Skip to main content
Genomics & Informatics logoLink to Genomics & Informatics
. 2021 Dec 31;19(4):e45. doi: 10.5808/gi.21055

Characterization of transcription factor genes related to cold tolerance in Brassica napus

Mayur Mukut Murlidhar Sharma 1, Rahul Vasudeo Ramekar 1, Nam-Il Park 2, Ik-Young Choi 1, Seon-Kang Choi 1, Kyong-Cheul Park 1,*
PMCID: PMC8752983  PMID: 35172475

Abstract

Brassica napus is the third most important oilseed crop in the world; however, in Korea, it is greatly affected by cold stress, limiting seed growth and production. Plants have developed specific stress responses that are generally divided into three categories: cold-stress signaling, transcriptional/post-transcriptional regulation, and stress-response mechanisms. Large numbers of functional and regulatory proteins are involved in these processes when triggered by cold stress. Here, our objective was to investigate the different genetic factors involved in the cold-stress responses of B. napus. Consequently, we treated the Korean B. napus cultivar Naehan at the 4-week stage in cold chambers under different conditions, and RNA and cDNA were obtained. An in silico analysis included 80 cold-responsive genes downloaded from the National Center for Biotechnology Information (NCBI) database. Expression levels were assessed by reverse transcription polymerase chain reaction, and 14 cold-triggered genes were identified under cold-stress conditions. The most significant genes encoded zinc-finger proteins (33.7%), followed by MYB transcription factors (7.5%). In the future, we will select genes appropriate for improving the cold tolerance of B. napus.

Keywords: Brassica napus, cold-stress, cold-tolerance, tanscription factors

Introduction

Brassica napus (genome AnAnCnCn) was formed recently by allopolyploidy between ancestors of Brassica oleracea (Mediterranean cabbage, genome CoCo) and Brassica rapa (Asian cabbage or turnip, genome ArAr) and is polyphyletic [1,2]. In natural habitats, plants face stressful conditions, ranging from biotic stresses, including pathogens, insects and weed infestation, and abiotic stresses caused by fluctuations in environmental conditions, like temperature, humidity, and sunlight. Drought, salinity and freezing are major abiotic stresses that cause adverse effects on crop growth and productivity by disturbing the physio-chemical balance in plant cells. Plants modify themselves at the cellular level by regulating different pathways governed by several genes to minimize the harm caused by an elicitor and to protect from further damage [3,4]. Low temperature is a major abiotic stress affecting plant growth in South Korea, where the temperature falls below −15°C in winters. The cold conditions freeze intracellular water, resulting in its movement out of the cell, owing to the potential gradient, which leads to the rupturing of cells, causing prominent damage to plants in the form of leaf wilting and burning, as well as possible plant death [5]. The cold tolerance of a plant is induced in response to low non-freezing temperatures and involves cold acclimation, which requires complex regulatory mechanisms [6]. The cold-tolerance mechanism comprises diverse pathways that involve networks of multiple components, including proteins, such as heat-shock and antioxidative enzymes [7], phytohormones, such as ethylene and abscisic acid [8], and cold-responsive genes, which are indispensable for coding many necessary proteins involved in cellular responses [9]. These components can be manipulated to make the plant resilient against stressful environmental conditions. Despite considerable efforts, traditional breeding approaches have resulted in only modest improvements in abiotic stress tolerance because much of the required genetic variation has been lost during domestication and modern breeding-associated selection [10,11]. Additionally, abiotic stress resistance, as a polygenic trait, is governed by complex genetic networks that make it difficult for the breeders to converge the polygenes in a single plant system [12]. Another alternative to conventional breeding is marker-assisted selection, which uses molecular markers in association and linkage mapping. From the association or linkage maps, quantitative trait loci associated with agronomic traits may be identified and used for gene pyramiding or recurrent parent genome analyses [1315]. Marker-assisted selection has been successfully exploited to confer cold-stress resistance in B. napus [16]. Recently, molecular, biological, and physiological studies investigating cellular responses in plants to abiotic stress have progressed significantly. The genetic factors behind these phenomena have been largely uncovered. The cloning and overexpression of these factors through biotechnological approaches, as well as genome editing, have resulted in conferring cold-resistance to plants [17,18]. Knowledge of the molecular basis of freezing tolerance will help develop tools that can effectively increasing the freezing tolerance of plants. Recently, several different gene transfer approaches to improve plant-stress tolerance, such as tissue electroporation [19], microinjection [20] and particle bombardment [21], have been employed. The transferred genes included those encoding enzymes required for the biosynthesis of various osmoprotectants that are responsible for protecting plant cells from damage under stress conditions [22].

When a plant is subjected to abiotic stresses, an assortment of genes having diverse functions are induced, or repressed, to synthesize key proteins and enzymes to protect the plant. These proteins may be categorized into two groups. The first group includes functional proteins, such as late embryogenesis abundant proteins, antifreeze proteins, molecular chaperones, key enzymes for osmolyte biosynthesis, like proline, sugar and sugar alcohols, betaines, detoxification enzymes, water-channel proteins and membrane transporters, which are directly associated with protecting plants from the ill effects of abiotic stresses. The second group includes regulatory proteins that control signal transduction and stress-responsive gene expression. These include various transcription factors, protein kinases, enzymes involved in phospholipid metabolism, and other signaling molecules, such as calmodulin-binding protein and 14-3-3 protein [23]. Analyzing and elucidating the functions of these genes are critical for further understanding the molecular mechanisms governing plant abiotic stress tolerance and may help in the genetic manipulation of crops for enhanced stress tolerance [24]. Previous studies have focused on targeting both the regulatory and functional genes involved in cold-stress tolerance [25,26]. Among these genes, protein kinases [27] heat-shock proteins [28], late embryogenesis abundant proteins [29] and genes encoding transcription factors appear to be most useful in improving stress tolerance in plants [23].

Transcription factors act as trans-acting elements through their specific binding to cis-acting elements in the promoters of target genes, and this allows them to play central roles in regulating the expression of downstream genes [30]. Therefore, the study of different genes having regulatory and functional roles is important for understanding the mechanisms involved in regulating stress responses as well as to fully elucidate the mechanisms of tolerance against abiotic stress. [31]. The objectives of this study in B. napus were as follows: () to perform a comprehensive analysis of cold-related genetic factors; and (2) to form a shortlist of suitable candidate genetic factors that can be used for enhancing cold tolerance. The workflow of this study is depicted in Supplementary Fig. 1.

Methods

Plant material, growth conditions and cold treatment.

A cold-tolerant cultivar, Naehan, was used in our study. Brassica napus seeds were sterilized, sown on Murashige-Skoog medium and incubated in an illuminated incubation chamber with a 16-h/8-h (light/dark) photoperiod, a photonflux density of 200 μmol m-2s-1 and a relative humidity of 70% at 25°C for 7 days. The seedlings were then planted in soil and grown at 25/22°C (day/night) with a 16-h/8-h (light/dark) photoperiod, a photonflux density range of 500–600 μmol m-2 s-1 and a relative humidity range of 60%–70% in a greenhouse. To investigate the cold-induced regulatory proteins, plants at the three-leaf stage were given different cold treatments, 10, 6, 3, 0, −3 and −6°C, for 8 h and randomly selected for sampling. A room temperature treatment served as the control.

RNA isolation and cDNA synthesis

Leaf tissue was placed in a mortar containing liquid nitrogen and homogenized with a pestle. Approximately 100 mg of the powder was transferred to a 1.5-µL microtube. Total RNA was isolated using a Ribospin Plant RNA isolation kit (Geneall Biotechnology Co. Ltd., Seoul, Korea) as per the protocol provided by the manufacturer. RNA integrity was determined by the RNA Integrity Number, which was calculated using an Agilent 2100 Bioanalyzer (Agilent Technologies Korea Ltd., Seoul, Korea). The samples with RNA Integrity Number values greater than eight were selected for further analysis. Using total RNA as the template, cDNAs were synthesized using Geneall 2X HyperScript reverse transcription polymerase chain reaction (RT-PCR) master mix with oligo dT (Geneall Biotechnology Co. Ltd.) as per the protocol provided by the manufacturer. Reaction details for the RT-PCR are as follows: Preheating of total RNA at 65°C for 5 min followed by heating the reaction mixture to 55°C for 60 min and 95°C for 5 min.

In silico analysis and primer designing

The nucleotide sequences of 80 cold-related genes were downloaded from the NCBI database (https://www.ncbi.nlm.nih.gov). These genes encoded different necessary proteins. Gene-specific primers were designed for the 80 genes using Primer 3 software. (https://bioinfo.ut.ee/primer3-0.4.0/).

Validation of gene-specific primers

Here, the B. napus actin gene was used as an internal reference. Gene-specific primers were validated by performing general PCR using cDNA as the template. The PCR reaction components were 10× buffer, dNTPs (0.5 mm), forward primer (10 pm), reverse primer (10 pm), DNA template (20 ng), and Taq polymerase (0.025 units). The PCR reaction was as follows: 95°C for 10 min and 40 cycles of 95°C for 5 s, 56°C for 15 s and 72°C for 30 s. The PCR products were screened using agarose gel electrophoresis.

Results

Data extraction and in silico identification of annotated cold-related genes

A total of 919 functionally annotated cold-related genes, including both regulatory and functional genes belonging to diverse families, were retrieved from the NCBI database. Among these genes, those having regulatory functions were identified and listed according to their families. A total of 80 genes were found (Supplementary Table 1) with zinc-finger protein genes making up the highest percentage (33.7%), followed by myeloblastosis transcription factors (MYB) (7.5%). Other genes included TCP transcription factors, basic leucine zipper domain-containing transcription factors and those encoding stress-related proteins (58.7%) (Fig. 1). Among the zinc-finger proteins, seven contained the C3HC4 domain and three each contained C2H2 or the B-box. Other members, such as WRKY, GATA, GRAS, NAC, and E2F/dimerization partner A were each represented by a solitary member in our data.

Fig. 1.

Fig. 1.

Numbers of cold-responsive genes belonging to different families in our data.

Expression profiling of genes by RT-PCR

To assess the mRNA transcript levels of the cold-responsive transcription factor genes, RT-PCR was performed using an endogenous gene (actin) as an internal standard for 80 genes (Supplementary Fig. 2). On the basis of gel-electrophoresis results, the proper amplified genes were sorted for the selection of candidate genes. The genes were sorted by band intensity, followed by RT-PCR. In total, 14 genes (Table 1) showing differential gene expression levels corresponding to the decrease in temperature were selected. The expression levels of group members were high as compared to the other candidate genes after the temperature decrease.

Table 1.

Identified candidate cold-responsive genes based on RT-PCR

Gene category No. of genes
Zinc-finger protein 8
MYB transcription factor 2
Membrane protein 1
KANADI transcription factor 1
Stress-related protein 1
Dimerization partner A transcription factor 1
Total 14

RT-PCR, reverse transcription polymerase chain reaction.

Assortment of candidate genes

The total sorted 14 genes encoded diverse proteins, including zinc fingers (8), MYB transcription factors (2), membrane protein (1), KANADI transcription factor (1), stress-related protein (1), and dimerization partner A transcription factor (1). Details on the primers for these 14 genes are described in Table 2. The first category includes the genes encoding zinc-finger proteins, including EV189678 (zinc-finger [MYND type] family protein), EV192654 (zinc-finger protein), EV192647 (zinc-finger [B-box type] family protein), CB686176 (zinc-finger [AN1-like] family protein), EV198845 (zinc-finger [B-box type] family protein), and EV197045 (zinc-finger family protein). The proteins EV199365 and EV196553, encoded by two additional zinc-finger genes, showed weak expression levels at the control temperature compared with at lower temperatures, as shown in Fig. 2A relative to the expression of the actin housekeeping gene. The second category of promising regulatory genes includes MYB transcription factors (Fig. 2B). EV190420 and EV196127 (MYB family transcription factor), and the expression levels of the genes encoding these proteins increased as the temperature decreased.

Table 2.

Primer details for 14 Brassica napus candidate cold-responsive genes

No. Gene ID Gene description Primer sequence (F & R) Primer length Tm (℃)
1 EV189678 Zinc finger protein F: GATCACATGCAAGAGACTGAAT 22 51
R: ATTTGAGAGAGAGGTAAGAGCG 22 53
2 EV192647 Zinc finger protein F: GTCCGAAAGTTTGGCTAATG 20 50
R: GTTCCCACAGATTCTTTTAAGC 22 51
3 EV197045 Zinc finger protein F: CATCAACGGTAGATCCAGATG 21 52
R: TCATACTGTGGGTCTCTGTCTC 22 55
4 EV192654 Zinc finger protein F: TTAGTTCACCGAGATTAGCTTCG 23 60
R: GAGAACTCTGGTATCGGAGGAAT 23 60
5 CB686176 Zinc finger protein F: TGAATCTCTGCTCCAACTGCTA 22 60
R: GGTGAATGAAAACTGTCTCAACC 23 59
6 EV198845 Zinc finger protein F: AATGTTCTGTGAGTCAGACCAG 20 60
R: TCATCATCGGAGTTAAGTTCTG 20 60
7 EV199365 Zinc finger protein F: ATTGCACTCAATTTGTTAGCC 22 60
R: TGCCATATCCACAAGTCATAAT 23 60
8 EV196553 Zinc finger protein F: CTTACGTGATTGTGAGTTTTCC 22 53
R: GTTAGAGGCGGTAAGAGAAGAG 22 51
9 EV190420 MYB trancription factor F: TCTCTCTCTCTCTCTCTTCGCT 20 52
R: TTCTTAGTGTTCCCTCCTTCAT 22 53
10 EV196127 MYB trancription factor F: ACACTTCTCCAGCTACGTCCA 21 60
R: TGTCTCTCAGGACTCCAGCAT 21 60
11 EV198916 Stress-related protein F: AAATTGATCACCGAGTTCTTCT 22 49
R: AAGCAGAATAATGGAACAAGGT 22 49
12 EV203394 Membrane protein F: ACTTTTAGATTTTGAGCGGTCT 22 49
R: CAATGACCATAAAAGCTATGGA 22 49
13 EV190408 KANADI F: AATGGTAGCTGCGGTACG 18 50
R: TGATTGTGGTGATTAGGGTAAA 22 49
14 EV200969 DPA transcription factor F: GAGAGAAGAGAGGATGGAGATG 22 55
R: GCATGAGGATTTGTCTCAAGTA 22 51

Fig. 2.

Fig. 2.

Expression levels of cold-responsive zinc finger protein genes and MYB transcription factor genes at control and lower temperatures as assessed by reverse transcription polymerase chain reaction in Brassica napus cv. Naehan subjected to low temperatures. (A) Zinc-finger genes. Reference gene actin (upper), EV199365 (zinc-finger family protein) (middle), EV196553 (zinc-finger family protein) (lower). (B) MYB transcription factors. Reference gene actin (upper), EV190420 (MYB transcription factor) (middle), EV196127 (MYB transcription factor) (lower).

Discussion

Transcription factors are necessary elements for conducting the central dogma of life, and they affect the transcription levels of genes [32]. In total, 8%–10% of a plant genome is translated into transcription factors [33]. Information on regulatory proteins provides us the opportunity to manipulate plant responses to external factors at the regulatory level, such as improving cold tolerance in B. napus. The increased availability of proper cold-responsive regulatory protein–encoding genes provides us with the more options and opportunities to investigate those that may be candidates for improving cold tolerance in B. napus. Among them, the dehydration-responsive element-binding protein (DREB) transcription factors from the ethylene response factor family have gained much attention owing to their involvement in the regulation of many stress-related genes that play important roles in the cascading responses to environmental stimuli [34]. They have significant roles in the tolerance to cold stress in B. napus [35]. Here, different regulatory factors belonging to different families related to cold-stress response were identified. Among the transcription factors, the MYB members were the most abundant. Different members of the MYB transcription factor family also bind to specific cis sites of cold-responsive genes to induce their expression, and they help stabilize plant cells under stress conditions through a complex of cold tolerance- and cold acclimation-related pathways. MYB transcription factor family members are actively involved in important regulatory roles in responses, and tolerance levels, to other abiotic stresses, such as salinity [13] and drought [13]. The widespread members of the MYB family have diverse roles in multiple pathways that are indispensable to plant growth and development and to plant adaptation to various environmental conditions. Our study investigated MYB transcription factors, many of which did not show expression at the control temperature but increased increasing their expression level as the temperature decreased. An R2R3-MYB protein has been reported as being involved in the biosynthesis of proanthocyanidin, which is required for seed coloring in B. napus [36]. Glucosinolate (GSL) is a well-known secondary metabolite in the Brassicacea family, and its synthesis in Arabidopsis thaliana is governed by a member of MYB transcription factor family. However, owing to the complexity of the genome, GSL biosynthesis has not been studied extensively in other Brassica species [37]. Few genome-wide association and transcriptome analyses in B .napus have shown MYB transcription factor roles in modulating reactive oxygen species [38] and regulating salt-stress tolerance [39]. Here, the largest number of transcription factors belonged to the zinc-finger family, and these members play multiple roles in plant growth and development. In our study, the identified 14 cold-responsive factor genes from different families contained mainly zinc-finger proteins, followed by MYB transcription factors. These genes had regulatory roles in the several pathways responsible for cold acclimation, as well as in protecting the plant cell against cold stress by conferring cold tolerance. Zinc-finger transcription factors are crucial in many plant regulatory pathways as well as in pathways involved in tolerance to various abiotic stresses. In Arabidopsis, the regulation of cadmium tolerance by a zinc finger of A. thaliana 6 (ZAT6) has been reported [40]. In a study conducted by Kim et al. [41], a zinc-finger transcription factor Capsicum annuum zinc finger protein 1 (CAZFP1) was found to be induced in defense against pathogens and under drought-stress conditions. Brassica rapa Ring zinc finger protein 1 (BrRZFP1) is involved in responses to multiple abiotic stresses in B. rapa [42]. The overexpression of zinc-finger genes, such as Oryza sativa indica stress-associated protein 8 (OsiSAP8) [43], O. sativa cold-inducible (OsCOIN) [44], O. sativa dehydration-responsive element-binding protein 1 (OsDREB1) [30], reactive oxygen species-basic leucine zipper (ROS-bZIP) [45], SNAC2 [46], and OsNAC6 [47], confer cold-stress tolerance at the seedling stage in rice. The members of the zinc-finger family are involved in different regulatory roles in the life processes of different plants. In B. napus, a particular classes of zinc-finger protein‒encoding genes having B-box, AN1 and MYND domains were found. The AN1 domain-containing zinc-finger proteins are involved in immune responses in humans [48], and recently, they have been found to play roles in combating multiple abiotic stresses in plants [49]. In a genome-wide identification conducted by [50] in B. napus, the AN1 proteins were induced by different kinds of stress, including cold stress. Another class of zinc-finger proteins is the B-box proteins. B-box proteins play multiple roles in different plants. In Arabidopsis, they are found in abundance and linked to circadian-associated events [51]. In apples, a B-box protein, Malus domestica B-box 20 (MdBBX20) is involved in anthocyanin accumulation in the epicarp [52]. Their involvement in the regulation of abiotic stresses has been determined. In Arabidopsis, they are induced in response to a cold environment and enhance the plant’s tolerance to cold conditions [53]. The role of the gene B. napus cold-regulated 25 (BnCOR25) in conferring cold tolerance to B. napus has been confirmed by its overexpression in Arabidopsis and yeast [54].

Acknowledgments

This study was supported by 2017 Research Grant from Kangwon National National University (No. 520170532) and Basic Science Research Program through the National Research Foundation of Korea(NRF-2017R1D1A3B03035902) funded by the Ministry of Education.

Footnotes

Authors’ Contribution

Conceptualization: KCP. Data curation: MMMS, IYC. Formal analysis: NIP, SKC. Funding acquisition: KCP. Methodology: MMMS, KCP. Writing - original draft: MMMS. Writing - review & editing: MMMS, RVR, KCP.

Conflicts of Interest

No potential conflict of interest relevant to this article was reported.

Supplementary Materials

Supplementary data can be found with this article online at http://www.genominfo.org.

Supplementary Table 1.

Total numbers of cold-related genes identified in our data

gi-21055suppl1.pdf (51.9KB, pdf)
Supplementary Fig. 1.

A representation of the workflow covering the hierarchical information in this study.

gi-21055suppl2.pdf (63.3KB, pdf)
Supplementary Fig. 2.

Expression profiling of all the candidate cold-related genes identified in our data.

gi-21055suppl3.pdf (712.4KB, pdf)

References

  • 1.Chalhoub B, Denoeud F, Liu S, Parkin IA, Tang H, Wang X, et al. Plant genetics. Early allopolyploid evolution in the post-Neolithic Brassica napus oilseed genome. Science. 2014;345:950–953. doi: 10.1126/science.1253435. [DOI] [PubMed] [Google Scholar]
  • 2.Allender CJ, King GJ. Origins of the amphiploid species Brassica napus L. investigated by chloroplast and nuclear molecular markers. BMC Plant Biol. 2010;10:54. doi: 10.1186/1471-2229-10-54. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Ding Y, Shi Y, Yang S. Advances and challenges in uncovering cold tolerance regulatory mechanisms in plants. New Phytol. 2019;222:1690–1704. doi: 10.1111/nph.15696. [DOI] [PubMed] [Google Scholar]
  • 4.Mahajan S, Tuteja N. Cold, salinity and drought stresses: an overview. Arch Biochem Biophys. 2005;444:139–158. doi: 10.1016/j.abb.2005.10.018. [DOI] [PubMed] [Google Scholar]
  • 5.Wei C, Huang J, Wang X, Blackburn GA, Zhang Y, Wang S, et al. Hyperspectral characterization of freezing injury and its biochemical impacts in oilseed rape leaves. Remote Sens Environ. 2017;195:56–66. [Google Scholar]
  • 6.Thomashow MF. Molecular basis of plant cold acclimation: insights gained from studying the CBF cold response pathway. Plant Physiol. 2010;154:571–577. doi: 10.1104/pp.110.161794. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Cui S, Huang F, Wang J, Ma X, Cheng Y, Liu J. A proteomic analysis of cold stress responses in rice seedlings. Proteomics. 2005;5:3162–3172. doi: 10.1002/pmic.200401148. [DOI] [PubMed] [Google Scholar]
  • 8.Gusta LV, Fowler DB, Tyler NJ. The effect of abscisic acid and cytokinins on the cold hardiness of winter wheat. Can J Bot. 1982;60:301–305. [Google Scholar]
  • 9.Takumi S, Koike A, Nakata M, Kume S, Ohno R, Nakamura C. Cold-specific and light-stimulated expression of a wheat (Triticum aestivum L.) Cor gene Wcor15 encoding a chloroplast-targeted protein. J Exp Bot. 2003;54:2265–2274. doi: 10.1093/jxb/erg247. [DOI] [PubMed] [Google Scholar]
  • 10.Ashraf M, O'leary JW. Responses of some newly developed salt‐tolerant genotypes of spring wheat to salt stress: 1. Yield components and ion distribution. J Agron Crop Sci. 1996;176:91–101. [Google Scholar]
  • 11.Tester M, Bacic A. Abiotic stress tolerance in grasses. From model plants to crop plants. Plant Physiol. 2005;137:791–793. doi: 10.1104/pp.104.900138. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Humphreys MO, Humphreys MW. In: Abiotic Stresses: Plant Resistance through Breeding and Molecular Approaches. Ashraf M, Harris PJC, editors. New York: Haworth Press; 2005. Breeding for stress resistance: general principles; pp. 19–46. [Google Scholar]
  • 13.Huang Z, Zhao N, Qin M, Xu A. Mapping of quantitative trait loci related to cold resistance in Brassica napus L. J Plant Physiol. 2018;231:147–154. doi: 10.1016/j.jplph.2018.09.012. [DOI] [PubMed] [Google Scholar]
  • 14.Knoll J, Ejeta G. Marker-assisted selection for early-season cold tolerance in sorghum: QTL validation across populations and environments. Theor Appl Genet. 2008;116:541–553. doi: 10.1007/s00122-007-0689-8. [DOI] [PubMed] [Google Scholar]
  • 15.Shinada H, Iwata N, Sato T, Fujino K. QTL pyramiding for improving of cold tolerance at fertilization stage in rice. Breed Sci. 2014;63:483–488. doi: 10.1270/jsbbs.63.483. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Spasibionek S, Mikolajczyk K, Cwiek-Kupczynska H, Pietka T, Krotka K, Matuszczak M, et al. Marker assisted selection of new high oleic and low linolenic winter oilseed rape (Brassica napus L.) inbred lines revealing good agricultural value. PLoS One. 2020;15:e0233959. doi: 10.1371/journal.pone.0233959. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Nguyen HC, Lin KH, Ho SL, Chiang CM, Yang CM. Enhancing the abiotic stress tolerance of plants: from chemical treatment to biotechnological approaches. Physiol Plant. 2018;164:452–466. doi: 10.1111/ppl.12812. [DOI] [PubMed] [Google Scholar]
  • 18.Debbarma J, Sarki YN, Saikia B, Boruah HPD, Singha DL, Chikkaputtaiah C. Ethylene response factor (ERF) family proteins in abiotic stresses and CRISPR-Cas9 genome editing of ERFs for multiple abiotic stress tolerance in crop plants: a review. Mol Biotechnol. 2019;61:153–172. doi: 10.1007/s12033-018-0144-x. [DOI] [PubMed] [Google Scholar]
  • 19.Sorokin AP, Ke X, Chen D, Elliott MC. Production of fertile transgenic wheat plants via tissue electroporation. Plant Sci. 2000;156:227–233. doi: 10.1016/s0168-9452(00)00260-0. [DOI] [PubMed] [Google Scholar]
  • 20.Holm PB, Olsen O, Schnorf M, Brinch-Pedersen H, Knudsen S. Transformation of barley by microinjection into isolated zygote protoplasts. Transgenic Res. 2000;9:21–32. doi: 10.1023/a:1008974729597. [DOI] [PubMed] [Google Scholar]
  • 21.Purkayastha J, Sugla T, Paul A, Solleti SK, Mazumdar P, Basu A, et al. Efficient in vitro plant regeneration from shoot apices and gene transfer by particle bombardment in Jatropha curcas. Biol Plant. 2010;54:13–20. [Google Scholar]
  • 22.Djilianov D, Georgieva T, Moyankova D, Atanassov A, Shinozaki K, Smeeken SC, et al. Improved abiotic stress tolerance in plants by accumulation of osmoprotectants: gene transfer approach. Biotechnol Biotechnol Equip. 2005;19:63–71. [Google Scholar]
  • 23.Yadav SK. Cold stress tolerance mechanisms in plants: a review. Agron Sustain Dev. 2010;30:515–527. [Google Scholar]
  • 24.Lata C, Prasad M. Role of DREBs in regulation of abiotic stress responses in plants. J Exp Bot. 2011;62:4731–4748. doi: 10.1093/jxb/err210. [DOI] [PubMed] [Google Scholar]
  • 25.Wang Y, Qiu L, Xie W, Huang W, Ye F, Zhang F, et al. Cold tolerance of transgenic tobacco carrying gene encoding insect antifreeze protein. Acta Agron Sin. 2008;34:397. [Google Scholar]
  • 26.Tang Y, Liu K, Zhang J, Li X, Xu K, Zhang Y, et al. JcDREB2, a physic nut AP2/ERF gene, alters plant growth and salinity stress responses in transgenic rice. Front Plant Sci. 2017;8:306. doi: 10.3389/fpls.2017.00306. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Chen J, Xue B, Xia X, Yin W. A novel calcium-dependent protein kinase gene from Populus euphratica, confers both drought and cold stress tolerance. Biochem Biophys Res Commun. 2013;441:630–636. doi: 10.1016/j.bbrc.2013.10.103. [DOI] [PubMed] [Google Scholar]
  • 28.Zhang L, Hu W, Gao Y, Pan H, Zhang Q. A cytosolic class II small heat shock protein, PfHSP17.2, confers resistance to heat, cold, and salt stresses in transgenic Arabidopsis. Genet Mol Biol. 2018;41:649–660. doi: 10.1590/1678-4685-GMB-2017-0206. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Xu M, Tong Q, Wang Y, Wang Z, Xu G, Elias GK, et al. Transcriptomic analysis of the grapevine LEA gene family in response to osmotic and cold stress reveals a key role for VamDHN3. Plant Cell Physiol. 2020;61:775–786. doi: 10.1093/pcp/pcaa004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Ito Y, Katsura K, Maruyama K, Taji T, Kobayashi M, Seki M, et al. Functional analysis of rice DREB1/CBF-type transcription factors involved in cold-responsive gene expression in transgenic rice. Plant Cell Physiol. 2006;47:141–153. doi: 10.1093/pcp/pci230. [DOI] [PubMed] [Google Scholar]
  • 31.Lee SC, Lim MH, Kim JA, Lee SI, Kim JS, Jin M, et al. Transcriptome analysis in Brassica rapa under the abiotic stresses using Brassica 24K oligo microarray. Mol Cells. 2008;26:595–605. [PubMed] [Google Scholar]
  • 32.Latchman DS. Transcription factors: an overview. Int J Biochem Cell Biol. 1997;29:1305–1312. doi: 10.1016/s1357-2725(97)00085-x. [DOI] [PubMed] [Google Scholar]
  • 33.Franco-Zorrilla JM, Lopez-Vidriero I, Carrasco JL, Godoy M, Vera P, Solano R. DNA-binding specificities of plant transcription factors and their potential to define target genes. Proc Natl Acad Sci U S A. 2014;111:2367–2372. doi: 10.1073/pnas.1316278111. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Khan MS. The role of DREB transcription factors in abiotic stress tolerance of plants. Biotechnol Biotechnol Equip. 2011;25:2433–2442. [Google Scholar]
  • 35.Gao MJ, Allard G, Byass L, Flanagan AM, Singh J. Regulation and characterization of four CBF transcription factors from Brassica napus. Plant Mol Biol. 2002;49:459–471. doi: 10.1023/a:1015570308704. [DOI] [PubMed] [Google Scholar]
  • 36.Wei YL, Li JN, Lu J, Tang ZL, Pu DC, Chai YR. Molecular cloning of Brassica napus TRANSPARENT TESTA 2 gene family encoding potential MYB regulatory proteins of proanthocyanidin biosynthesis. Mol Biol Rep. 2007;34:105–120. doi: 10.1007/s11033-006-9024-8. [DOI] [PubMed] [Google Scholar]
  • 37.Seo MS, Kim JS. Understanding of MYB transcription factors involved in glucosinolate biosynthesis in Brassicaceae. Molecules. 2017;22:1549. doi: 10.3390/molecules22091549. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Chen B, Niu F, Liu WZ, Yang B, Zhang J, Ma J, et al. Identification, cloning and characterization of R2R3-MYB gene family in canola (Brassica napus L.) identify a novel member modulating ROS accumulation and hypersensitive-like cell death. DNA Res. 2016;23:101–114. doi: 10.1093/dnares/dsv040. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Hajiebrahimi A, Owji H, Hemmati S. Genome-wide identification, functional prediction, and evolutionary analysis of the R2R3-MYB superfamily in Brassica napus. Genome. 2017;60:797–814. doi: 10.1139/gen-2017-0059. [DOI] [PubMed] [Google Scholar]
  • 40.Chen J, Yang L, Yan X, Liu Y, Wang R, Fan T, et al. Zinc-finger transcription factor ZAT6 positively regulates cadmium tolerance through the glutathione-dependent Pathway in Arabidopsis. Plant Physiol. 2016;171:707–719. doi: 10.1104/pp.15.01882. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Kim SH, Hong JK, Lee SC, Sohn KH, Jung HW, Hwang BK. CAZFP1, Cys2/His2-type zinc-finger transcription factor gene functions as a pathogen-induced early-defense gene in Capsicum annuum. Plant Mol Biol. 2004;55:883–904. doi: 10.1007/s11103-004-2151-5. [DOI] [PubMed] [Google Scholar]
  • 42.Jung YJ, Lee IH, Nou IS, Lee KD, Rashotte AM, Kang KK. BrRZFP1 a Brassica rapa C3HC4-type RING zinc finger protein involved in cold, salt and dehydration stress. Plant Biol (Stuttg) 2013;15:274–283. doi: 10.1111/j.1438-8677.2012.00631.x. [DOI] [PubMed] [Google Scholar]
  • 43.Kanneganti V, Gupta AK. Overexpression of OsiSAP8, a member of stress associated protein (SAP) gene family of rice confers tolerance to salt, drought and cold stress in transgenic tobacco and rice. Plant Mol Biol. 2008;66:445–462. doi: 10.1007/s11103-007-9284-2. [DOI] [PubMed] [Google Scholar]
  • 44.Liu K, Wang L, Xu Y, Chen N, Ma Q, Li F, et al. Overexpression of OsCOIN, a putative cold inducible zinc finger protein, increased tolerance to chilling, salt and drought, and enhanced proline level in rice. Planta. 2007;226:1007–1016. doi: 10.1007/s00425-007-0548-5. [DOI] [PubMed] [Google Scholar]
  • 45.Cheng C, Yun KY, Ressom HW, Mohanty B, Bajic VB, Jia Y, et al. An early response regulatory cluster induced by low temperature and hydrogen peroxide in seedlings of chilling-tolerant japonica rice. BMC Genomics. 2007;8:175. doi: 10.1186/1471-2164-8-175. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Hu H, You J, Fang Y, Zhu X, Qi Z, Xiong L. Characterization of transcription factor gene SNAC2 conferring cold and salt tolerance in rice. Plant Mol Biol. 2008;67:169–181. doi: 10.1007/s11103-008-9309-5. [DOI] [PubMed] [Google Scholar]
  • 47.Nakashima K, Tran LS, Van Nguyen D, Fujita M, Maruyama K, Todaka D, et al. Functional analysis of a NAC-type transcription factor OsNAC6 involved in abiotic and biotic stress-responsive gene expression in rice. Plant J. 2007;51:617–630. doi: 10.1111/j.1365-313X.2007.03168.x. [DOI] [PubMed] [Google Scholar]
  • 48.Dixit VM, Green S, Sarma V, Holzman LB, Wolf FW, O'Rourke K, et al. Tumor necrosis factor-alpha induction of novel gene products in human endothelial cells including a macrophage-specific chemotaxin. J Biol Chem. 1990;265:2973–2978. [PubMed] [Google Scholar]
  • 49.Mukhopadhyay A, Vij S, Tyagi AK. Overexpression of a zinc-finger protein gene from rice confers tolerance to cold, dehydration, and salt stress in transgenic tobacco. Proc Natl Acad Sci U S A. 2004;101:6309–6314. doi: 10.1073/pnas.0401572101. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.He X, Xie S, Xie P, Yao M, Liu W, Qin L, et al. Genome-wide identification of stress-associated proteins (SAP) with A20/AN1 zinc finger domains associated with abiotic stresses responses in Brassica napus. Environ Exp Bot. 2019;165:108–119. [Google Scholar]
  • 51.Huang J, Zhao X, Weng X, Wang L, Xie W. The rice B-box zinc finger gene family: genomic identification, characterization, expression profiling and diurnal analysis. PLoS One. 2012;7:e48242. doi: 10.1371/journal.pone.0048242. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Fang H, Dong Y, Yue X, Hu J, Jiang S, Xu H, et al. The B-box zinc finger protein MdBBX20 integrates anthocyanin accumulation in response to ultraviolet radiation and low temperature. Plant Cell Environ. 2019;42:2090–2104. doi: 10.1111/pce.13552. [DOI] [PubMed] [Google Scholar]
  • 53.Takuhara Y, Kobayashi M, Suzuki S. Low-temperature-induced transcription factors in grapevine enhance cold tolerance in transgenic Arabidopsis plants. J Plant Physiol. 2011;168:967–975. doi: 10.1016/j.jplph.2010.11.008. [DOI] [PubMed] [Google Scholar]
  • 54.Chen L, Zhong H, Ren F, Guo QQ, Hu XP, Li XB. A novel cold-regulated gene, COR25, of Brassica napus is involved in plant response and tolerance to cold stress. Plant Cell Rep. 2011;30:463–471. doi: 10.1007/s00299-010-0952-3. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Table 1.

Total numbers of cold-related genes identified in our data

gi-21055suppl1.pdf (51.9KB, pdf)
Supplementary Fig. 1.

A representation of the workflow covering the hierarchical information in this study.

gi-21055suppl2.pdf (63.3KB, pdf)
Supplementary Fig. 2.

Expression profiling of all the candidate cold-related genes identified in our data.

gi-21055suppl3.pdf (712.4KB, pdf)

Articles from Genomics & Informatics are provided here courtesy of BMC

RESOURCES