2945_MOESM2_ESM.pdf (411KB, pdf)

Description of Additional Supplementary Files

Supplementary Movie 1 (22MB, mov)
Supplementary Data 1 (22.6KB, xlsx)
Reporting Summary (1.9MB, pdf)

Data Availability Statement

All data generated or analyzed during this study are included in this published article (and its Supplementary Information files: Supplementary Material and Supplementary Data 1). Raw datasets generated during and/or analyzed during the current study are available from the corresponding authors on reasonable request.

Custom-written code used to analyse the data in the current study is available from the corresponding authors on reasonable request.


Articles from Communications Biology are provided here courtesy of Nature Publishing Group

RESOURCES