Skip to main content
PLOS One logoLink to PLOS One
. 2022 Jan 13;17(1):e0262551. doi: 10.1371/journal.pone.0262551

Proteomics-based screening and antibiotic resistance assessment of clinical and sub-clinical Brucella species: An evolution of brucellosis infection control

Ayman Elbehiry 1,2,*, Musaad Aldubaib 3, Osamah Al Rugaie 4, Eman Marzouk 1, Marwan Abaalkhail 5, Ihab Moussa 6,7,*, Mohamed H El-Husseiny 8, Adil Abalkhail 1, Mohammed Rawway 9,10
Editor: Abdelazeem Mohamed Algammal11
PMCID: PMC8757992  PMID: 35025975

Abstract

Brucellae are intracellular sneaky bacteria and they can elude the host’s defensive mechanisms, resulting in therapeutic failure. Therefore, the goal of this investigation was to rapid identification of Brucella species collected from animals and humans in Saudi Arabia, as well as to evaluate their resistance to antibiotics. On selective media, 364 animal samples as well as 70 human blood samples were cultured. Serological and biochemical approaches were initially used to identify a total of 25 probable cultured isolates. The proteomics of Brucella species were identified using the MALDI Biotyper (MBT) system, which was subsequently verified using real-time polymerase chain reaction (real-time PCR) and microfluidic electrophoresis assays. Both Brucella melitensis (B. melitensis) and Brucella abortus (B. abortus) were tested for antimicrobial susceptibility using Kirby Bauer method and the E-test. In total, 25 samples were positive for Brucella and included 11 B. melitensis and 14 B. abortus isolates. Twenty-two out of 25 (88%) and 24/25 (96%) of Brucella strains were recognized through the Vitek 2 Compact system. While MBT was magnificently identified 100% of the strains at the species level with a score value more than or equal to 2.00. Trimethoprim-sulfamethoxazole, rifampin, ampicillin-sulbactam, and ampicillin resistance in B. melitensis was 36.36%, 31.82%, 27.27%, and 22.70%, respectively. Rifampin, trimethoprim-sulfamethoxazole, ampicillin, and ampicillin-sulbactam resistance was found in 35.71%, 32.14%, 32.14%, and 28.57% of B. abortus isolates, correspondingly. MBT confirmed by microfluidic electrophoresis is a successful approach for identifying Brucella species at the species level. The resistance of B. melitensis and B. abortus to various antibiotics should be investigated in future studies.

Introduction

Brucellosis is a prevalent zoonotic disease that continues to be community health obstacles around the world [1]. Brucellosis has remained endemic in many parts of the Universe till now, with an estimated 500 thousand new cases each year [2, 3]. Brucella is an intracellular gram-negative bacterium that harms a variety of domesticated animals, comprising cattle, sheep, goats, and camels [4, 5]. B. melitensis, which was first isolated from sheep, goats, and camels; B. abortus of cows; Brucella suis (B. suis) of pigs; and Brucella canis (B. canis) of canines are all virulent to humans [4].

Different species of Brucella are known to have varying degrees of pathogenicity. B. melitensis is one of the most prevalent aggressive and pathogenic species of Brucella, causing the most serious sickness [6]. B. abortus, on the other hand, is the least pathogenic species and causes the sickness to be mild. As a result, B. melitensis is often regarded as the primary cause of brucellosis in humans around the world. Despite being under control in several affluent nations, the disease stills prevalent in the Kingdom of Saudi Arabia, where the disease has a nationwide sero-prevalence of about 15% [7]. This disease is brought into Saudi Arabia via the unrestricted importation of various animals that have not been thoroughly checked for the disease [7, 8].

Nevertheless, isolation of Brucella from various cultures and identification by traditional techniques are considered the standard methods for identification brucellosis in both humans and different animal species, these methods remains unsafe, laborious, and expensive [9, 10]. Several serological screening tests such as Rose Bengal Plate Test (RBPT), Serum Agglutination Test (SAT), Enzyme Linked Immunosorbent Assay (ELISA) and Complement Fixation Test (CFT) are still applied for the recognition of Brucella antibodies [11]. The World Health Organization (OIE) stated that the CFT is the most widely accepted test in the world [12]. However, this test has many disadvantages such as time-consuming and hard to standardize [13]. The above mentioned tests did not have the ability to differentiate between antibodies which have been formed following vaccination and those resulted after infection [14].

Molecular diagnostic techniques are also crucial tools in the detection of Brucellosis. Conventional PCR techniques using primers such as 16S rRNA [15], the 16S-23S intergenic spacer region [16], omp2 [17] and bcsp31 [18], have been well-known for discovery of Brucellae gene sequences. These techniques were improved for detection of Brucellae in various biomedical samples. Leyla et al. [19] confirmed that standard PCR is considered a respectable method to identify DNA of Brucella species isolated from clinical samples, however, Romero and coworkers established that PCR had minor accuracy than the other traditional tools [20].

Although genetic analyses are still used as truthful methods for diagnosis of various types of microorganisms, their application is time consuming, and their cost may be relatively high. Because brucellosis represents one of major laboratory-acquired diseases [21], the fast recognition of Brucella species is essential to protect the handlers of microbiology laboratories [22]. Moreover, the Centers for Disease Control and Prevention ordered brucellae as one of the bioterrorism agents; consequently, early discovery of this bacterium is very significant to reduce its risk. Consequently, there is an essential requirement for fast, low-cost, less-skilled laboratory personnel and precise method for recognizing the various microbes causing infectious and non-infectious diseases.

Therefore, an innovative skill for precise and rapid categorization of various microorganisms is an actual phase toward an appropriate method for handling of contagious infections in medical and veterinary diagnostics [23, 24]. Currently, the furthermost appropriate technique for recognition of various pathogens is based on mass spectral identification with MALDI Biotyper (MBT) [25]. By using of this technique, the various bacteria and fungi are identified by corresponding the obtained mass spectra with the mass spectra deposited in the reference library. In recent times, a reference library to identify various types of Brucella at the genus and species levels was carried out using 12 Brucella strains [26].

From this perspective view, MBT can be used to diagnose brucellosis in humans and animals in a timely and accurate manner [27]. MBT has many advantages than the other techniques such as reducing the danger of laboratory infections and the time used to detect the infection [26, 28, 29]. Proteomic analysis of mass peak intensities permits the actual documentation to the species level of bacteria [25]. The main idea of this technology is mainly depended on ionization of the microbial proteins by laser shots and the creation of different peak intensities known as spectra. Through the properties of a spectra database kept in the library of MBT device, the associated software scans for matching with the microbial species, based on a consistent list between both spectra [30, 31].

Most antibiotics are unable to penetrate Brucellae because of their intracellular position in reticuloendothelial cells and their preference sites (e.g., bone). To treat brucellosis, antimicrobial regimens containing quinolones, doxycycline, rifampicin, streptomycin, and aminoglycosides are being used alone or in combination [32, 33]. Failure of treatment is common, and there have been lots of reports of brucellosis relapses after treatment, varying from 5% to 15% in mild cases [34]. Emergence of multidrug-resistant in Brucella has recently emerged in brucellosis-endemic regions worldwide (for example, Malaysia, Egypt, Qatar, and China) [34].

Multidrug resistance bacteria arise as a result of incorrect antimicrobial usage [33, 35, 36]. Antibiotics used to encourage growth or as a primary prevention in domesticated animals contribute to the enhancement of bacterial resistance and have a significant impact in their dissemination throughout the food supply chain [37]. Resistance to antibiotics in zoonotic infections is also a concern, as it limits disease treatment choices in public health and animal contexts [38]. None of the research that are available show antimicrobial susceptibility profiles of Brucella isolates from Saudi livestock and humans. Multidrug resistance has been increased all over the world that is considered a public health threat. Several recent investigations reported the emergence of multidrug-resistant bacterial pathogens from different origins including humans, birds, cattle, and fish that increase the need for routine application of the antimicrobial susceptibility testing to detect the antibiotic of choice as well as the screening of the emerging MDR strains [3945].

Drug sensitivity screening is the approach for effective brucellosis management and treatment [46]. Microdilution and/or E-test procedures are used to calculate the minimum inhibitory concentrations (MICs) of antimicrobial drugs [46, 47]. Our research aimed to use serological tests, the Vitek 2 compact System, and MBT with real-time PCR confirmation to rapidly and precisely identify Brucella species isolated from sheep, goats, and humans with a history of brucellosis. A Kirby Bauer method and E-test are also used to test their resistance to various antibacterial drugs.

Material and methods

Ethical statement

Because there were no human or animal participants in this study, it did not involve ethical approval or written permission. Only bacterial cultures from regular medical testing or strain collections have been used, not primary human or animal samples. All of the clinical strains used in this study came from regular diagnostic tests. As a result, there was no attempt to get patient or animal samples for the investigation.

Sample collection and isolation of Brucella species

A total of 434 samples were obtained from humans and various animal herds in the Al-Qassim region of Saudi Arabia with a history of habitual abortion. Three hundred and sixty-four samples were collected from animal sources as follow: 124 milk samples (80 from cows and 44 from goats), 120 blood and serum samples (80 from cows and 40 from goat) and 120 vaginal swab samples (80 from cows and 40 from goats). Seventy from each human blood and serum samples were also collected from people suffering from hyperthermia who were in direct contact with suspected animals. All samples were collected between April to September, 2021.

In the Al-Qassim region of Saudi Arabia’s central plateau, 15 ml of each milk and blood sample, along with vaginal swab samples, were collected from cows and goat farms with a history of habitual abortion. Biosafety level two (BSL2) was used for all bacteriological samples with high personal percussions as formerly considered. Concisely, the milk samples were rotated at 6000 rpm for 10 min to concentrate the organism under hygienic procedures that decrease the danger of aerosol infection to the technicians, and the sediment (cream) was inoculated onto specific media (Brucella Selective Agar) supplemented with antibiotic as formerly described [48], after that the cultured plates were examined for the growth of Brucella species on the fourth day and thereafter day-to-day for 2–4 weeks at 37°C in the presence or absence of CO2 (5–10%).The suspected colonies of Brucella were sub-cultured till appearance of typical round, glistening, pinpoint and honey drop-like appearance. Furthermore, 6 isolates of B. melitensis were collected from microbiological laboratories in a number of hospitals, which took precautions while extracting blood and serum samples from 70 febrile patients based on their history, which involved animal contact, unpasteurized milk consumption, and clinical signs for example fever, night sweetening, low back pain, and severe joint pains. Subsequent biochemical analysis of all Brucella isolates were carried out with Vitek® 2 Compact System.

Biochemical identification of the recovered isolates

The suspected isolates that illustrated gram negative short coccobacilli from oxidase and catalase positive small colonies were examined for production of urease and H2S. On Columbia agar (Sigma-Aldrich, Saint Louis, USA), the strains were recognized by the Vitek 2 device (bioMérieux SA F-69280 Marcy l’Etoile France), via GN cards (bioMérieux SA F-69280 Marcy l’Etoile France) as indicated in the company’s guidelines. Concisely, the bacterial suspension was prepared and balanced by McFarland standards (0.5 to 0.63). Vitek®2 cards were inoculated, and the cards were then submitted to the machine to for proper identification.

Serological identification of the recovered Brucella species

Rose Bengal Test (rapid slide agglutination antigen)

The Rose Bengal Test (RBT) was applied to discriminate antibodies against B. abortus and B. melitensis strains in animal and human serum samples [49]. This test depends mainly on reaction between the bacterial suspension and immunoglobulins (G & M antibodies) in clinical and sub-clinical infections. The test is carried out by examination of the buffered suspension (pH 3.6) of B. abortus strain colored with Rose Bengal against unrecognized sera. The test kits including Rose Bengal Antigen, positive and negative control were purchased from Linear Chemicals, Spain. In brief, the antigen vial was gently re-suspended several times. Fifty μL (one drop) of each unknown serum was placed into one circle of the card. Subsequently, one drop of positive control serum and another drop of negative control serum were dispensed into two separated circles. One drop of Rose Bengal Antigen was then added to each circle. The contents of each circle were properly mixed with one-use stirrer and the slide was manually rotated for approximately 4 minutes. Any degree of agglutination was directly observed under light source and then interpreting the results.

Complement-Enzyme Linked Immuno Sorbent Assay (cELISA)

The cELISA was achieved and results were recorded [50] as described by the guidelines of the manufacturing via Svanovir™ Brucella-Ab cELISA kit (Svanovia Biotech AB Uppsala, Sweden).

Protein analysis using MALDI Biotyper (MBT)

The MBT equipment, which was obtained from Bruker Daltonik in Bremen, Germany, was utilized to identify Brucella species isolated from humans and other animal species (cows and goats) suffering from clinical and sub-clinical Brucellosis quickly and precisely. FlexControl (Flex Series version 1.3) and Compass software were used to investigate all isolates [25].

Preparation of samples via ethanol/formic acid extraction procedure

All MBT samples were made by cultivating on modified Farrell’s serum dextrose agar (Sigma-Aldrich, USA) and then incubating at 37°C for 3–7 days. The extraction of ethanol and formic acid was carried out according to Bruker Daltonics’ guidelines. In brief, 1–2 new colonies were placed onto a clean Eppendorf tube and carefully mixed in 300 μl of sterilized water for each sample. Then, nine hundred μl of pure ethanol were added. The contents were vortexed carefully, and the tubes were correctly mixed for two minutes at 13,000 rpm, with the supernatant decanted and the pellet air-dried. After that, ten μl of the pellet were thoroughly rotated with fifty μl of 70% formic acid, followed by an equal amount of acetonitrile. One μl of the supernatant was put onto a stainless steel plate and left to dry at 25°C after another 2 minutes of spin at 13,000 rpm. As a result, each isolate was covered with one μl of cyano-4 hydroxycinnamic acid (HCCA) matrix solution. The MBT target plate was then loaded into the MBT system for automatic data collection and analysis. All samples were run twice to ensure good detection. The positive control (Escherichia coli) was made by inoculating 50 μl of the standard solvent solution onto the in-vitro diagnostic product (IVD) BTS pellet and melting it repeatedly at 27°C. The solution of Bacterial Test Standard (BTS) was then dissolved for approximately five min at the same manner for several times and then rotated properly at 13, 000 rpm for two minutes. Lastly, the supernatant (5 μl) was moved into screw cap tubes and is kept at –20°C for additional examinations.

Data analysis in MBT

By comparing the unidentified spectrum to the known spectrum preserved in the reference library, the log score of an unnamed spectrum in the range of 0 to 3 was calculated. In the ranges of 2 to 2.29 and 1.700 to 1.999, the species and genus levels were predicted. Misidentification, on the other hand, was carried out when the score value fluctuated between 0.00 and 1.69. The m/z range of two thousand Da to twenty thousand Da was used to evaluate the various spectra created by the Compass Software. A dendrogram based on the reference library was built from the minimum spanning tree (MSP) data set, which includes over 7,000 different species of microorganisms.

SYBR green real time PCR assay

DNA extraction

The field isolates’ DNA was extracted using the QuickGene-810 (AutoGen, Japan) and the QuickGene DNA tissue kit S (DT-S) as stated by the producer’s guidelines. A Spectrophotometer (NanoDropTM 2000) obtained from Thermo Scientific was used to determine the degree of purity of the isolated DNA.

qPCR assay

As a MBT confirmatory procedure, the Fast 7500 Real-Time PCR System (Applied Biosystems, USA) was used. This method was used to distinguish between B. melitensis and B. abortus. BMEII0466 gene for B. melitensis and BruAb2 0168 gene for B. abortus were selected for the manufacture of species-specific primers (Table 1). The reaction mix was made up of 15 μl (10 μl of oasigTM or Precision PLUSTM 2 qPCR Master Mix, 1 μl of primer/probe mix, and 4 μl of RNAse/DNAse-free water). After that, 15 μl of this combination was placed into each well, followed by 5 μl of DNA template, while the negative control wells received 5 μl of RNAse/DNase free water. As a result, each well’s final volume was 20 μl. For infection interpretation, the amplification findings were plotted against the cycle number as Delta Rn (Rn).

Table 1. Oligonucleotide sequences used in the current study.
Species Target sequence Forward (F) primer/reverse (R) primer (5′→3′) Base pair (bp) size Reference
B. melitensis BMEII0466 F TCGCATCGGCAGTTTCAA 112 [80]
R CCAGCTTTTGGCCTTTTCC
B. abortus BruAb2_0168 F GCACACTCACCTTCCACAACAA 222
R CCCCGTTCTGCACCAGACT

Analysis of PCR products by LabChip GX Touch 24

Electrophoresis for PCR products will be accomplished by LabChip GXII Touch 24 instrument (PerkinElmer, USA). DNA 1K Assay Quick was applied for chip and processing of samples. In brief, the chip and reagents were prepared by equilibration for 2 min at room temperature. The Dye Concentrate (blue cap) was properly melted and vortexed. For four Low-throughput chip preparations, one vial of DNA HiSens/NGS3K Gel Matrix (red cap) was advised. Gel-Dye was by transferring 13 μl of DNA Dye Concentrate into one vial of DNA Gel Matrix and then was vortexed properly. The mixture was transferred into two spin filters and centrifugation was carried out at 9200 rcf for 10 minutes. Each active well (1 to 10) was rinsed aspirated with purified water. Fifty μl of gel-dye was then added by reverse pipetting method to chip well 3, 7, 8 and 10 and 50 μl DNA Marker was added to chip well 4 and finally, the chip was inserted in the device.

DNA Sample, Ladder and Buffer preparation was carried out as follow: Firstly, 14 μl DNA ladder and 106 μl of DNA sample buffer were added to the provided 0.2 ml ladder tube. The ladder tube was inserted into the ladder hole on the LabChip holder. Then 750 μl (150 μl DNA sample buffer plus 600 μl water) of DNA sample buffer was added to the buffer tube (0.75 ml) delivered with the reagent kit. The buffer tube was then inserted into the buffer slot on the LabChip device. Finally, 40 μl of each DNA sample was transferred into the microchannels and analyzed by electrophoresis. The DNA samples from 25–12,000 bps was rapidly characterized after 30–60 seconds.

Susceptibility of Brucella species to various antibiotics

A total of 25 isolates of Brucella species (11 B. melitensis and 14 B. abortus), were included in the current study. A method described by Magiorakos et al. [51] was used to classify the tested isolates into 18 multidrug-resistant (MDR) strains and 7 extensively drug-resistant (XDR) strains.

The E-test (MIC Test Strip, Fisher Scientific) and Kirby-Bauer techniques were used to assess Brucella species vulnerability and resistance to 12 antimicrobial drugs (Table 2) routinely used to treat human and animal brucellosis. The two tests were undertaken in accordance with the CLSI requirements [51]. The MICs of field isolates to 6 classes of antibiotics including penicillins [ampicillin (AMP, 0.016–256 μg/mL), ampicillin-sulbactam (AMS, 0.016–256 μg/mL)], cephalosporins [cefuroxime (CXM, 0.016–256 μg/mL)], tetracyclines [tetracycline (TE, 0.016–256 μg/mL), doxycycline (DXT, 0.016–256 μg/mL)], fluoroquinolones [ciprofloxacin (CIP, 0.002–32 μg/mL), levofloxacin (LEV, 0.002–32 μg/mL)], sulfonamides [trimethoprim- sulfamethoxazole (SXT, 0.002–32 μg/mL), chloramphenicol (C, 0.016–256 μg/mL)], rifamycins [rifampin (RIF, 0.016–256 μg/ml)], and aminoglycosides [gentamycin (CN, 0.064–1024 μg/mL), streptomycin (S, 0.016–256 μg/mL)] were measured using MIC Test Strip purchased from Fisher Scientific, US.

Table 2. Zone diameter and MIC breakpoints for Haemophilus spp. as an alternative for Brucella species [52].

Antibiotic used Disc content in μg Zone diameter breakpoints in mm MIC breakpoints in μg/ml
S I R S I R
Ampicillin 10 ≥22 19–21 ≤18 ≤1 2 ≥4
Ampicillin-sulbactam 10/10 ≥20 - ≤19 ≤ 2/1 ≥ 4/2
Cefuroxime 30 ≥20 17–19 ≤16 ≤4 8 ≥16
Tetracycline 30 ≥29 26–28 ≤25 ≤2 4 ≥8
Doxycycline 30 ≥48 32–47 ≤31 ≤1 - -
Ciprofloxacin 5 ≥ 21 - ≤20 ≤1 - -
levofloxacin 5 ≥ 17 18–19 ≤20 ≤2 - -
Trimethoprim- sulfamethoxazole 1.25/23.75 ≥16 11–15 ≤10 ≤ 0.5/9.5 1/19–2/38 ≥ 4/76
Chloramphenicol 30 ≥29 26–28 ≤25 ≤2 4 ≥8
Rifampin 5 ≥20 17–19 ≤16 ≤1 2 ≥4
Gentamycin 10 ≥45 23–44 ≤22 ≤4 - -
Streptomycin 10 ≥36 20–35 ≤19 ≤8 - -

Measuring zones for ampicillin (10 μg), ampicillin-sulbactam (10/10 μg), cefuroxime (30 μg), tetracycline (30 μg), doxycycline (30 μg), ciprofloxacin (5 μg), levofloxacin (5 μg), trimethoprim- sulfamethoxazole (1.25/23.75 μg), chloramphenicol (30 μg), rifampin (5 μg), gentamycin (10 μg), and streptomycin (10 μg) was established by Kirby-Bauer method and automatically identified by ProtoCOL 3 Plus (Synbiosis, Cambridge, United Kingdom). Preparation of bacterial suspension for each isolate was performed using pure colonies and the McFarland Standard 0.5 (Thermo Fisher Scientific Inc., US) was applied for adjustment of the bacterial turbidity. The suspension of each isolate was then distributed onto Muller-Hinton agar plates (IndiaMart, India) enhanced with sheep blood (5%) and in the presence of 10% CO2, all plates were incubated at 37°C for two successive days. The breakpoints of Brucella species have been detected against the antimicrobial agents under study, based on the procedures for slow-growing bacteria (Haemophilus spp.) as formerly described [52]. All antibiotics were tested two times to confirm the results. B. melitensis biotype 1 (strain 16M / ATCC 23456) and Haemophilus influenzae ATCC® 10211™, were applied as reference strains throughout the current investigation.

Results

Isolation of Brucella species and colony physiognomies

Initially, the growth of bacterial colonies was illustrated as early as 72 h on a specific media (Brucella selective agar) and the majority of isolates were noticed following four consecutive days of incubation at 37°C with absence of CO2. Under microscope, the grown colonies exhibited typical honey-like appearance which characterized by small, smooth, round and pin-point colonies. Modified Ziehl-Neelsen (MZN) stain was applied for all isolates to demonstrate their cellular characteristics (e.g. gram negative small coccobacilli arranged singly and in pairs). According to our findings in Table 3, 14 isolates were isolated from 240 cow samples as follow: 5 strains from 80 milk samples, 3 strains from blood samples and 6 strains from vaginal swab samples whereas, 5 strains were recovered from 44 goat samples (1 strain from milk, 2 from blood & 2 from vaginal swab samples). From 70 human blood samples, 6 strains were detected.

Table 3. Different types of samples used in the study and Brucella isolates.

Species Type of sample Total
Milk Blood Vaginal swab
Sample cultured Isolates Sample cultured Isolates Sample cultured Isolates Total samples cultured Total isolates
Cattle 80 5 80 3 80 6 240 14
Goat 44 1 40 2 40 2 124 5
Human 0 0 70 6 0 0 70 6

Biochemical and serum analyses

Twenty-five isolates were biochemically identified by the Vitek 2 ID-GN card. Based on our findings, the examined strains were recognized as 11 B. melitensis and 14 B. abortus. This test was carried out in around 7–8 hours for majority of the strains as indicated previously by Pappas et al. (2006), The minimum period used to check the isolates was 6 hours (3 isolates), while the longest period was 10.40 hours (2 isolates). One hundred and ninety serum samples collected from human (n = 70), cow (n = 80) and goat (n = 40) were examined by RBT and cELISA technique and the interpreting results indicated that the positive samples for RBT were 10% (7/70), 3.75% (3/80) and 5% (2/40), for human, cow and goat samples, respectively. All positive samples for RBT were confirmed cELISA except one human serum samples gave negative results.

Protein fingerprinting of Brucella species

In the current investigation, 25 cultured strains were examined by MBT device, and the spectra of the field isolates were correlated to the reference spectra. Based on our findings, MBT was able to identify all cultured isolates as Brucella species (11 B. melitensis and 14 B. abortus) by 100%. Examining these results illustrated that about twenty prominent ion peaks were identified in the original bands from the region extended from 2000 to 15,000 Daltons (Da) (Figs 1 & 2). All tested strains were appropriately recognized as 14 B. abortus strains recovered from cows and 11 B. melitensis recovered from human (6 strains) and goat (5 strains).

Fig 1. Protein patterns of Brucella melitensis strain.

Fig 1

Fig 2. Protein patterns of field Brucella abortus strain.

Fig 2

As can be seen in Table 4, analysis of logarithmic score value demonstrates that 5/14 (35.71%) B. abortus and 3/11 (27.27%) of B. melitensis, were identified score value between 2.3 and 3.0. Similarly; 8/14 (57.14%) B. abortus and 8/11 (72.73%) B. melitensis were properly identified, with log values ranging from 2.0 to 2.29. However, we found that one strain (3.57%) of B. abortus was identified at the genus level at less than 2 scoring value.

Table 4. Logarithmic score values for B. melitensis and B. abortus strains isolated from human blood samples and milk and vaginal swab samples of animals by MBT.

Brucella spp. Total number Score value of identification
2.3–3 2–2.29 1.7–1.99 0–1.69
No. % No. % No. % No. %
B. melitensis 11 3 27.27 8 72.73 0 0.00 0 0.00
B. abortus 14 5 35.71 8 57.14 1 3.57 0 0.00

Principal Component Analysis (PCA) was created by MBT Compass IVD software as a supplementary statistical tool to detect the resemblances and variances among the spectral proteins of Brucella species. As shown in Fig 3, three‐dimensional (3d) image of PCA illustrated numerous protein spectra. Detection of each peak was demonstrated by calculation of the three loading standards (Loading 1, Loading 2, and Loading 3). In our investigation, the majority of peaks verified in the MBT Compass IVD software were assessed statistically by PCA, which was capable of separating the Brucella species as B. melitensis and B. abortus.

Fig 3. Principal component analysis developed a 3D loading image that shows many spectra for 11 Brucella melitensis and 14 Brucella abortus strains.

Fig 3

The force value of the peaks was represented by each dot. The peaks were adjusted in accordance with the loading value, which corresponded to loading 1, loading 2, and loading 3 modes.

Molecular identification of Brucella species

SYBR® Green qPCR was applied to approve the results of MBT. The target sequences of BMEII0466 and BruAb2_0168 were considered to recognize B. melitensis and B. abortus, respectively. Amplification of PCR with these target sequences produced replication events of the predictable base pairs. Every genome was magnified individually, and the size of each probable product was long-established. Based on our findings, BMEII0466 and BruAb2_0168 were detected in 11 B. melitensis and 14 B. abortus strains, correspondingly. The products of qPCR were run through LabChip GXII Automated electrophoresis device to analyze the size of both genes and the results indicated that the sizes were 112 bp for B. melitensis and 222 bp for B. abortus. By comparing the results of MBT with the qPCR, it was found that there is complete agreement; consequently, the qPCR is used as a confirmatory method of MBT.

Susceptibility of B. melitensis and B. abortus strains to antimicrobial agents

Based on the measurements of MIC for all tested antibiotics as can be seen in Table 5, it was appeared that all strains were vulnerable to ceftriaxone (MIC90 = 2 μg/ml for B. melitensis and MIC90 = 0.75 μg/ml for B. abortus), ciprofloxacin (MIC90 = 0.125 μg/ml for B. melitensis and MIC90 = 0.094 μg/ml for B. abortus), levofloxacin (MIC90 = 1 μg/ml for B. melite nsis and MIC90 = 0.75 μg/ml for B. abortus). According to the results recorded in Table 6 and Table 7, 36.36%, 31.82%, 27.27% and 22.70% of B. melitensis strains were resistant to trimethoprim-sulfamethoxazole (MIC90 = 0.125 μg/ml), rifampin (MIC90 = 4 μg/ml), ampicillin-sulbactam (MIC90 = 1.5 μg/ml) and ampicillin (MIC90 = 4 μg/ml), respectively. Likewise, 35.71%, 32.14%, 32.14, and 28.57% (Table 7) of B. abortus isolates were resistant rifampin (MIC90 = 6 μg/ml), trimethoprim-sulfamethoxazole (MIC90 = 0.38 μg/ml), ampicillin (MIC90 = 3 μg/ml) and ampicillin-sulbactam (MIC90 = 2 μg/ml), respectively.

Table 5. MBT and molecular identification, as well as culturing of B. melitensis and B. abortus isolated from human animal species in Saudi Arabia.

ID of sample Species Sample’s origin Sample’s type Selective culture media MBT identification Real time PCR
Species Score value
CM-1 Cattle Bukiryah Milk Positive B. abortus 2.12 B. abortus
CM-2 Cattle Bukiryah Milk Positive B. abortus 2.31 B. abortus
CM-3 Cattle Unayzah Milk Positive B. abortus 2.16 B. abortus
CM-4 Cattle Unayzah Milk Positive B. abortus 2.43 B. abortus
CM-5 Cattle Ar Rass Milk Positive B. abortus 2.08 B. abortus
CB-6 Cattle Ar Rass Blood Positive B. abortus 2.29 B. abortus
CB-7 Cattle Ar Rass Blood Positive B. abortus 2.30 B. abortus
CB-8 Cattle Ar Rass Blood Positive B. abortus 2.22 B. abortus
CV-9 Cattle Bukiryah Vagina Positive B. abortus 2.41 B. abortus
CV-10 Cattle Buraydah Vagina Positive B. abortus 2.14 B. abortus
CV-11 Cattle Unayzah Vagina Positive/Negative Brucella spp. 1.98 B. abortus
CV-12 Cattle Buraydah Vagina Positive B. abortus 2.18 B. abortus
CV-13 Cattle Unayzah Vagina Positive B. abortus 2.39 B. abortus
CV-14 Cattle Unayzah Vagina Positive B. abortus 2.21 B. abortus
GM-15 Goat Unayzah Milk Positive B. melitensis 2.24 B. melitensis
GM-16 Goat Ar Rass Blood Positive B. melitensis 2.32 B. melitensis
GM-17 Goat Ar Rass Blood Positive B. melitensis 2.00 B. melitensis
GM-18 Goat Buraydah Vagina Positive B. melitensis 2.23 B. melitensis
GM-19 Goat Buraydah Vagina Positive B. melitensis 2.15 B. melitensis
HB-20 Human Buraydah Blood Positive B. melitensis 2.41 B. melitensis
HB-21 Human Buraydah Blood Positive B. melitensis 2.07 B. melitensis
HB-22 Human Buraydah Blood Positive B. melitensis 2.36 B. melitensis
HB-23 Human Buraydah Blood Positive B. melitensis 2.18 B. melitensis
HB-24 Human Riyadh Blood Positive B. melitensis 2.10 B. melitensis
HB-25 Human Riyadh Blood Positive B. melitensis 2.20 B. melitensis

Table 6. The MIC values of antimicrobial agents against 25 Brucella strains (11 B. melitensis and 14 B. abortus).

Antimicrobial agent Conc. in μg/ml Range of MIC MIC50 in μg/ml MIC90 in μg/ml
B. melitensis B. abortus B. melitensis B. abortus B. melitensis B. abortus
AMP 0.016–256 0.25–6 0.19–4 0.38 1.5 4 2
AMS 0.016–256 0.125–6 0.094–6 1 0.75 1.5 3
CXM 0.016–256 0.75–8 0.5–6 1.5 1.5 2 0.75
TE 0.016–256 0.064–8 0.094–8 0.125 0.19 0.25 0.75
DXT 0.016–256 0.032–4 0.047–4 0.094 0.125 0.19 0.25
CIP 0.002–32 0.023–0.19 0.023–0.25 0.047 0.19 0.125 0.094
LEV 0.002–32 0.032–1.5 0.094–1 0.75 0.50 1 0.75
SXT 0.002–32 0.012–4 0.016–0.25 0.047 0.19 0.125 0.38
C 0.016–256 0.032–0.75 0.023–0.5 0.064 0.094 0.25 0.19
RIF 0.016–256 0.125–6 0.094–12 0.19 4 4 6
CN 0.064–1024 0.38–6 0.50–6 0.75 0.75 1 0.50
S 0.016–256 0.023–8 0.032–8 0.125 0.19 0.38 0.75

AMP = ampicillin; AMS = ampicillin-sulbactam; CXM = cefuroxime; TE = tetracycline; DXT = doxycycline; CIP = ciprofloxacin; LEV = levofloxacin, SXT = trimethoprim- sulfamethoxazole; C = chloramphenicol; RIF = rifampin; CN = gentamycin; S = streptomycin

Table 7. Kirby Bauer method for determining antibiotic sensitivity of B. melitensis and B. abortus isolates.

Antimicrobial agent Conc. in μg/ml Range in mm Degree of susceptibility
B. melitensis (n = 11) B. abortus (n = 14)
B. melitensis B. abortus S I R S I R
No. % No. % No. % No. % No. % No. %
AMP 10 13–35 16–34 17 77.30 0 0 5 22.7 19 67.86 0 0 9 32.14
AMS 10/10 14–30 12–33 16 72.73 0 0 6 27.27 20 71.43 0 0 8 28.57
CXM 30 24–37 22–41 22 100.0 0 0 0 0.00 28 100.0 0 0 0 0.00
TE 30 25–40 25–38 20 90.91 0 0 2 9.10 25 89.29 0 0 3 10.71
DXT 30 26–52 27–51 20 90.10 0 0 2 9.10 26 92.86 0 0 2 7.14
CIP 5 22–37 24–40 22 100.0 0 0 0 0.00 28 100.0 0 0 0 0.00
LEV 5 18–29 17–32 22 100.0 0 0 0 0.00 28 100.0 0 0 0 0.00
SXT 1.25/23.75 7–23 6–24 14 63.64 0 0 8 36.36 17 60.71 2 7.14 9 32.14
C 30 25–42 26–38 19 86.36 0 0 3 13.66 26 92.86 0 0 2 7.14
RIF 5 13–28 12–30 11 50.00 4 18.18 7 31.82 15 53.57 3 10.71 10 35.71
CN 10 23–48 22–51 22 100.0 0 0 0 0.00 22 78.57 5 17.86 1 3.57
S 10 17–45 19–43 19 86.36 1 4.55 2 9.10 25 89.29 1 3.57 2 7.14

AMP = ampicillin; AMS = ampicillin-sulbactam; CXM = cefuroxime; TE = tetracycline; DXT = doxycycline; CIP = ciprofloxacin; LEV = levofloxacin, SXT = trimethoprim- sulfamethoxazole; C = chloramphenicol; RIF = rifampin; CN = gentamycin; S = streptomycin

Furthermore, 24/25 (96%) Brucella species were resistant either to at least two antibiotics belonging to two different classes (Table 8). The same table also shows that in the class of multidrug resistant, 12/25 (48%) of Brucella species are resistant to at least three classes of antibiotics and classified as multidrug resistant, whereas the rest of isolates were resistant to one or two classes of antibiotics and classified as drug resistant.

Table 8. Multidrug resistance profile of 25 Brucella species.

No. of antibiotics Antibiotic profiles Resistant strains No. of antibiotic classes Resistance category
No. %
5 AMP, TE, DXT, SXT, RIF 2 8% 4 Multidrug resistant
5 AMS, TE, SXT, RIF, S 2 8% 5 Multidrug resistant
5 AMS, TE, DXT, SXT, S 1 4% 4 Multidrug resistant
4 AMP, AMS, DXT, RIF 1 4% 3 Multidrug resistant
4 AMP, AMS, TE, SXT 1 4% 3 Multidrug resistant
3 AMS, SXT, RIF 3 12% 3 Multidrug resistant
3 C, RIF, CN 1 4% 3 Multidrug resistant
3 AMP, AMS, SXT 1 4% 2 Drug resistant
3 AMP, AMS, RIF 2 8% 2 Drug resistant
3 SXT, RIF, S 1 4% 3 Multidrug resistant
3 AMP, AMS, C 1 4% 2 Drug resistant
3 SXT, C, RIF 1 4% 2 Drug resistant
3 AMP, AMS, RIF 1 4% 2 Drug resistant
2 AMS, SXT 1 4% 2 Drug resistant
2 SXT, RIF 2 8% 2 Drug resistant
2 AMS, RIF 1 4% 2 Drug resistant
2 C, RIF 2 8% 2 Drug resistant
1 RIF 1 4% 1 Drug resistant

Discussion

Brucellosis is still one of the utmost imperative zoonotic illnesses, distressing both animals and humans in many parts of the world [53]. For thousands of years, the disease has been present in the Gulf and Mediterranean regions, posing serious public health and veterinary implications [54]. The tight link between humans, foods, and cattle is the most significant component of its One-Health. Reliable identification and species determination of Brucellae obtained from animal and human origins are crucial for early management [55].

For microbial characterization and identification, Mass Assisted Laser Desorption Ionization Time of Flight Mass Spectrometry (MALDI-TOF MS) provides a quick, accurate, and cost-effective approach. Its power comes from the distinctive and unique protein profiles generated for each bacterium, which allow for reliable microbiological identification at the genus and species levels. Due to their advantages, MALDI-TOF based tests are replacing the existing techniques for conventional bacterial identification in diagnostic laboratories [5658]. MALDI-TOF MS is a reliable approach for identifying extremely harmful microbes (Brucella species and Bacillus anthracis), including that could have been utilized as biological weapons agents, due to its high resolution and accuracy [29, 59, 60].

These organisms are often detected with morphologic, genomic, and immunologic assays that are time-consuming, inefficient, and pose a severe danger to healthcare personnel. Early identification and characterization of the potential cause is crucial for formulating a timely and successful response in the case of bioweapons or spontaneous epidemics [61]. Although Brucella species have a high amount of nucleotide similarity, they differ greatly in terms of host tropism, bacterial and disease characteristics, and virulence. For a long time, the lack of variety impeded the development of molecular typing methods [61].

Furthermore, despite the fact that the MBT 2.0 basic dataset (Bruker Daltonics) is utilized for standard microbial identification in clinical microbiology, which appears to contain over 3,000 particular mass spectra from several microbial species, the database lacks spectra for several species of Brucella. This substantially restricts its use in high-incidence nations where Brucella species are regularly recovered from individuals. An augmented library comprising Brucella species [26, 61, 62] or a custom Brucella library [29] have been used by several groups to improve Brucella identification.

MALDI-TOF, a proteomics-based technology, was used in conjunction with qPCR and DNA-based technologies, to recognize different species of Brucella obtained from several sources in the current investigation. For the routine identification of Brucellae, MBT seemed to be a fast and consistent approach [63]. For species identification, however, DNA-based methods are still required. MALDI-TOF has emerged as a quick approach for Brucellae identification in standard diagnostic laboratories over the last two decades. To increase the accuracy of Brucella species identification, however, robust standard databases require a lot of strains from various species and biovars [64].

In the diagnostic laboratory, MALDI-TOF MS is replacing traditional approaches for detecting bacteria. Several of the obstacles of recognizing microbial pathogens are addressed by MALDI-TOF mass spectrometry [65]. The development of libraries collecting spectra of known organisms as technology has made it feasible to identify species with similar morphological, genotypic, and biochemical traits that were formerly impossible to identify [66]. This has improved medical intervention by reducing the time it takes to diagnose illnesses caused by relatively rare species [65]. Unfortunately, there are certain drawbacks to this method. Due to intrinsic similarities among microorganisms and a limited number of spectra in the databases, improper species differentiation and mistaken identity might occur [23, 65]. These mistakes are made infrequently and may usually be avoided by performing further screening.

All novel isolates, as well as a considerable number of ancient isolated strains from the Resource Centre Libraries’ holdings in endemic regions, should really be processed and morphologically categorized to update the current database. For identifying Brucella at the genus and species, a DNA-based approaches such as qPCR is required to eliminate morphological processing and minimize the chances of research lab infection [67].

The current study additionally used a real-time PCR to confirm the MBT results. This technique offers a viable alternative to the difficult culturing and identification of Brucella species by means of traditional techniques [68, 69]. Real-time PCR was found to be a sensitive and specific approach for detecting and distinguishing between B. abortus and B. melitensis. This technique has the advantages of being rapid to perform, not requiring electrophoretic analysis, and not being contaminated like traditional PCR.

Because of the high cost of treating brucellosis in cattle and sheep, it is not commonly done, yet the meat of butchered animals is consumed by humans in underdeveloped nations. The most popular antibiotic combinations suggested through the WHO to cure brucellosis in humans are doxycycline with rifampicin or fluoroquinolones with rifampicin. There are few previous investigations on sensitivity testing for antimicrobials for the Brucellae, and Kirby Bauer and the E-test techniques are commonly used [33, 55].

Increased microbial resistance to traditional antibiotics has recently sparked interest in developing new antibiotic classes for the treatment of certain infectious illnesses. Only a few restricted antibiotics have clinical efficacy and good intracellular penetration for the handling of brucellosis, as stated previously by the WHO [26]. Many B. melitensis and B. abortus strains were shown to be susceptible to a wide range of antibiotics, including ceftriaxone, ciprofloxacin, levofloxacin, doxycycline, gentamycin, chloramphenicol, and streptomycin, according to our research. Trimethoprim-sulfamethoxazole (36.36%), rifampin (31.82%), ampicillin-sulbactam (27.27%), and ampicillin (22.70 percent) resistance were all found in B. melitensis isolates. Rifampin, trimethoprim-sulfamethoxazole, ampicillin, and ampicillin-sulbactam resistance were found in 35.71%, 32.14%, 32.14%, and 28.57% of B. abortus isolates, respectively.

Alamian et al. [70] found similar results when they tested 60 isolates of B. melitensis collected from blood samples against a variety of medications routinely used to treat human brucellosis. Except for 18.4% of isolates that exhibited probable resistance to ampicillin-sulbactam, nearly all strains were sensitive to ceftriaxone, doxycycline, streptomycin, trimethoprim-sulfamethoxazole, and gentamicin. Asadi et al. [71] tested 140 B. melitensis isolates against various antimicrobial agents and found that all strains were vulnerable to streptomycin, doxycycline, ciprofloxacin, moxifloxacin, and gentamicin, while only 3.5% and 35.08% of strains had moderate response to trimethoprim-sulfamethoxazole and rifampin, correspondingly.

Qadri and Ueno [72] indicated that several antimicrobial drugs such as doxycycline, ciprofloxacin, tetracycline, gentamicin, streptomycin, trimethoprim-sulfamethoxazole, and levofloxacin were all effective against Brucella strains collected from Saudi Arabia. Nonetheless, Khan et al. [33] observed that B. melitensis strains of animal sources were resistant to ciprofloxacin, rifampicin, and streptomycin in 75.2%, 66.7%, and 4.8%, correspondingly. Furthermore, Liu et al. [47] found that all 85 B. melitensis isolates from patients suffering from Brucellosis in China were sensitive to levofloxacin, ciprofloxacin, sparfloxacin, minocycline, gentamicin tetracycline, and doxycycline. Cotrimoxazole and rifampin resistance was found in 7.0% and 1.0%, respectively, of the isolates. In another investigation, Abdel Maksoud and his colleagues [73] found that 64% of Brucella strains recovered from Egyptian patients were resistant to rifampin. Cotrimoxazole and rifampin have limited inhibitory effect against Brucella strains, according to Lopez-Merino et al. [74].

Antibiotic resistance is a major problem in many developing nations because of improper drug administration, which results in the usage of a large number of antibiotics each year. It has also been observed that Middle Eastern countries consume significantly more systemic antibacterial medicines such as broad-spectrum β-lactam antibiotics, 3rd generation cephalosporins, and quinolones than other countries [70]. As a result, the current study looked at a group of antibiotics routinely used to treat brucellosis.

Rifampin, is an antibiotic used to treat brucellosis. It works by inhibiting bacterial RNA and protein production, which makes it bactericidal [75]. Because of its high intracellular transport, this antibiotic also has an in vitro inhibitory impact against several Brucella strains [76]. As stated by the CLSI breakpoints for slow-growing bacteria, 31.82% (7/22) of B. melitensis isolates and 35.71% (10/28) of B. abortus isolates were susceptible to rifampin in our investigation. Rifampin resistance has already been found in 64% of Egyptian field strains [73], 36.73% in Brazil [77], 9.7% in Turkey [78], and 70% in Malaysia [79].

Conclusions

Brucellosis is still a significant global health threat, and the One-Health approach’s most important feature is the close link between individuals, foodstuffs, and animals. Throughout Saudi Arabia, Brucellosis is an endemic zoonotic disease, with B. melitensis as the most common species of bacteria. MBT has been proposed as a viable rapid 1st line screening technology for Brucella detection in regular clinical laboratories that requires relatively little time, work, and money. Nevertheless, in order to diagnose Brucella at the species level, a combination of DNA-based techniques, including real-time PCR, confirmed by microfluidic electrophoresis is required. With the exception of ampicillin, rifampin, and ampicillin-sulbactam, most of the antimicrobial drugs evaluated in this investigation showed effective inhibitory effects against B. melitensis and B. abortus and could be used in treatment regimens. Due to observed resistances, caution should be exercised while prescribing ampicillin, ampicillin-sulbactam, and rifampin. Moreover, Brucella’s intracellular localization limits the number of effective antimicrobial medicines available to treat both localized and systemic brucellosis.

Data Availability

All relevant data are within the paper.

Funding Statement

The Deputyship for Research & Innovation, Ministry of Education and Qassim University, Saudi Arabia (the project number: QU-IF-1-4-2). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1.Jokhdar H. Brucellosis in Saudi Arabia: review of literature and an alarming case report in a hospital in Jeddah. 2009;77(3):47–55. doi: 10.3899/jrheum.081320 [DOI] [PubMed] [Google Scholar]
  • 2.de Figueiredo P, Ficht TA, Rice-Ficht A, Rossetti CA, Adams LG. Pathogenesis and immunobiology of brucellosis: review of Brucella–Host Interactions. 2015;185(6):1505–17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Golshani M, Buozari SJ. A review of brucellosis in Iran: epidemiology, risk factors, diagnosis, control, and prevention. 2017;21(6):349. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Al Jindan R. Scenario of pathogenesis and socioeconomic burden of human brucellosis in Saudi Arabia. 2021;28(1):272. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Cutler S, Whatmore A, Commander NJ. Brucellosis–new aspects of an old disease. 2005;98(6):1270–81. [DOI] [PubMed] [Google Scholar]
  • 6.Godfroid J. Brucellosis in livestock and wildlife: zoonotic diseases without pandemic potential in need of innovative one health approaches. 2017;75(1):1–6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Alkahtani AM, Assiry MM, Chandramoorthy HC, Al-Hakami AM, Hamid ME. Sero-prevalence and risk factors of brucellosis among suspected febrile patients attending a referral hospital in southern Saudi Arabia (2014–2018). 2020;20(1):1–8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Cooper CW. Risk factors in transmission of brucellosis from animals to humans in Saudi Arabia. 1992;86(2):206–9. [DOI] [PubMed] [Google Scholar]
  • 9.Al Dahouk S, Tomaso H, Nöckler K, Neubauer H, Frangoulidis DJ. Laboratory-based diagnosis of brucellosis—a review of the literature. Part I: Techniques for direct detection and identification of Brucella spp. 2003;49(9–10):487–505. [PubMed] [Google Scholar]
  • 10.Barua A, Kumar A, Thavaselvam D, Mangalgi S, Prakash A, Tiwari S, et al. Isolation & characterization of Brucella melitensis isolated from patients suspected for human brucellosis in India. 2016;143(5):652. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Neha A, Kumar A, Ahmed I. Comparative efficacy of serological diagnostic methods and evaluation of polymerase chain reaction for diagnosis of bovine brucellosis. 2017;18(4):279. [PMC free article] [PubMed] [Google Scholar]
  • 12.Banai M, Itin R, Bardenstein S. Perspectives and outcomes of the activity of a reference laboratory for brucellosis. 2018;4:234. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Elbehiry A. Evaluation of Diagnostic Techniques for the detection of Brucella spp in camel sera and In-Vitro testing their susceptibility against antimicrobial agents. 2014. [Google Scholar]
  • 14.Nielsen K, Cherwonogrodzky J, Duncan J, Bundle D. Enzyme-linked immunosorbent assay for differentiation of the antibody response of cattle naturally infected with Brucella abortus or vaccinated with strain 19. 1989;50(1):5–9. [PubMed] [Google Scholar]
  • 15.Herman L, De Ridder H. Identification of Brucella spp. by using the polymerase chain reaction. 1992;58(6):2099–101. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Rijpens NP, Jannes G, Van Asbroeck M, Rossau R, Herman LM. Direct detection of Brucella spp. in raw milk by PCR and reverse hybridization with 16S-23S rRNA spacer probes. 1996;62(5):1683–8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Leal-Klevezas DS, Lopez-Merino A, Martinez-Soriano J. Molecular detection of Brucella spp.: rapid identification of B. abortus biovar I using PCR. 1995;26(3):263–7. [PubMed] [Google Scholar]
  • 18.Baily G, Krahn J, Drasar B, Stoker N. Detection of Brucella melitensis and Brucella abortus by DNA amplification. 1992;95(4):271–5. [PubMed] [Google Scholar]
  • 19.Leyla G, Kadri G, Ümran O. Comparison of polymerase chain reaction and bacteriological culture for the diagnosis of sheep brucellosis using aborted fetus samples. 2003;93(1):53–61. doi: 10.1016/s0378-1135(02)00442-x [DOI] [PubMed] [Google Scholar]
  • 20.Saadat S, Mardaneh J, Ahouran M, Mohammadzadeh A, Ardebili A, Yousefi, et al. Diagnosis of cattle brucellosis by PCR and serological methods: Comparison of diagnostic tests. 2017;14(2):881–8. [Google Scholar]
  • 21.Yagupsky P, Baron E. Laboratory exposures to brucellae and implications for bioterrorism. 2005;11(8):1180. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Yagupsky P, Morata P, Colmenero J. Laboratory diagnosis of human brucellosis. 2019;33(1):e00073–19. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Elbehiry A, Marzouk E, Hamada M, Al-Dubaib M, Alyamani E, Moussa IM, et al. Application of MALDI-TOF MS fingerprinting as a quick tool for identification and clustering of foodborne pathogens isolated from food products. 2017;40(4):269–78. [PubMed] [Google Scholar]
  • 24.Hays JP, Van Leeuwen W. The Role of New Technologies in Medical Microbiological Research and Diagnosis: Title Page. pdf; 02 Cover Page; 03 REVISED eBooks End User License Agreement-Website; 04 Contents; 05 FOREWARD; 06 Preface; 07 List of Contributors; 08 Chapter 1. Ingham 30.06; 09 Chapter 2. Hwang 30.06; 10 Chapter 3. Welker 30.06; 11 Chapter 4. Ferrer 30.06; 12 Chapter 5. Bruins 30.06; 13 Chapter 6. Ikonomopoulos 30.06; 14 Chapter 7. Manmohan Parida 30.06; 15 Chapter 8. Nuutila 30.06; 16 Chapter 9. Verkaik 30.06; 17 Index 11.10: Bentham Science Publishers; 2012. [Google Scholar]
  • 25.Elbehiry A, Marzouk E, Moussa IM, Alenzi A, Al-Maary KS, Mubarak AS, et al. Multidrug-resistant Escherichia coli in Raw Milk: Molecular Characterization and the potential impact of camel’s Urine as an Antibacterial Agent. 2021;28(4):2091–7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Ferreira L, Vega Castaño S, Sánchez-Juanes F, González-Cabrero S, Menegotto F, Orduña-Domingo A, et al. Identification of Brucella by MALDI-TOF mass spectrometry. Fast and reliable identification from agar plates and blood cultures. 2010;5(12):e14235. doi: 10.1371/journal.pone.0014235 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Grenga L, Pible O, Armengaud J. Pathogen proteotyping: A rapidly developing application of mass spectrometry to address clinical concerns. 2019;14:9–17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Choudhary P, Shringi N, Kashyap S. MALDI-TOF Mass Spectrometry: In Search of the Most Reliable Approach to Diagnose Brucella in Bovines. International Journal of Livestock Research. 2019;9:27–55. doi: 10.5455/ijlr.20190413030405 [DOI] [Google Scholar]
  • 29.Lista F, Reubsaet FA, De Santis R, Parchen RR, de Jong AL, Kieboom J, et al. Reliable identification at the species level of Brucella isolates with MALDI-TOF-MS. 2011;11(1):1–11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Pavlovic M, Huber I, Konrad R, Busch U. Application of MALDI-TOF MS for the identification of food borne bacteria. 2013;7:135. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Seng P, Drancourt M, Gouriet F, La Scola B, Fournier P-Exs, Rolain JM, et al. Ongoing revolution in bacteriology: routine identification of bacteria by matrix-assisted laser desorption ionization time-of-flight mass spectrometry. 2009;49(4):543–51. [DOI] [PubMed] [Google Scholar]
  • 32.Ariza J, Bosilkovski M, Cascio A, Colmenero JD, Corbel MJ, Falagas ME, et al. Perspectives for the treatment of brucellosis in the 21st century: the Ioannina recommendations. 2007;4(12):e317. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Khan AU, Shell WS, Melzer F, Sayour AE, Ramadan ES, Elschner MC, et al. Identification, genotyping and antimicrobial susceptibility testing of Brucella spp. isolated from livestock in Egypt. 2019;7(12):603. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.del Pozo JSG, Solera J. Treatment of Human Brucellosis—Review of Evidence from Clinical Trials. 2015:185. [Google Scholar]
  • 35.Gebeyehu E, Bantie L, Azage M. Inappropriate use of antibiotics and its associated factors among urban and rural communities of Bahir Dar City Administration, Northwest Ethiopia. 2015;10(9):e0138179. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Kasim K, Hassan H. Self medication problem in Egypt: a review of current and future perspective. 2018;10(4):40–5. [Google Scholar]
  • 37.Landers TF, Cohen B, Wittum TE, Larson EL. A review of antibiotic use in food animals: perspective, policy, and potential. 2012;127(1):4–22. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Agunos A, Pierson FW, Lungu B, Dunn PA, Tablante N. Review of nonfoodborne zoonotic and potentially zoonotic poultry diseases. 2016;60(3):553–75. [DOI] [PubMed] [Google Scholar]
  • 39.Makharita RR, El-Kholy I, Hetta HF, Abdelaziz MH, Hagagy FI, Ahmed AA, et al. Antibiogram and genetic characterization of carbapenem-resistant gram-negative pathogens incriminated in healthcare-associated infections. 2020;13:3991. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Algammal AM, Hashem HR, Alfifi KJ, Hetta HF, Sheraba NS, Ramadan H, et al. atp D gene sequencing, multidrug resistance traits, virulence-determinants, and antimicrobial resistance genes of emerging XDR and MDR-Proteus mirabilis. 2021;11(1):1–15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Algammal AM, Hashem HR, Al-Otaibi AS, Alfifi KJ, El-Dawody EM, Mahrous E, et al. Emerging MDR-Mycobacterium avium subsp. avium in house-reared domestic birds as the first report in Egypt. 2021;21(1):1–11. doi: 10.1186/s12866-021-02287-y [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Algammal AM, Hetta HF, Batiha GE, Hozzein WN, El Kazzaz WM, Hashem HR, et al. Virulence-determinants and antibiotic-resistance genes of MDR-E. coli isolated from secondary infections following FMD-outbreak in cattle. 2020;10(1):1–13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Algammal AM, Mabrok M, Ezzat M, Alfifi KJ, Esawy AM, Elmasry N, et al. Prevalence, antimicrobial resistance (AMR) pattern, virulence determinant and AMR genes of emerging multi-drug resistant Edwardsiella tarda in Nile tilapia and African catfish. 2022;548:737643. [Google Scholar]
  • 44.Algammal AM, El-Sayed ME, Youssef FM, Saad SA, Elhaig MM, Batiha GE, et al. Prevalence, the antibiogram and the frequency of virulence genes of the most predominant bacterial pathogens incriminated in calf pneumonia. 2020;10(1):1–8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Enany ME, Algammal AM, Shagar GI, Hanora AM, Elfeil WK, Elshaffy N. Molecular typing and evaluation of Sidr honey inhibitory effect on virulence genes of MRSA strains isolated from catfish in Egypt. 2018;31(5). [PubMed] [Google Scholar]
  • 46.Johansen TB, Scheffer L, Jensen VK, Bohlin J, Feruglio SL. Whole-genome sequencing and antimicrobial resistance in Brucella melitensis from a Norwegian perspective. 2018;8(1):1–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Liu Z-g, Di D-d, Wang M, Liu R-h, Zhao H-y, Piao D-r, et al. In vitro antimicrobial susceptibility testing of human Brucella melitensis isolates from Ulanqab of Inner Mongolia, China. 2018;18(1):1–6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Lopez G, Escobar G, Ayala S, Lucero NJVm. Detection of antibodies to Brucella ovis in sheep milk using B. ovis and B. canis antigen. 2006;116(1–3):232–8. [DOI] [PubMed] [Google Scholar]
  • 49.Caces E, Lauture Hd, Tichet J, Boulard PJCi, microbiology, diseases i. The systematic detection of human brucellosis by the rose bengal test on agricultural people after a study in the middle-west of France on 89 000 workers. 1978. doi: 10.1016/0147-9571(78)90017-6 [DOI] [PubMed] [Google Scholar]
  • 50.Charalampides S. complement enzyme linked immuno sorbent assay (CELISA) and its application to the parasitic infections. II. The estimation of complement fixing filaria-antibodies. 1981. [Google Scholar]
  • 51.Hsueh P-R, Ko W-C, Wu J-J, Lu J-J, Wang F-D, Wu H-Y, et al. Consensus statement on the adherence to Clinical and Laboratory Standards Institute (CLSI) Antimicrobial Susceptibility Testing Guidelines (CLSI-2010 and CLSI-2010-update) for Enterobacteriaceae in clinical microbiology laboratories in Taiwan. 2010;43(5):452–5. [DOI] [PubMed] [Google Scholar]
  • 52.Kosikowska U, Andrzejczuk S, Grywalska E, Chwiejczak E, Winiarczyk S, Pietras-Ożga D, et al. Prevalence of susceptibility patterns of opportunistic bacteria in line with CLSI or EUCAST among Haemophilus parainfluenzae isolated from respiratory microbiota. 2020;10(1):1–11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Suárez-Esquivel M, Chaves-Olarte E, Moreno E, Guzmán-Verri C. Brucella genomics: macro and micro evolution. 2020;21(20):7749. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Bagheri Nejad R, Krecek RC, Khalaf OH, Hailat N, Arenas-Gamboa A. Brucellosis in the Middle East: Current situation and a pathway forward. 2020;14(5):e0008071. doi: 10.1371/journal.pntd.0008071 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Wareth G, El-Diasty M, Abdel-Hamid NH, Holzer K, Hamdy ME, Moustafa S, et al. Molecular characterization and antimicrobial susceptibility testing of clinical and non-clinical Brucella melitensis and Brucella abortus isolates from Egypt. 2021;13:100255. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.La Scola B, Raoult D. Direct identification of bacteria in positive blood culture bottles by matrix-assisted laser desorption ionisation time-of-flight mass spectrometry. 2009;4(11):e8041. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Singhal N, Kumar M, Kanaujia PK, Virdi J. MALDI-TOF mass spectrometry: an emerging technology for microbial identification and diagnosis. 2015;6:791. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Suarez S, Nassif X, Ferroni A. Applications of MALDI-TOF technology in clinical microbiology. 2014;63(1):43–52. [DOI] [PubMed] [Google Scholar]
  • 59.Cunningham SA, Patel R. Importance of using Bruker’s security-relevant library for Biotyper identification of Burkholderia pseudomallei, Brucella species, and Francisella tularensis. 2013;51(5):1639–40. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Pierce CY, Barr JR, Woolfitt AR, Moura H, Shaw EI, Thompson HA, et al. Strain and phase identification of the US category B agent Coxiella burnetii by matrix assisted laser desorption/ionization time-of-flight mass spectrometry and multivariate pattern recognition. 2007;583(1):23–31. [DOI] [PubMed] [Google Scholar]
  • 61.Sali M, De Maio F, Tarantino M, Garofolo G, Tittarelli M, Sacchini L, et al. Rapid and safe one-step extraction method for the identification of Brucella strains at genus and species level by MALDI-TOF mass spectrometry. 2018;13(6):e0197864. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Karger A, Melzer F, Timke M, Bettin B, Kostrzewa M, Nöckler K, et al. Interlaboratory comparison of intact-cell matrix-assisted laser desorption ionization–time of flight mass spectrometry results for identification and differentiation of Brucella spp. 2013;51(9):3123–6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63.Christoforidou S, Kyritsi M, Boukouvala E, Ekateriniadou L, Zdragas A, Samouris G, et al. Identification of Brucella spp. isolates and discrimination from the vaccine strain Rev. 1 by MALDI-TOF mass spectrometry. 2020;51:101533. doi: 10.1016/j.mcp.2020.101533 [DOI] [PubMed] [Google Scholar]
  • 64.Wareth G, Pletz MW, Neubauer H, Murugaiyan JJM. Proteomics of Brucella: technologies and their applications for basic research and medical microbiology. 2020;8(5):766. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 65.Rychert JJJoI. Benefits and limitations of MALDI-TOF mass spectrometry for the identification of microorganisms. 2019;2(4). [Google Scholar]
  • 66.Elbehiry A, Al‐Dubaib M, Marzouk E, Osman S, Edrees HM. Performance of MALDI biotyper compared with Vitek™ 2 compact system for fast identification and discrimination of Staphylococcus species isolated from bovine mastitis. 2016;5(6):1061–70. doi: 10.1002/mbo3.389 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 67.Kaden R, Ferrari S, Alm E, Wahab TJBid. A novel real-time PCR assay for specific detection of Brucella melitensis. 2017;17(1):1–6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 68.Christoforidou S, Boukouvala E, Zdragas A, Malissiova E, Sandalakis V, Psaroulaki A, et al. Novel diagnostic approach on the identification of Brucella melitensis Greek endemic strains‐discrimination from the vaccine strain Rev. 1 by PCR‐RFLP assay. 2018;4(3):172–82. [Google Scholar]
  • 69.Kattar MM, Zalloua PA, Araj GF, Samaha-Kfoury J, Shbaklo H, Kanj SS, et al. Development and evaluation of real-time polymerase chain reaction assays on whole blood and paraffin-embedded tissues for rapid diagnosis of human brucellosis. 2007;59(1):23–32. [DOI] [PubMed] [Google Scholar]
  • 70.Alamian S, Dadar M, Etemadi A, Afshar D, Alamian M. Antimicrobial susceptibility of Brucella spp. isolated from Iranian patients during 2016 to 2018. 2019;11(5):363. [PMC free article] [PubMed] [Google Scholar]
  • 71.Asadi FT, Hashemi SH, Alikhani MY, Moghimbeigi A, Naseri Z. Clinical and diagnostic aspects of brucellosis and antimicrobial susceptibility of Brucella isolates in Hamedan, Iran. 2016:JJID. 2016.133. [DOI] [PubMed] [Google Scholar]
  • 72.Qadri H, Ueno YJC. Susceptibility of Brucella melitensis to the new fluoroquinolone PD 131628: comparison with other drugs. 1993;39(2):128–31. [DOI] [PubMed] [Google Scholar]
  • 73.Abdel-Maksoud M, House B, Wasfy M, Abdel-Rahman B, Pimentel G, Roushdy G, et al. In vitro antibiotic susceptibility testing of Brucella isolates from Egypt between 1999 and 2007 and evidence of probable rifampin resistance. 2012;11(1):1–4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 74.López-Merino A, Contreras-Rodríguez A, Migranas-Ortiz R, Orrantia-Gradín R, Hernández-Oliva GM, Gutiérrez-Rubio ATY, et al. Susceptibility of Mexican brucella isolates to moxifloxacin, ciprofloxacin and other antimicrobials used in the treatment of human brucellosis. 2004;36(9):636–8. [DOI] [PubMed] [Google Scholar]
  • 75.Gattringer K-B, Suchomel M, Eder M, Lassnigg AM, Graninger W, Presterl E. Time-dependent effects of rifampicin on staphylococcal biofilms. 2010;33(9):621–6. [DOI] [PubMed] [Google Scholar]
  • 76.Godeau P, Fuchs G, Guillevin L, Philippon A, Tucat G, Cabane J, et al. Treatment of human brucellosis with rifampicin. 1984;60(1):5–9. [PubMed] [Google Scholar]
  • 77.Barbosa Pauletti R, Reinato Stynen AP, Pinto da Silva Mol J, Seles Dorneles EM, Alves TM, de Sousa Moura Souto M, et al. Reduced susceptibility to Rifampicin and resistance to multiple antimicrobial agents among Brucella abortus isolates from cattle in Brazil. 2015;10(7):e0132532. doi: 10.1371/journal.pone.0132532 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 78.Ilhan Z, Solmaz H, Ekin I. In vitro antimicrobial susceptibility of Brucella melitensis isolates from sheep in an area endemic for human brucellosis in Turkey. 2013:12–0163. [DOI] [PubMed] [Google Scholar]
  • 79.Hashim R, Ahmad N, Zahidi M, Tay B, Mohd Noor A, Zainal S, et al. Identification and in vitro antimicrobial susceptibility of Brucella species isolated from human brucellosis. 2014;2014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 80.Hinić V, Brodard I, Thomann A, Cvetnić Ž, Makaya P, Frey J, et al. Novel identification and differentiation of Brucella melitensis, B. abortus, B. suis, sB. ovis, B. canis, and B. neotomae suitable for both conventional and real-time PCR systems. 2008;75(2):375–8. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

All relevant data are within the paper.


Articles from PLoS ONE are provided here courtesy of PLOS

RESOURCES