Super-Resolution Imaging of the Filtration Barrier Suggests a Role for Podocin R229Q in Genetic Predisposition to Glomerular Disease

Significance Statement

Podocin R229Q results from the most frequent missense variant in NPHS2, and its association with FSGS when podocin R229Q is transassociated with a second mutation in NPHS2 is well recognized. However, because results from observational studies are ambiguous and appropriate animal studies are lacking, its isolated pathogenic potency is not entirely clear. In this study, the authors introduced this genetic alteration in mice and assessed the phenotype using super-resolution microscopy and albuminuria measurements. They demonstrated a deleterious effect of the variant on podocyte morphology and on the integrity of the glomerular filtration barrier under basal conditions and after external glomerular injury. Because this finding suggests that this mutation confers a genetic predisposition to glomerular disease, it has implications for a large number of carriers worldwide.

Visual Abstract

Abstract

Background

Diseases of the kidney’s glomerular filtration barrier are a leading cause of end stage renal failure. Despite a growing understanding of genes involved in glomerular disorders in children, the vast majority of adult patients lack a clear genetic diagnosis. The protein podocin p.R229Q, which results from the most common missense variant in NPHS2, is enriched in cohorts of patients with FSGS. However, p.R229Q has been proposed to cause disease only when transassociated with specific additional genetic alterations, and population-based epidemiologic studies on its association with albuminuria yielded ambiguous results.

Methods

To test whether podocin p.R229Q may also predispose to the complex disease pathogenesis in adults, we introduced the exact genetic alteration in mice using CRISPR/Cas9-based genome editing (Pod^R231Q). We assessed the phenotype using super-resolution microscopy and albuminuria measurements and evaluated the stability of the mutant protein in cell culture experiments.

Results

Heterozygous Pod^{R231Q/wild-type} mice did not present any overt kidney disease or proteinuria. However, homozygous Pod^R231Q/R231Q mice developed increased levels of albuminuria with age, and super-resolution microscopy revealed preceding ultrastructural morphologic alterations that were recently linked to disease predisposition. When injected with nephrotoxic serum to induce glomerular injury, heterozygous Pod^{R231Q/wild-type} mice showed a more severe course of disease compared with Pod^{wild-type/wild-type} mice. Podocin protein levels were decreased in Pod^{R231Q/wild-type} and Pod^R231Q/R231Q mice as well as in human cultured podocytes expressing the podocin^R231Q variant. Our in vitro experiments indicate an underlying increased proteasomal degradation.

Conclusions

Our findings demonstrate that podocin R231Q exerts a pathogenic effect on its own, supporting the concept of podocin R229Q contributing to genetic predisposition in adult patients.

Injury to the glomerular filtration barrier, which is composed of glomerular endothelial cells, the glomerular basement membrane, and podocytes, results in albuminuria and podocyte foot process (FP) effacement with or without progression to focal segmental glomerulosclerosis (FSGS).¹ Mutations in NPHS2, encoding the slit diaphragm scaffold protein podocin, are a leading cause for steroid-resistant nephrotic syndrome and FSGS in children.² The podocyte-specific PHB-domain protein podocin interacts with the slit diaphragm Ig superfamily protein nephrin and forms a multimeric protein-lipid supercomplex at the filtration barrier.^3,4 Patients with disease-causing mutations in NPHS2 usually present with childhood onset of disease, but several genetic studies have demonstrated an adolescent or even adult onset in patients with one pathogenic mutation in transassociation with the missense variant R229Q.^5–7 The high allele frequency of 2%–7% in people of European descent and its abundance in FSGS patient cohorts⁸ gave rise to a number of efforts to determine the pathogenic potency of the p.R229Q variant. Although some investigators found an association with albuminuria in the general population,⁹ others only demonstrated a trend but no significant increase in the prevalence of albuminuria in individuals carrying the variant.¹⁰ In R229Q-homozygous individuals, an autosomal-recessive mode of disease with incomplete inheritance and variable severity was proposed.¹¹ In cell culture, the R229Q missense variant has been shown to localize to the plasma membrane unless it is transassociated with certain additional podocin mutations, in which case it is retained in the endoplasmic reticulum.^6,12 Additionally, decreased binding to the core slit diaphragm component nephrin was observed.⁷

In this study, we generated mice homozygous and heterozygous for Pod^R231Q (equivalent to the human R229Q). Using super-resolution stimulated-emission depletion (STED) microscopy, we found evidence for a negative effect of the variant on podocyte ultrastructure preceding the development of microalbuminuria in aged homozygous Pod^R231Q/R231Q mice. Heterozygous Pod^{R231Q/wild-type} mice did not display morphologic alterations under basal conditions. However, they showed signs of more pronounced glomerular damage in comparison with Pod^{wild-type/wild-type} mice upon injecting nephrotoxic serum. In addition to previous in vitro findings, experiments in cultured human podocytes show that podocin R231Q represents a hypomorphic variant with decreased protein levels due to increased proteasomal degradation. In summary, our findings suggest a predisposition to further glomerular injury and highlight the importance of genetic screenings in adult patients with albuminuria.

Methods

Animal Models

All animal experiments were approved by the State Office of North Rhine-Westphalia, Department of Nature, Environment and Consumer Protection (Germany; animal approval nos. AZ 81–02.04.2018.A325 and AZ 84–02_04_2014_A372). All animal experiments were conducted in accordance with European, national, and institutional guidelines. Mice were kept in the Cologne Excellence Cluster on Cellular Stress Responses in Aging-Associated Diseases (CECAD) Research Center, University of Cologne, Germany in the specific and pathogen-free animal facility. Mice were kept in individually ventilated cages (Greenline GM500m Tecniplast) at 22°C and a humidity of 55% under a 12-h light cycle with access to water and food ad libitum. Pod^R231Q mice were previously generated using CRISPR/Cas9-based genome editing in our in vivo research facility (CECAD Research Center University of Cologne, Germany).¹³ All experiments were performed in a pure C57BL/6N background and in male and female mice (combined analyses are presented). The ages of the animals used for the respective experiments are indicated in the figures.

Injections of Nephrotoxic Serum

For the injections of nephrotoxic serum, Pod^{wild-type/wild-type} and Pod^{R231Q/wild-type} mice at 8–10 weeks of age with equal distribution of males and females were injected intravenously with 9 µl/g body wt nephrotoxic serum (Probetex; PTX-001S, San Antonio, TX) on 2 consecutive days. Mice were euthanized 14 days after the induction according to the protocol described in the section Histology Staining. Additional urine samples were collected at day 10 after the first injection.

Genotyping

Mice were genotyped using DNA isolated from ear biopsies. For podocin^R231Q, DNA was amplified by PCR using REDTaq ReadyMix (Sigma-Aldrich) and visualized via gel electrophoresis. For sequencing, DNA was amplified using REDTaq ReadyMix (Sigma-Aldrich) and analyzed by Sanger sequencing (Table 1).

Table 1.

Oligonucleotides

Primers Used	Sequence
Genotyping primers podocinR231Q forward	GCCCGGCTCTATGCTATAAT
Genotyping primers podocinR231Q reverse	ACTGACTGACTGATTCCCCA
Genotyping primers podocinR231Q forward wild type	CGCCTCTTGGCACATCG
Genotyping primers podocinR231Q reverse mutant	CAGGAGAATTTCAGTCAAGCTTT
PCR primer podocinR231Q forward	GCCCGGCTCTATGCTATAAT
PCR primer podocinR231Q reverse	ACTGACTGACTGATTCCCCA
Sequencing primer podocinR231Q	TGGAAAATGCCTCTCTTCTTCT

Urine Analyses

An albumin ELISA (mouse albumin ELISA kit; Bethyl Labs, Montgomery, TX) and a creatinine assay (Cayman Chemical, Ann Arbor, MI) were used to analyze urine samples. Albumin concentrations were divided by creatinine concentrations to obtain the urinary albumin-creatinine ratio (ACR).

Serum Analyses

Blood samples were centrifuged at 3000 rpm and 4°C for 10 min; 100 µl serum was pipetted from the supernatant and subsequently analyzed for creatinine and urea levels in the central laboratory of the University Hospital Cologne, Germany.

Histology Staining

After anesthesia with ketamine (Zoetis) and xylazine (Bayer), cardiac blood draw was performed followed by euthanasia of the experimental mice by cardiac perfusion with HBSS (5.4 mM KCl, 0.3 mM Na₂HPO₄, 0.4 mM KH₂PO₄, 4.2 mM NaHCO₃, 137 mM NaCl, 5.6 mM D-glucose, 1.3 mM CaCl₂, 0.5 mM MgCl₂, and 0.6 mM MgSO₄). Kidneys were then removed and fixed in 4% neutral buffered formalin for 2–4 hours at room temperature or overnight at 4°C. After dehydration and embedding in paraffin, tissue was cut using a microtome (Leica) and transferred on glass slides. Periodic acid–Schiff staining was performed in order to assess glomerulosclerosis. Sections of 1-µm thickness were deparaffinized in xylene and rehydrated using a descending ethanol row. Subsequently, sections were incubated for 10 minutes each in 0.9% periodic acid (Carl Roth, Karlsruhe, Germany), Schiff reagent (Merck, Darmstadt, Germany), and Mayer hematoxylin (Merck). After this, they were dehydrated using an ascending ethanol row and xylene and mounted in Histomount (National Diagnostics, Atlanta, GA). An Axio Observer microscope (Zeiss) was used to acquire images that were further processed with ImageJ/Fiji software version 1.52i (National Institutes of Health, Bethesda, MD). For the quantification of the glomerular area, 100 glomeruli per mouse were encircled. The areas were measured automatically using the ImageJ/Fiji software.

Optical Clearing and Immunolabeling of Kidney Sections

The protocol was performed as previously described.¹³ In brief, formalin-fixed kidney tissue was incubated in hydrogel solution (4% vol/vol acrylamide, 0.25% wt/vol VA-044 initiator, and PBS) at 4°C overnight. Subsequently, acrylamide was polymerized for 3 hours at 37°C. The tissue was removed from the hydrogel solution thereafter and then immersed in clearing solution (200 mM boric acid and 4% SDS, pH 8.5) for 6 hours at 50°C. A vibratome was used to cut the tissue in 0.3-mm-thick slices. After incubation in clearing solution overnight at 50°C, samples were washed in 0.1% Triton X in PBS (PBST) for 10 minutes. For all immunolabeling steps, PBST was used as diluent. Cleared sections were incubated with the primary antibody at 37°C for 24 hours. After washing in PBST (10 minutes at 37°C), the incubation with the secondary antibody followed (24 hours at 37°C). Prior to mounting (see below), sections were again washed with PBST (10 minutes at 37°C). A rabbit antipodocin primary antibody (catalog no. P0372; RRID: AB_261982; 1:100; Sigma-Aldrich) and a donkey anti-rabbit Atto-594 (1:50) were used to stain for podocin. A sheep antinephrin primary antibody (AF4269; 1:100; R&D Systems) or a guinea pig antinephrin (20R-NP002; 1:100; Fitzgerald) and a donkey anti-sheep or a donkey anti–guinea pig Abberior STAR 635P secondary antibody (dilution 1:50) were used to stain for nephrin. The secondary antibodies were conjugated as follows. Fluorophores (Atto-594 NHS ester; catalog no. 08741; Sigma-Aldrich or Abberior STAR 635P NHS ester; catalog no. 07679; Sigma-Aldrich) were conjugated to a donkey anti-rabbit IgG (catalog no. A16037; RRID: AB_2534711; Thermo Fisher Scientific, Bremen, Germany), a donkey anti-sheep IgG (catalog no. A16050; RRID: AB_2534723; Thermo Fisher Scientific), or a donkey anti–guinea pig (706–005–148; Jackson Immuno) antibody; 1 M NaHCO₃ was added to antibody vials at a dilution of 1:10 to ensure basic conjugation conditions. The fluorophores were dissolved in DMSO at a concentration of 10 mg/ml. Fluorophores and antibodies were mixed at a 20-fold molar excess of fluorophores and incubated on a shaker (1 hour at room temperature). A centrifugal filter (Amicon Ultra 0.5 centrifugal filter 30-MW cutoff; catalog no. UFC5030; Sigma-Aldrich) and centrifugation at 14,000×g (10 minutes) were used to remove the excess fluorophores. After filling up with PBS containing 0.1% sodium azide, the centrifugation step was repeated, and PBS containing 0.1% sodium azide was added for a final antibody concentration of 1 mg/ml. Antibodies were stored at −20°C.

Mounting and Imaging of Kidney Sections

Prior to imaging, cleared and immunolabeled sections were immersed for 1 hour at 37°C in 80% wt/wt fructose with 0.5% vol/vol 1-thioglycerol and mounted on a glass-bottomed dish (MatTek P35G-1.5–14-C). A Leica SP8 3× STED system was used to perform imaging.

Quantification of Morphometric Parameters

The quantification of morphometric parameters was done as published previously.¹³

Quantification of Fluorescence Intensities in Mouse Kidney

For the analyses of the fluorescence intensities of nephrin and podocin within STED images of podocin^{wild-type/wild-type}, podocin^{R231Q/wild-type}, and podocin^R231Q/R231Q mice at 24 months of age, only images that were taken in one imaging session with the same microscope settings (in particular, laser power) were directly compared. An ImageJ macro was written that enabled the semiautomated quantification of mean fluorescence intensities within assigned regions of interest. In brief, two-channel images were opened, and a width was defined (150 nm) that was sufficient to include the nephrin staining signal as well as the two neighboring podocin signals along two interdigitating FPs. Then, the freehand tool was used to mark nephrin/podocin staining patterns with an average length of 700 nm (minimum: 300 nm; maximum: 1200 nm). The macro automatically widened the manually assigned line to the previously defined width (150 nm), and the mean fluorescence intensities of the nephrin and the podocin signal within the 150-nm-wide seam along the assigned line were automatically determined. Mean fluorescence intensities of nephrin and podocin in podocin^{wild-type/wild-type} mice were set to one on the y scale. A minimum of 42 independent measurements per mouse (n=3 mice per genotype) in three different images per mouse were performed.

Sample Preparation for Liquid Chromatography-Mass Spectrometry

One piece of kidney cortex per mouse of podocin^{wild-type/wild-type}, podocin^{R231Q/wild-type}, and podocin^R231Q/R231Q mice at 24 months of age (n=3 per genotype) was processed for mass spectrometry. Samples were homogenized in 550 µl urea buffer (8 M) containing 50 mM ammonium bicarbonate, placed in a bioruptor for 10 minutes, and centrifuged for 60 minutes at 20,000×g and 4°C. Ten microliters supernatant per sample was used to determine the protein concentration in each sample using a BCA Protein Assay (Thermo Fisher Scientific). The remaining supernatant was incubated in 10 mM dithiothreitol and 50 mM CAA for 60 minutes at room temperature each. After this, 50 µg protein per sample was digested with 1 µg trypsin at room temperature overnight. After acidic elution of the peptides, a stage-tip clean-up protocol was performed as previously described.¹⁴

Liquid Chromatography-Tandem Mass Spectrometry

A targeted assay was designed to quantify specific nephrin and podocin peptides within the kidney cortex samples (nephrin peptides: ELVLIIGPPDNLAK and SGSTFSR; podocin peptides: ARPDAGAER, MAAEILSGTPAAVQLR, and VALDAVTCIWGIK). Samples were measured on a Q-Exactive Plus mass spectrometer (Thermo Fisher Scientific) coupled to an EASY-nLC 1000 (Thermo Fisher Scientific) using a 1-hour gradient. To ensure reliable results, only peptides with a dot library product >0.9 were used to compare peptide abundances (for nephrin: ELVLIIGPPDNLAK; for podocin: MAAEILSGTPAAVQLR).

Cell Culture

Immortalized human podocytes¹⁵ were cultured at 33°C in RPMI medium 1640 + GlutaMAX (catalog no. 61870036; Gibco) in the presence of 10% FBS and 1× insulin-transferrin-selenium supplement (Sigma-Aldrich). All experiments were performed in undifferentiated human cultured podocytes.

Plasmids and Transduction

For the generation of the podocin^R231Q plasmid, QuikChange mutagenesis was performed on a full-length FLAG-tagged murine podocin pcDNA6 vector to introduce the respective point mutation c.[692G>A]; p.R231Q. For the generation of human cultured podocytes stably expressing FLAG-tagged murine podocin^wild-type or podocin^R231Q, lentiviral gene transfer was used. The respective podocin variants were recombined from the pcDNA6 vector into pLenti 6.3 destination vectors. After virus production in HEK293T cells, the two viruses were separately transduced into human cultured podocytes for 48 hours. After a 24-hour period of incubation in virus-free medium, a blasticidin selection (10 µg/ml) was started and maintained until all control cells in a separate dish died.

Immunoblotting

Cell lysates of human cultured podocytes were run on 10% SDS-PAGE and transferred on low-fluorescence PVDF membranes. Membranes were blocked in 1× Rothiblock (Roth) for 30 minutes at room temperature and then, incubated for 1 hour at room temperature in each case with antibodies diluted in PBST. Primary antibodies used were mouse monoclonal anti-FLAG antibody (catalog no. F3165; RRID: AB_259529; 1:10,000; Sigma-Aldrich) and rabbit monoclonal antiactin antibody (catalog no. 8456; RRID: AB_10998774, 1:1000; Cell Signaling Technology). Fluorescent secondary antibodies used were goat anti-mouse (catalog no. 926–32210; RRID: AB_621842; wavelength 800 nm; 1:20,000; LI-COR Biosciences) and goat anti-rabbit (catalog no. 926–68071; RRID: AB_10956166; wavelength 680 nm; 1:20,000; LI-COR Biosciences). Immunoblots were densitometrically quantified using the LI-COR Image Studio Lite Version 5.2. Quantifications of the podocin bands were always normalized to the quantifications of the actin bands in the respective replicate to ensure comparable proportions.

Cycloheximide Assay

Human cultured podocytes expressing FLAG-tagged podocin^wild-type or podocin^R231Q were treated with cycloheximide (CHX; Roth), an inhibitor of protein translation, at a concentration of 100 ng/ml medium for 30, 60, 90, and 120 minutes prior to harvesting and immunoblotting. Incubation with DMSO served as the control (“0” minutes). To inhibit proteasomal degradation, human cultured podocytes expressing FLAG-tagged podocin^wild-type or podocin^R231Q were incubated with 10 mM/ml MG-132 (Merck) for 4 hours prior to the treatment with CHX.

RNA Purification and Quantitative PCR

RNA of human cultured podocytes expressing FLAG-tagged podocin^wild-type and podocin^R231Q or of kidney cortex of podocin^{wild-type/wild-type} and podocin^R231Q/R231Q mice at 24 months of age was isolated using the Zymo Research Direct-zol RNA miniprep kit (catalog no. R2052; Zymo Research) according to the manufacturer’s instructions. Quality of the RNA was checked measuring absorption in a nanodrop (Thermo Fisher Scientific). Five hundred nanograms RNA was used for reverse transcription using the High-Capacity cDNA Reverse Transcription Kit (catalog no. 4368814; Thermo Fisher Scientific) according to the manufacturer’s instructions. Quantitative PCR was performed using SYBR Green and Taqman master mixes; 25 ng cDNA; and primers for murine nephrin, murine podocin, murine Hprt (housekeeping control in kidney samples), and human HPRT (housekeeping in human cultured podocytes). QuantStudio 12K Flex Real Time PCR System v1.2.2 (Life Technologies) was used for data analysis.

Results

Pod^R231Q/R231Q Mice Do Not Display Overt Glomerular Disease

Podocin is highly conserved in evolution, and murine podocin is 86% identical and 95% similar to the human protein.¹⁶ Using CRISPR/Cas9-mediated genome editing, we previously generated a mouse line carrying the Pod^R231Q allele by inserting a single–base pair change, resulting in an amino acid exchange at position 231 (equivalent to human 229) from arginine to glutamine (Figure 1A).¹³ Heterozygous as well as homozygous Pod^R231Q mice were born at the expected Mendelian ratios (Figure 1B). There were no differences between the genotypes in terms of survival and body weight over 24 months (Figure 1, C and D). As to albuminuria (ACR), Pod^R231Q/R231Q mice but not Pod^{R231Q/wild-type} mice showed a significant increase compared with any of the other groups at 24 months of age (Figure 1E). Specifically, these mice had approximately three-fold higher ACRs than their age-matched wild-type littermates. However, there was no evidence for a marked reduction in kidney function as both serum creatinine and serum urea levels were not significantly elevated in Pod^R231Q/R231Q mice at 24 months of age (Figure 1, F and G). Analysis of the histology did not reveal pathologic findings at either an early stage (2 months) or a late stage (24 months) between the three genotypes (Figure 2, A and B). Glomerular enlargement is observed in a variety of glomerular diseases, including FSGS, and a contribution to disease progression has been suggested in several studies.^17–19 We analyzed the glomerular area in kidney sections of wild-type, Pod^{R231Q/wild-type}, and Pod^R231Q/R231Q mice at 24 months of age and found no significant difference (Figure 2D).

Figure 1.

Pod^R231Q/R231Q mice do not display overt glomerular disease. (A) Schematic illustration of the murine podocin with the respective point mutation and the respective human ortholog. PHB, prohibitin domain; TM, transmembrane domain. (B) Display of genotypes at the age of weaning (approximately 3 weeks) showing no disproportionate distribution (chi-squared test; P=0.15). (C) Survival curve of Pod^{wild-type/wild-type}, Pod^{R231Q/wild-type}, and Pod^R231Q/R231Q mice. There was no significant difference in the life span (n=9 mice in Pod^{wild-type/wild-type}, n=10 mice in Pod^{R231Q/wild-type}, n=11 mice in Pod^R231Q/R231Q). (D) Display of the body weight of Pod^{wild-type/wild-type} and Pod^R231Q/R231Q mice. There was no significant difference in the body weight (n=5 mice per genotype). (E) Urinary ACR (albumin creatinine ratio) of Pod^{wild-type/wild-type}, Pod^{R231Q/wild-type}, and Pod^R231Q/R231Q mice at 2 and 24 months of age. Pod^R231Q/R231Q mice displayed a significantly higher ACR than any other group. The Tukey multiple comparisons test was used to determine statistical significance. Data are presented as mean±SD. ***P<0.001; ****P<0.0001. (F) Serum creatinine and (G) serum urea levels of Pod^{wild-type/wild-type}, Pod^{R231Q/wild-type}, and Pod^R231Q/R231Q mice at 24 months of age. There was no statistically significant difference between the genotypes. The Tukey multiple comparisons test was used to determine statistical significance. Data are presented as mean±SD.

Figure 2.

Pod^R231Q/R231Q mice do not display histologic alterations. Periodic acid–Schiff reaction of (A) Pod^{wild-type/wild-type}, (B) Pod^{R231Q/wild-type}, and (C) Pod^R231Q/R231Q mice at 2 and 24 months of age. Pod^{wild-type/wild-type} mice did not develop FSGS lesions. Scale bars, 200 µm in (A)–(C); 50 µm in insets in (A)–(C). (D) There was no significant difference in glomerular size between Pod^{wild-type/wild-type} (black circles), Pod^{R231Q/wild-type} (light gray diamonds with black contours), and Pod^R231Q/R231Q (dark gray triangles) mice at 24 months of age (n=4 mice per genotype). The Tukey multiple comparisons test was used to determine statistical significance. Data are presented as mean±SD.

Pod^R231Q/R231Q Mice Display Altered Podocyte Morphology and Increased Albumin Excretion

We went on to analyze the staining pattern of podocin and its binding partner nephrin using immunofluorescence microscopy. We applied super-resolution STED microscopy to optically cleared kidneys of wild-type, Pod^{R231Q/wild-type}, and Pod^R231Q/R231Q mice at different ages to assess the FP morphology (Figure 3) as was initially described,²⁰ later automatized,²¹ and further developed.¹³ In wild-type and Pod^{R231Q/wild-type} mice at 2 and 24 months of age, a regular staining pattern of nephrin and podocin was observed (Figure 3, A, top and middle panels, and B, top and middle panels), and the capillary surface was covered with a dense network of FPs. In Pod^R231Q/R231Q mice, the podocin variant and concomitantly, nephrin also correctly localized to the slit diaphragm (Figure 3, A, bottom panel and B, bottom panel). However, already at 2 months and even more pronounced at 24 months of age, the FP pattern appeared less dense in Pod^R231Q/R231Q as compared with wild-type and Pod^{R231Q/wild-type} mice. We quantified morphologic alterations over time by measuring the slit diaphragm length represented by the nephrin staining, the FP circularity, and the FP area at 2 and 24 months of age (Figure 4, A–C). The slit diaphragm length represents the automatically detected length of the nephrin signal within a manually assigned region of interest (Supplemental Figure 1). The FP area is calculated for each individual FP. FP circularity is a dimensionless measure for the shape of a given geometric body. The values vary between zero and one, with a value approaching zero representing an elongated polygon, whereas a value of one represents a perfect circle (Supplemental Figure 1). Within wild-type mice, there was a significant decrease in slit diaphragm length per area (Figure 4A) and a significant increase in FP circularity (Figure 4B) between young and aged mice, indicating that this remodeling of the FP pattern is a physiologic process during aging. In homozygous Pod^R231Q/R231Q animals, slit diaphragm length (Figure 4A) and FP circularity (Figure 4B) were significantly altered as compared with age-matched wild-type and Pod^{R231Q/wild-type} littermates at 2 months. On the basis of their slit diaphragm length and FP circularity, their FP morphology resembles the morphology of 24-month-old wild-type and Pod^{R231Q/wild-type} mice. Both parameters further worsened (decrease for slit diaphragm length and increase for FP circularity) significantly during aging. Notably, FP area remained unchanged between all groups and ages (Figure 4C). There was no significant difference in terms of slit diaphragm length and FP circularity between wild-type and Pod^{R231Q/wild-type} mice, indicating no negative effect of heterozygosity under basal conditions. Consistent with our previously published observation, the slit diaphragm length and the FP circularity correlated significantly with the ACR among the experimental mice (Figure 4, D and E). Collectively, these findings demonstrate a negative effect of the podocin^R231Q variant on podocyte morphology, leading to a decreased slit diaphragm length and changes in FP circularity. In addition, the morphologic alterations are also associated with a dysfunction of the glomerular filtration barrier.

Figure 3.

STED microscopy reveals alterations in the staining pattern of podocin and nephrin in Pod^R231Q/R231Q mice. STED microscopy after immunolabeling of podocin and nephrin in Pod^{wild-type/wild-type}, Pod^{R231Q/wild-type} and Pod^R231Q/R231Q mice at (A) 2 and (B) 24 months of age. The staining pattern of podocin and nephrin appears less dense in Pod^R231Q/R231Q mice. Scale bars, 2 µm.

Figure 4.

Morphologic alterations are evident in Pod^R231Q/R231Q mice. (A–C) Measurements of the slit diaphragm length, the FP circularity, and the FP area in Pod^{wild-type/wild-type} (black circles), Pod^{R231Q/wild-type} (light gray diamonds with black contours), and Pod^R231Q/R231Q (dark gray triangles) mice at 2 and 24 months of age. Young (2-month-old) and aged (24-month-old) Pod^R231Q/R231Q mice have a significantly decreased slit diaphragm length and increased FP circularity as compared with the other two genotypes. The morphologic alterations are progressing with aging. The FP area is unaltered among all genotypes and ages. The Tukey multiple comparisons test was used to determine statistical significance. Data are presented as mean±SD. *P=0.05; **P=0.01; ***P<0.001; ****P<0.0001. Plotting the values for the ACRs (albumin creatinine ratios) against (D) the slit diaphragm length and (E) the FP circularity reveals a significant correlation (n=33 mice). Spearman rank correlation was used to determine statistical significance. r = Spearman rank coefficient; p = Spearman correlation. (F) Measuring the ratio of fluorescence intensity of podocin/nephrin in Pod^{wild-type/wild-type} (black circles), Pod^{R231Q/wild-type} (light gray diamonds), and Pod^R231Q/R231Q (dark gray triangles) mice at 24 months of age reveals a significant decrease of podocin relative to nephrin in Pod^R231Q/R231Q mice. Each cluster represents one mouse with independent measurements from five different images. The mean of each mouse was used test for statistical significance using the Tukey multiple comparisons test. Data are presented as mean±SD. SD in (A) and (D) refers to slit diaphragm. A. U., arbitrary unit. **P=0.01; ***P<0.001.

Pod^{R231Q/wild-type} Mice Are More Severely Affected When Challenged with Nephrotoxic Serum

We next investigated whether Pod^{R231Q/wild-type} mice are more susceptible to glomerular injury, although there is no apparent phenotype at baseline. To this end, the nephrotoxic nephritis model was used to induce acute glomerular injury and albuminuria.²² Fourteen days after the induction, several histopathologic signs of injury were present in both genotypes, such as protein casts, glomerular sclerosis, and tuft adhesions (Figure 5A). Interestingly, although mice of both genotypes gained weight due to ascites formation throughout the course of nephrotoxic nephritis, the increase in body weight in Pod^{R231Q/wild-type} mice was more pronounced than in wild-type littermates (Figure 5B). Fitting a linear regression revealed a significant slope in Pod^{R231Q/wild-type} but not in Pod^{wild-type/wild-type} mice. All mice developed albuminuria with a peak in ACR at day 10 after the injection and a partial recovery at day 14, as was previously reported (Figure 5, C and D).²³ At day 10, the median ACR was four-fold higher in Pod^{R231Q/wild-type} than in Pod^{wild-type/wild-type} mice (Figure 5C), narrowly missing statistical significance (P=0.07) due to the large variance of the values. We then performed STED microscopy to assess the FP morphology 14 days after the injections. As expected, morphologic alterations were present in all injected mice (Figure 5E). However, the decrease in slit diaphragm length was significantly stronger in Pod^{R231Q/wild-type} as compared with Pod^{wild-type/wild-type} mice (Figure 5, F and G). Plotting the ACRs against the slit diaphragm length of each animal again revealed a robust correlation between ACR and slit diaphragm length (Figure 5H). Taken together, these results show that Pod^{R231Q/wild-type} mice are more severely affected by the nephrotoxic serum.

Figure 5.

Pod^{R231Q/wild-type} mice are more severely affected by nephrotoxic serum–induced glomerular damage. (A) Periodic acid–Schiff reaction of Pod^{wild-type/wild-type} (left panel) and Pod^{R231Q/wild-type} (right panel) mice 14 days after injecting nephrotoxic serum. Mice of both genotypes depicted signs of glomerular injury, like protein casts (black arrow), glomerulosclerosis (black star), and tuft adhesions (black arrowhead). (B) Weight curve of Pod^{wild-type/wild-type} (black circles) and Pod^{R231Q/wild-type} (light gray diamonds with black contours) after injecting nephrotoxic serum (n=6 for Pod^{wild-type/wild-type} mice, and n=7 Pod^{R231Q/wild-type} mice). Light gray and black lines and P values indicate the results of the simple linear regression. (C and D) ACRs (albumin creatinine ratios) (C) 10 and (D) 14 days after injecting nephrotoxic serum. The Mann–Whitney U test was used to determine statistical significance. P=0.05 was considered statistically significant. Day 10: n=4 (Pod^{wild-type/wild-type}), and n=6 (Pod^{R231Q/wild-type}) mice. Urine could not be obtained from two Pod^{wild-type/wild-type} mice and one Pod^{R231Q/wild-type} mouse. Day 14: n=6 (Pod^{wild-type/wild-type}), and n=7 (Pod^{R231Q/wild-type}) mice. (E) STED microscopy after immunolabeling of nephrin in Pod^{wild-type/wild-type} and Pod^{R231Q/wild-type} mice at day 14 after injecting nephrotoxic serum. (F) Quantification of the slit diaphragm length per area in Pod^{wild-type/wild-type} (black circles) and Pod^{R231Q/wild-type} (light gray diamonds with black contours) 14 days after injecting nephrotoxic serum. Each circle/diamond represents one mouse. At least five images per mouse were used for the quantification. The Mann–Whitney U test was used to determine statistical significance. n=6 (Pod^{wild-type/wild-type}) and n=7 (Pod^{R231Q/wild-type}) mice. *P<0.05. (G) Quantification of the slit diaphragm length per area in Pod^{wild-type/wild-type} (black circles) and Pod^{R231Q/wild-type} (light gray diamonds with black contour) 14 days after injecting nephrotoxic serum. Each circle/diamonds represents the mean slit diaphragm length per area of each image used. At least five images per mouse were used for the quantification. An unpaired t test was used to determine statistical significance. n=48 Pod^{wild-type/wild-type} images, and n=49 Pod^{R231Q/wild-type} images. ****P<0.0001. (H) Plotting the values for the ACRs against the slit diaphragm length reveals a significant correlation (n=13 mice). Each square represents one mouse. n=6 Pod^{wild-type/wild-type} mice, and n=7 Pod^{R231Q/wild-type} mice. Spearman rank correlation was used to determine statistical significance. r = Spearman rank coefficient; p = Spearman correlation. Data are presented as mean±SEM. SD in (F–H) refers to slit diaphragm. (A and E) Scale bars correspond to 200 µm (overview) and 50 µm (inset), respectively.

Podocin^R231Q Is a Hypomorphic Variant with Decreased Protein Levels

Podocin deficiency is known to cause severe disruption of FP morphology in mice,²⁴ which is why we examined the global abundance of the podocin^R231Q proteoform in the kidney and its abundance at the slit diaphragm. To investigate the latter, we measured the fluorescence intensities of nephrin and podocin along the slit diaphragm in STED images of wild-type, Pod^{R231Q/wild-type}, and Pod^R231Q/R231Q mice at 24 months of age (Figure 4F, Supplemental Figure 2). To compensate for possible overall differences in signal intensities, we normalized podocin to nephrin intensities. The ratio of podocin to nephrin along the slit diaphragm was decreased in Pod^R231Q/R231Q mice, whereas there was no difference between wild-type and Pod^{R231Q/wild-type} mice. Decreased protein levels of podocin^R231Q at the slit diaphragm could be due to globally lowered podocin abundance and/or less efficient membrane targeting of the variant, a known pathomechanism of several podocin variants.^6,25–27 We investigated the former by quantifying nephrin and podocin mRNA as well as protein levels by real-time quantitative PCR and mass spectrometry, respectively. There were no significant differences in either nephrin or podocin mRNA levels between Pod^R231Q/R231Q and wild-type mice at 24 months of age (Figure 6, A and B). Analyses of the protein levels with a parallel reaction monitoring targeted quantification method in wild-type, Pod^{R231Q/wild-type}, and Pod^R231Q/R231Q mice at 24 months of age revealed no significant difference in nephrin (Figure 6C) but a significant decrease in both Pod^{R231Q/wild-type} and Pod^R231Q/R231Q mice in podocin abundance (Figure 6D). Taken together, these results suggest a deficiency in protein stability.

Figure 6.

Podocin abundance is decreased in Pod^{R231Q/wild-type} and Pod^R231Q/R231Q mice. (A and B) Quantitative PCRs of nephrin and podocin mRNA in Pod^{wild-type/wild-type} (black circles) and Pod^R231Q/R231Q (gray triangles) mice. There were no statistically significant differences between both genotypes. Hprt was used as the homekeeping gene. mRNA was isolated from kidney cortex. The Mann–Whitney U test was used to determine statistical significance. (C and D) Quantifications of nephrin and podocin peptides from kidney cortex of Pod^{wild-type/wild-type} (black circles), Pod^{R231Q/wild-type} (light gray diamonds with black contours), and Pod^R231Q/R231Q (dark gray triangles) mice at 24 months of age (n=3 mice per genotype) in a targeted mass spectrometry approach. Whereas there was no significant difference in nephrin abundance, the podocin abundance was significantly decreased in both Pod^{R231Q/wild-type} and Pod^R231Q/R231Q mice as compared with wild-type littermates. A BCA protein assay was performed to ensure equal protein content of the samples. The Tukey multiple comparisons test was used to determine statistical significance. All data are presented as mean±SEM. *P<0.05; **P<0.01. (E) Representative immunoblots of undifferentiated human cultured podocytes expressing FLAG-tagged podocin^wild-type or podocin^R231Q using antibodies against the FLAG tag (upper panel) and human actin (lower panel). HPRT, hypoxanthine guanine phosphoribosyl transferase; IB, immunoblot; A. U., arbitrary unit; FLAG, FLAG protein tag (sequence: DYKDDDDK); BCA, bicinchoninic acid assay.

Podocin^R231Q Is Subject to Increased Proteasomal Degradation

We next characterized the podocin^R231Q variant using undifferentiated human cultured podocytes as a model. We generated podocyte cell lines stably overexpressing either podocin^wild-type or podocin^R231Q. Similar to our measurements in kidney tissue, mRNA levels of podocin were not significantly different between podocytes expressing podocin^wild-type or podocin^R231Q (Supplemental Figure 3A), whereas there was a marked reduction in the protein levels of podocin^R231Q (Figure 6E, Supplemental Figure 3B). The decoupling of mRNA and protein levels in podocin^R231Q indicates a decrease in protein stability. To investigate this further, we treated the cell lines with CHX (cycloheximide), an inhibitor of translation (Figure 7, A and B). Treatment with CHX resulted in significantly faster degradation of podocin^R231Q as compared with podocin^wild-type (Figure 7C), confirming a decreased protein stability of podocin^R231Q. It was previously demonstrated that wild-type podocin is degraded via the proteasomal and lysosomal proteolytic machineries, whereas certain podocin variants are heavily degraded by the proteasome.^22,23 Treating the cell lines with MG-132, an inhibitor of the proteasome, prior to and during the course of CHX incubation (Figure 7, D and E) abolished the difference in protein stability between podocin^wild-type and podocin^R231Q (Figure 7F). Although podocin stability in podocin^wild-type expressing podocytes also increased upon MG-132 treatment (Figure 7G), the rescue effect was much larger in cells expressing podocin^R231Q (Figure 7H). These findings show how increased proteasomal degradation leads to lower protein levels in cultured podocytes expressing podocin^R231Q.

Figure 7.

Podocin^R231Q is subject to faster degradation in immortalized human cultured podocytes. Representative immunoblots of undifferentiated human cultured podocytes expressing (A) FLAG-tagged podocin^wild-type and (B) FLAG-tagged podocin^R231Q using antibodies against the FLAG tag and human actin upon treatment with CHX (100 ng/ml medium) for the indicated periods of time. (C) Protein abundance of FLAG-tagged podocin^wild-type (black circles) and podocin^R231Q (gray triangles) in human cultured podocytes normalized to human actin upon treatment with CHX depicted as the log₂ decrease relative to time point 0. Protein abundance was determined by densitometry in western blots. Podocin^R231Q (gray triangles) abundance was significantly decreased after 60, 90, and 120 minutes (n=12 biologic replicates). Representative immunoblots of human cultured podocytes expressing (D) FLAG-tagged podocin^wild-type and (E) FLAG-tagged podocin^R231Q using antibodies against the FLAG tag and human actin upon treatment with CHX for the indicated periods of time without and with addition of MG-132 (concentration: 10 mM), an inhibitor of proteasomal degradation. (F) Comparison of protein abundance of FLAG-tagged podocin^wild-type (black circles) or podocin^R231Q (gray triangles) upon coincubation with CHX and MG-132. There was no statistically significant difference (n=6 biologic replicates). (G and H) Protein abundance of FLAG-tagged podocin^wild-type (B; black circles) and podocin^R231Q (C; gray triangles) in human cultured podocytes normalized to human actin upon treatment with CHX with (continuous lines) or without (dotted lines) MG-132 depicted as the log₂ decrease relative to time point 0. Protein abundance was determined by densitometry in western blots. Podocin^R231Q (gray triangles) abundance was significantly increased after 60, 90, and 120 minutes upon coincubation with MG-132 (n=12 biologic replicates without MG-132, and n=6 biologic replicates with MG-132). DMSO was used as the vehicle control for all experiments. Cells were collected at one time point. Mann–Whitney U tests were used to determine statistical significance. Data are presented as mean±SD. *P<0.05; **P<0.01; ***P<0.001. B, immunoblot; FLAG, FLAG protein tag (sequence: DYKDDDDK).

Discussion

The contribution of the frequent podocin missense variant R229Q to the development of FSGS and/or nephrotic syndrome is well accepted in cases in which R229Q is transassociated with a second pathogenic mutation in NPHS2.^{2,5,7,11,28–31} On the basis of these studies, it became evident that R229Q displays its most obvious pathogenic potency in the presence of additional mutations. Population-based studies on the association of R229Q with the most prominent symptom of glomerular disease, albuminuria, have produced inconclusive results.^9,10 R229Q was, therefore, regarded as disease modifying rather than disease causing.^6,32 This is supported by the presence of heterozygous and homozygous R229Q carriers among healthy individuals.^9–11 Given a 3.7% allele frequency of R229Q in a cohort of White United States Americans,¹⁰ 1.4 in 1000 are predicted to be homozygous for R229Q. Although this adds up to >300,000 affected people in the United States alone, it illustrates how challenging a comprehensive epidemiologic assessment of R229Q is given the requirements regarding the number of participants. To circumvent this challenge, we analyzed the effect of the equivalent murine R231Q variant in vivo and in vitro.

Recently, we have mechanistically linked defined alterations in slit diaphragm abundance to the occurrence of albuminuria¹³ and to changes in physical forces possibly contributing to podocyte detachment.³³ Moreover, we have established the circularity of FPs as a sensitive parameter for pathologic changes in podocyte morphology.¹³ In this study, we found that podocin R231Q did not result in the development of nephrotic syndrome and/or FSGS in mice homozygous for the mutation. However, we observed robust increases in FP circularity in young adult (2-month-old) Pod^R231Q/R231Q mice as well as in aged (24-month-old) Pod^R231Q/R231Q mice. Increasing values of FP circularity reflect an increase in the proportion of the area to the perimeter of a geometric body. Consequently, values increase when a body becomes more circular as the maximum relation of area to perimeter is given in a circle. Because the FP area in Pod^R231Q/R231Q mice was not significantly larger than in wild-type littermates, the increase in FP circularity necessarily reflected a parallel shortening and widening of FPs. FP widening is a well-known and well-characterized feature of podocyte injury and the hallmark of FP effacement.^34,35 The observed alterations in FP morphology eventually resulted in a significantly decreased slit diaphragm length in aged Pod^R231Q/R231Q mice and concomitantly, in increased levels of albuminuria. In a previous study, we found that slit diaphragm length and FP circularity correlated significantly with albuminuria in a mouse model for hereditary FSGS.¹³ We used a known disease-causing combination of two NPHS2 point mutations in the mouse (murine equivalents to human podocin^R229Q and podocin^A284V) to establish morphometric parameters, such as slit diaphragm length per area and FP circularity, as indicators of disease severity and predictors of albuminuria levels. In the study at hand, we show that slit diaphragm length and FP circularity also correlate with albuminuria in a population of healthy and only very mildly affected Pod^R231Q/R231Q mice. Combining the analyses of morphology and function of the glomerular filtration barrier allowed us to identify the degree of slit diaphragm length decrease from which albuminuria significantly increased. In our model, this was a slit diaphragm length per area value of approximately 2.5, a score only reached in aged Pod^R231Q/R231Q mice. Already under basal conditions and without an additional harming event, Pod^R231Q/R231Q mice developed albuminuria, which is known to predispose to cardiovascular disease and renal dysfunction.^36,37 We also analyzed FP morphology of heterozygous Pod^{R231Q/wild-type} mice and found no difference in comparison with age-matched wild-type littermates. This is in line with previous studies that have not observed phenotypic abnormalities in Nphs2^+/− mice²⁴ and the general perception that NPHS2-associated diseases are inherited autosomal recessively.⁶ However, upon inducing glomerular injury by injecting nephrotoxic serum, Pod^{R231Q/wild-type} mice did gain significantly more weight over time through ascites formation, had a significantly stronger decrease in slit diaphragm length, and tended to be more albuminuric than age-matched wild-type controls.

These findings strongly emphasize a pathogenicity of R231Q in mice and therefore, presumably R229Q in humans that only becomes overt in elderly homozygous individuals or in combination with comorbidities known to have a detrimental effect on glomerular physiology.

Our data indicate that the podocin R229Q proteoform not only exerts its negative effect when present in transassociation with a pathogenic allele but already on its own confers a genetic predisposition for podocyte damage to the carrier. This is supported by the observation of an increased occurrence of albuminuria in obese R229Q carriers.⁹ Considering the high allele frequency as well as the significance of albuminuria as an independent risk factor for ESKD and cardiovascular disease,^36,37 the association of podocin R229Q with albuminuria and renal impairment should be evaluated in large population-based observational studies. Mechanistically, we found podocin levels to be decreased globally in kidney samples of Pod^{R231Q/wild-type} and Pod^R231Q/R231Q mice as compared with wild-type littermates, which implies a deficiency of the podocin^R231Q proteoform. The globally decreased protein levels in mice are potentially caused by the increased proteasomal degradation of podocin^R231Q we demonstrated in human cultured podocytes. Strikingly, the ratio of podocin to nephrin fluorescence intensity at the slit diaphragm was unaltered in Pod^{R231Q/wild-type} mice compared with wild-type littermates, whereas the ratio was decreased in Pod^R231Q/R231Q mice, indicating a locally decreased abundance at the slit diaphragm. This might suggest an additional inefficiency in membrane trafficking of podocin^R231Q, although the fate of the podocin^R231Q proteoform that escapes proteasomal degradation has yet to be determined. A less efficient membrane targeting of the podocin^R231Q variant has been shown before, although only in transassociation with a second pathogenic mutation.⁶ Given the role of podocin as a scaffolding protein,³⁸ a reduction at the slit diaphragm is the likeliest explanation for the observed negative effect on FP morphology in Pod^R231Q/R231Q mice. It is, therefore, intriguing to speculate that FP morphology in Pod^{R231Q/wild-type} mice is preserved through a local predominance of podocin^wild-type over podocin^R231Q at the slit diaphragm, even though the podocin abundance is globally decreased.

Collectively, we presented evidence for a pathogenicity of podocin^R231Q resulting in the development of albuminuria in aged Pod^R231Q/R231Q mice, which indicates an increased risk of ESKD and cardiovascular disease. Lastly, by demonstrating a more severe effect of the nephrotoxic serum in Pod^{R231Q/wild-type} mice, we found indications for a genetic predisposition to glomerular injury in heterozygous carriers already.

Disclosures

T. Benzing reports consultancy agreements via advisory activity for Otsuka in the field of cystic kidney disease and hyponatremia; research funding support for the autosomal dominant polycystic kidney disease registry by Otsuka; speaker honoraria and travel support from Amgen, Hexal, Novartis, Otsuka, Roche, and Sanofi-Genzyme; and scientific advisor or membership via editorial boards of JASN, Nephrology Dialysis Transplantation, and Science Signaling. H. Blom reports other interests/relationships with BioClinicum, Karolinska University Hospital (Solna, Sweden), and MedTechLabs. P. T. Brinkkötter reports honoraria from Alexion, Bayer, Bristol Meyers Squibb, Pfizer, Sanofi Genzyme, and Travere. M. M. Rinschen reports honoraria from JASN and Physiological Genomics and scientific advisor or membership via the editorial board of American Physiology–Renal Physiology, the editorial board of JASN, and the editorial board of Physiological Genomics. All remaining authors have nothing to disclose.

Funding

This work was supported by Deutsche Forschungsgemeinschaft grants BR4917/3, FOR2743, and KFO329; Bundesministerium für Bildung und Forschung grant BMBF 01-GM1901E (to T. Benzing and P.T. Brinkkötter), Novo Nordisk Fonden grant NNF19OC0056043 (to M.M. Rinschen), and Universität zu Köln grant Center of Molecular Medicine Cologne Clinician Scientist Program (to S. Brähler). This work was partially funded by Else Kröner-Fresenius-Stiftung grant Project No: 2019_KollegSE.04 and Eva Luise und Horst Köhler Stiftung grant Project No: 2019_KollegSE.04 (to L. Butt).

Data Sharing Statement

All data are available upon request.

Supplemental Material

This article contains the following supplemental material online at http://jasn.asnjournals.org/lookup/suppl/doi:10.1681/ASN.2020060858/-/DCSupplemental.

Supplemental Figure 1. Quantification of morphologic parameters.

Supplemental Figure 2. The fluorescence intensity ratio of podocin to nephrin is decreased in Pod^R231Q/R231Q mice as compared with wild-type littermates.

Supplemental Figure 3. Podocin R231Q is less abundant in immortalized human cultured podocytes .