Skip to main content
BMC Veterinary Research logoLink to BMC Veterinary Research
. 2022 Jan 18;18:43. doi: 10.1186/s12917-022-03144-4

Development of a one-step multiplex qRT–PCR assay for the detection of African swine fever virus, classical swine fever virus and atypical porcine pestivirus

Huixin Liu 1,#, Kaichuang Shi 1,2,✉,#, Jing Zhao 1, Yanwen Yin 2, Yating Chen 1, Hongbin Si 1,, Sujie Qu 2, Feng Long 2, Wenjun Lu 2
PMCID: PMC8764768  PMID: 35042532

Abstract

Background

African swine fever virus (ASFV), classical swine fever virus (CSFV) and atypical porcine pestivirus (APPV) have caused great economic losses to the swine industry in China. Since coinfections of ASFV, CSFV and APPV occur in certain pig herds, it is necessary to accurately and differentially detect these pathogens in field-collected samples. In this study, a one-step multiplex real-time quantitative reverse transcription-polymerase chain reaction (multiplex qRT–PCR) was developed for the simultaneous and differential detection of ASFV, CSFV and APPV.

Results

The one-step multiplex qRT–PCR presented here was able to simultaneously detect ASFV, CSFV and APPV but could not amplify other viruses, including porcine circovirus type 2 (PCV2), pseudorabies virus (PRV), porcine reproductive and respiratory syndrome virus (PRRSV), foot-and-mouth disease virus (FMDV), porcine parvovirus (PPV), porcine epidemic diarrhoea virus (PEDV), transmissible gastroenteritis virus (TGEV), porcine rotavirus (PRoV), porcine deltacoronavirus (PDCoV), border disease virus (BDV), bovine viral diarrhoea virus type 1 (BVDV-1), BVDV-2, etc. The limit of detection (LOD) of the assay was 2.52 × 101 copies/μL for ASFV, CSFV and APPV. A repeatability test using standard recombinant plasmids showed that the intra- and interassay coefficients of variation (CVs) were less than 2%. An assay of 509 clinical samples collected in Guangxi Province, southern China, from October 2018 to December 2020 showed that the positive rates of ASFV, CSFV and APPV were 45.58, 12.57 and 3.54%, respectively, while the coinfection rates of ASFV and CSFV, ASFV and APPV, CSFV and APPV were 4.91, 1.38, 0.98%, respectively. Phylogenetic analysis based on the nucleotide sequences of the partial ASFV p72 gene showed that all ASFV strains from Guangxi Province belonged to genotypes I and II.

Conclusion

A one-step multiplex qRT–PCR with high specificity, sensitivity and repeatability was successfully developed for the simultaneous and differential detection of ASFV, CSFV and APPV.

Background

African swine fever virus (ASFV) is an enveloped double-stranded DNA virus and the only member of the genus Asfivirus in the family Asfarviridae [1]. This virus causes African swine fever (ASF), a notifiable disease to the World Organization for Animal Health (OIE) characterized by high fever, extensive haemorrhage, pulmonary oedema and intensive lymphoid tissue necrosis, and it presents high morbidity and mortality [2]. ASF was first identified in Kenya in the 1920s, Europe in 1957, the Caucasus region and southern Russia in 2007 [3, 4], and China in August 2018 [5], where it rapidly spread to most provinces in China within a short time and adversely affected the swine industry [6]. Furthermore, ASF has been reported in other Asian countries, such as Mongolia, Korea, Vietnam, Laos, Cambodia, the Philippines, and Indonesia, since the end of 2018 [7]. ASF was recently reported again in the Dominican Republic in July 2021 (OIE-WAHIS, https://wahis.oie.int/#/report-info?reportId=36844) and Haiti in August 2021 [8], and these reports occurred almost 40 years after the last outbreak of ASF in these countries. ASF has caused severe economic losses to the swine industry worldwide since the 1920s.

Classical swine fever virus (CSFV) is an enveloped single-stranded, positive-sense RNA virus that belongs to the Pestivirus genus of the Flaviviridae family [9]. CSFV causes classical swine fever (CSF), another notifiable disease of OIE, and it is characterized by high fever, leukopenia, extensive haemorrhage, convulsion and constipation or diarrhoea and presents high morbidity and mortality [10]. CSF was first reported in Ohio, USA, in 1833, and it is still prevalent in many countries worldwide [11, 12]. Although the Chinese C-strain vaccine of CSFV was developed in the 1950s and has been widely used in the field since then, CSF is still sporadic in many regions in China [13, 14]. One explanation for this finding is that many circulating pathogens in China, such as PRRSV and PCV2, can cause immunosuppression [15, 16], which impairs the effect of vaccination with the C-strain vaccine. Another reason is that the circulating CSFVs in the field have high genetic diversity [17, 18], which results in incomplete protection for pig herds even if vaccinated with the C-strain vaccine.

Atypical porcine pestivirus (APPV), a newly discovered virus, is an enveloped single-stranded, positive-sense RNA virus that belongs to the Pestivirus genus of the Flaviviridae family [19]. It was first discovered in the USA in 2015 [20] and subsequently reported in many other countries in America, Asia and Europe [19, 21]. APPV is a possible causative agent of type A-II congenital tremor (CT) in newborn piglets, which is characterized by generalized body shaking with variable degrees of hypomyelination in the brain and spinal cord [20, 22] and similar to type A-I CT caused by CSFV [23].

ASFV, CSFV and APPV are still prevalent in many countries and cause huge economic losses to the swine industry worldwide. ASF and CSF show similar clinical symptoms and pathological changes, such as high fever, leukopenia, extensive haemorrhage, constipation or diarrhoea, and high mortality [2, 10]. Type A-II CT caused by APPV shows similar clinical manifestations to type A-I CT caused by CSFV in newborn piglets [22, 23]. Therefore, differentiating these diseases in the field is difficult. Furthermore, ASFV, CSFV and APPV were simultaneously prevalent in some countries, and coinfections of these pathogens have been observed in pig herds [24, 25]. Therefore, it is very important to differentially detect these pathogens by laboratory test methods for clinical diagnosis. Currently, several differential polymerase chain reaction (PCR)/reverse transcription (RT)-PCR and real-time quantitative PCR (qPCR)/qRT–PCR assays have been developed for the detection of ASFV [26, 27], CSFV [28, 29], APPV [30], ASFV/CSFV [31, 32] and ASFV/CSFV/APPV [24]. However, a qRT–PCR assay capable of simultaneous and differential detection of ASFV, CSFV and APPV has not been previously reported. Therefore, the objective of this study was to develop a specific, sensitive and reproducible one-step multiplex qRT–PCR for the simultaneous and differential detection of ASFV, CSFV and APPV.

Results

Construction of standard recombinant plasmids

The target fragments of the ASFV p72 gene, the CSFV 5′ untranslated region (UTR) and the APPV 5′UTR, were amplified by PCR/RT–PCR, purified and ligated to the pMD18-T vector (TaKaRa, Dalian, China), and then transferred into E. coli DH5α competent cells. The positive clones were cultured, and the plasmid constructs were extracted, and then their concentrations were determined by ultraviolet absorbance at 260 nm and 280 nm. The results showed that the original concentrations of the three constructed plasmids, which were named p-ASFV, p-CSFV and p-APPV, were 2.65 × 1010 copies/μL, 2.52 × 1010 copies/μL, and 3.02 × 1010 copies/μL, respectively. These plasmids were used as positive standard plasmids for the optimization of different reaction conditions and for sensitivity and repeatability of the multiplex qRT–PCR.

Optimal parameters of the multiplex qRT–PCR

After optimization, the reaction conditions, including the annealing temperature, primer and probe concentrations, amplification cycles, etc., were obtained. The reaction mixture of the developed multiplex qRT–PCR was as follows: 10 μL of 2× One Step RT–PCR Buffer III (TaKaRa, Dalian, China), 0.4 μL of Ex Taq HS (5 U/μL) (TaKaRa, Dalian, China), 0.4 μL of PrimeScript RT Enzyme Mix II (RNA/DNA) (TaKaRa, Dalian, China), 0.4 μL of each of ASFV, CSFV and APPV primers (20 pmol/μL), 0.5 μL of ASFV-p72-P (20 pmol/μL), 0.4 μL of CSFV-5′UTR-P (20 pmol/μL), 0.3 μL of APPV-5′UTR-P (20 pmol/μL), 2.0 μL of total DNA/RNA, and distilled water to a total volume of 20 μL. The amplification parameters were as follows: reverse transcription at 42 °C for 5 min; inactivation at 95 °C for 10 s; and 40 cycles of denaturation at 95 °C for 5 s and annealing and extension at 59 °C for 34 s. The fluorescent signals were determined at the end of each cycle.

Standard curves of the multiplex qRT–PCR

To generate the standard curves of the multiplex qRT–PCR, the standard plasmids of p-ASFV, p-CSFV and p-APPV were mixed together and then serially diluted 10-fold to final concentrations of each plasmid of 2.52 × 108 to 2.52 × 100 copies/μL (5.04 × 108 to 5.04 × 100 copies per reaction). The results showed that the corresponding slope of the equation, correlation coefficient (R2), and amplification efficiency (E) were − 3.065, 0.999, and 89.419% for ASFV, respectively; − 3.640, 1.000, and 88.256% for CSFV, respectively; and − 3.716, 0.999 and 85.811% for APPV, respectively (Fig. 1). These results indicated that an excellent linear relationship (R2 ≥ 0.999) occurred between the initial template concentrations and the corresponding threshold cycle (Ct) values.

Fig. 1.

Fig. 1

Standard curves of the multiplex qRT-PCR. The triplicate standard curves indicated a linear correlation between the logarithm of the copy number and the Ct values. The concentrations of the standard plasmids (p-ASFV, p-CSFV and p-APPV) ranged from 2.52 × 108 to 2.52 × 100 copies/μL (5.04 × 108 to 5.04 × 100 copies per reaction)

Specificity of the multiplex qRT–PCR

To evaluate the specificity of the assay, the RNAs/DNAs of ASFV, CSFV, APPV, and 12 other viruses, namely, PCV2, PRV, PRRSV, FMDV, PPV, PEDV, TGEV, PRoV, PDCoV, BVDV-1, BVDV-2 and BDV, were used as templates for multiplex qRT–PCR. The results showed that ASFV, CSFV and APPV had specific amplification curves while the other 12 viruses did not demonstrate any fluorescent signal or amplification curve, indicating high specificity of the assay (Fig. 2).

Fig. 2.

Fig. 2

Specificity analysis of the multiplex qRT-PCR using different viral strains. The standard recombinant plasmids (p-ASFV, p-CSFV and p-APPV), ASFV, CSFV, APPV and other viruses (PCV2, PRV, PRRSV, FMDV, PPV, PEDV, TGEV, PRoV, PDCoV, BVDV-1, BVDV-2 and BDV) were used to test the specificity

Sensitivity of the multiplex qRT–PCR

The standard plasmids of p-ASFV, p-CSFV and p-APPV were mixed together and then serially diluted 10-fold from 2.52 × 108 to 2.52 × 100 copies/μL (final reaction concentrations: from 2.52 × 107 copies/μL to 2.52 × 10− 1 copies/μL) and used to determine the sensitivity of the multiplex qRT–PCR. The results showed that the limit of detection (LOD) of the assay was 2.52 × 100 copies/μL for ASFV, CSFV and APPV (Fig. 3), while the LOD of the corresponding singleplex qRT–PCR was also 2.52 × 100 copies/μL for ASFV, CSFV and APPV, indicating that the multiplex qRT–PCR had similar sensitivity as the singleplex qRT–PCR. The Ct values of the singleplex and multiplex qRT–PCR are shown in Table 1.

Fig. 3.

Fig. 3

Sensitivity analysis of the multiplex qRT-PCR. The standard recombinant plasmids (p-ASFV, p-CSFV and p-APPV) were used to test the sensitivity. 1-9: 2.52 × 107 - 2.52 × 10− 1 copies/μL (final reaction concentrations)

Table 1.

Comparison of the Ct values between the singleplex and multiplex qRT-PCR

Plasmid Concentration (copies/μL) 2.52 × 107 2.52 × 106 2.52 × 105 2.52 × 104 2.52 × 103 2.52 × 102 2.52 × 101 2.52 × 100 2.52 × 10−1
p-ASFV Singleplex qRT-PCR 13.781 17.478 20.347 24.044 28.274 31.010 35.073 39.481
Multiplex qRT-PCR 13.846 16.859 20.052 24.052 27.862 31.227 34.776 39.351
p-CSFV Singleplex qRT-PCR 13.490 17.195 20.329 24.584 27.974 31.427 34.793 39.341
Multiplex qRT-PCR 13.788 17.011 20.433 24.418 28.270 31.837 35.074 39.857
p-APPV Singleplex qRT-PCR 12.172 15.430 19.161 23.145 27.183 30.502 33.480 36.519
Multiplex qRT-PCR 11.976 15.469 18.845 22.955 26.767 30.154 34.328 36.830

Repeatability of the multiplex qRT–PCR

To evaluate the repeatability of the assay, three concentrations of 2.52 × 107, 2.52 × 105 and 2.52 × 103 copies/μL (final reaction concentrations) of each standard plasmid in the mixtures were used as templates for the intra- and inter-assay comparisons. The results showed that the intra- and interassay coefficients of variation (CVs) of the Ct values were less than 2% (Table 2), indicating high repeatability of the assay.

Table 2.

Repeatability analysis of the multiplex qRT-PCR

Plasmid Concentration (copies/μL) Ct values of intra-assay Ct value of inter-asssay
X¯  SD CV (%) X¯  SD CV (%)
p-ASFV 2.52 × 103 27.847 0.370 1.329 27.942 0.379 1.356
2.52 × 105 20.738 0.168 0.810 20.747 0.207 0.998
2.52 × 107 13.845 0.166 1.199 13.725 0.124 0.903
P-CSFV 2.52 × 103 28.001 0.153 0.546 27.946 0.186 0.666
2.52 × 105 20.359 0.200 0.982 20.457 0.239 1.168
2.52 × 107 13.109 0.156 1.190 13.076 0.088 0.673
P-APPV 2.52 × 103 27.328 0.152 0.556 27.314 0.137 0.502
2.52 × 105 19.125 0.267 1.396 19.128 0.207 1.082
2.52 × 107 12.348 0.145 1.174 12.302 0.157 1.276

Detection of clinical samples by multiplex qRT–PCR

A total of 509 clinical samples collected from October 2018 to December 2020 in Guangxi Province, southern China, were detected by the developed multiplex qRT–PCR to evaluate its practicality for the detection of clinical samples. The results showed that the positive rates of ASFV, CSFV and APPV were 45.58% (232/509), 12.57% (64/509) and 3.54% (18/509), respectively, while the coinfection rates of ASFV and CSFV, ASFV and APPV, and CSFV and APPV were 4.91% (25/509), 1.38% (7/509), and 0.98% (5/509), respectively (Table 3). The results detected by the established qRT–PCR were consistent with the results detected by the OIE-recommended real-time PCR/RT–PCR for ASFV and CSFV and the reported real-time RT–PCR for APPV [25] (Table 4). After the test, all samples were treated with high temperature and high pressure as required.

Table 3.

Detection of clinical samples by the multiplex qRT-PCR

Date Numbers ASFV (%) CSFV (%) APPV (%) ASFV+CSFV (%) ASFV+APPV (%) CSFV+APPV (%)
Oct, 2018 18 0 (0) 2 (11.11) 1 (5.56) 0 (0) 0 (0) 0 (0)
Nov, 2018 40 0 (0) 9 (22.5) 4 (10.00) 0 (0) 0 (0) 1 (2.50)
Dec, 2018 30 5 (16.67) 6 (20.00) 1 (3.33) 3 (10.00) 0 (0) 1 (3.33)
Jan, 2019 38 5 (13.16) 4 (10.53) 0 (0) 1 (2.63) 0 (0) 0 (0)
Feb, 2019 57 15 (26.32) 5 (8.77) 3 (5.26) 3 (5.26) 2 (3.51) 1 (1.75)
Mar, 2019 36 10 (27.78) 7 (19.44) 0 (0) 4 (11.11) 0 (0) 0 (0)
Apr, 2019 19 12 (63.16) 3 (15.79) 1 (5.26) 0 (0) 0 (0) 0 (0)
May, 2019 16 16 (100.00) 0 (0) 2 (12.50) 0 (0) 1 (6.25) 0 (0)
Jun, 2019 11 4 (36.36) 1 (9.09) 1 (9.09) 0 (0) 1 (9.09) 0 (0)
Jul, 2019 12 12 (100.00) 2 (16.67) 0 (0) 0 (0) 0 (0) 0 (0)
Aug, 2019 28 20 (71.43) 2 (7.14) 0 (0) 2 (7.14) 0 (0) 0 (0)
Sep, 2019 15 15 (100.00) 2 (13.33) 0 (0) 2 (13.33) 0 (0) 0 (0)
Oct, 2019 20 20 (100.00) 1 (5.00) 0 (0) 1 (5.00) 0 (0) 0 (0)
Nov, 2019 24 21 (87.50) 5 (20.83) 3 (12.50) 5 (20.83) 3 (12.50) 2 (8.33)
Dec, 2019 10 6 (60.00) 1 (10.00) 0 (0) 0 (0) 0 (0) 0 (0)
Jan, 2020 10 10 (100.00) 0 (0) 0 (0) 0 (0) 0 (0) 0 (0)
Feb, 2020 10 7 (70.00) 1 (10.00) 0 (0) 0 (0) 0 (0) 0 (0)
Jul, 2020 4 0 (0) 4 (100.00) 0 (0) 0 (0) 0 (0) 0 (0)
Aug, 2020 10 8 (80.00) 0 (0) 0 (0) 0 (0) 0 (0) 0 (0)
Sep, 2020 26 14 (53.85) 2 (7.69) 0 (0) 0 (0) 0 (0) 0 (0)
Oct, 2020 20 13 (65.00) 6 (30.00) 0 (0) 4 (20.00) 0 (0) 0 (0)
Nov, 2020 32 15 (46.88) 1 (3.13) 0 (0) 0 (0) 0 (0) 0 (0)
Dec, 2020 23 4 (17.39) 0 (0) 2 (8.70) 0 (0) 0 (0) 0 (0)
Total 509 232 (45.58) 64 (12.57) 18 (3.54) 25 (4.91) 7 (1.38) 5 (0.98)

Table 4.

Agreement between the multiplex qRT-PCR and the reference methods

Detection method Number of positive samples
ASFV CSFV APPV
Multiplex qRT-PCR 232/509 64/509 18/509
Reference methods 232/509 64/509 18/509
Agreements 100% 100% 100%

Note: the reference methods refer to the real-time PCR/RT-PCR that was recommended for ASFV (Chapter 3.9.1), CSFV (Chapter 3.9.3) identification by the OIE (OIE Terrestrial Manual 2019) and the real-time RT-PCR for detection of APPV reported by Liu et al. with modification [25]

Phylogenetic analysis based on ASFV p72 gene

A total of 21 clinical samples were selected randomly from the ASFV-positive samples, and the C-terminal end of the B646L gene, which encodes the p72 major capsid protein of ASFV, was amplified and sequenced. Phylogenetic analysis based on partial p72 gene nucleotide sequences showed that 17 strains of the 21 strains obtained from Guangxi Province together with strains from Mozambique (MOZ-60-98, MAD/1/98, MAZ 9/2006), Tanzania (TAN 2011/01) and Zambia (LUS93-1) formed a distinguishable cluster belonging to genotype II, and the other 4 strains from Guangxi Province, together with strains from Nigeria (Nig01, NIG-2), Angola (Ang72), Congo (Kat67), Ghana (GHA/1/00), South Africa (ZAR85) and Cameroon (CAM/4/85) belonged to genotype I (Fig. 4).

Fig. 4.

Fig. 4

Phylogenetic tree based on partial p72 gene of ASFV. The tree was constructed using the neighbour-joining algorithm of MEGA5.0, and 1000 bootstrap replicates were performed to assign confidences to the groupings. The strains from this study were marked with triangle (△)

Discussion

ASFV, CSFV and APPV are important pathogens in the swine industry. Coinfection between ASFV and CSFV might occur occasionally in certain pig herds, and the clinical manifestations and pathological changes between these viruses might be hard to distinguish in the field; moreover, similar phenomena are observed between CSFV and APPV [2, 10, 21, 22, 24, 25]. Highly virulent ASFVs of genotype II were first identified in China in August 2018 and have become the main epidemic genotype [33]. However, two strains of genotype I ASFV were recently identified in China, and one strain showed low virulence and efficient transmissibility in pigs and caused mild onset of infection and chronic disease [34], which increased the difficulty of differentially diagnosing ASF and CSF in the field. Therefore, to accurately diagnose these diseases, it is necessary to differentially detect these pathogens in the laboratory and obtain clinical information. Among the many diagnostic methods, qRT–PCR is undoubtedly one of the best choices because it is a rapid, specific, sensitive and accurate method for the detection of viral nucleic acids and can be conveniently used for the quantification and detection of swine viral pathogens [35, 36]. Due to its high throughput, sensitivity, accuracy and ability to detect several pathogens in one reaction within a very short time, multiplex qRT–PCR has been widely used for diagnostic purposes in veterinary laboratories in China. Therefore, a one-step multiplex qRT–PCR was developed to differentially detect ASFV, CSFV and APPV in this study. The assay could specifically detect ASFV, CSFV and APPV with an LOD of 2.52 × 101 copies/μL for each pathogen, and the intra- and interassay CVs were all less than 2%, thus showing high specificity, sensitivity and repeatability. Finally, the developed assay was used to detect 509 clinical samples to further verify its practicality for the detection of samples collected in the field.

The developed qRT–PCR was used to detect 509 clinical samples from Guangxi Province, southern China, for ASFV, CSFV and APPV. The results showed that the positive rates of ASFV, CSFV and APPV were 45.58, 12.57 and 3.54%, respectively, indicating that these viruses were still widely prevalent in pig herds in southern China. Since ASFV and CSFV can cause huge economic damage to the swine industry, great efforts to prevent and control these viruses are required. Furthermore, the coinfection rates of ASFV/CSFV, ASFV/APPV and CSFV/APPV were 4.91, 1.38 and 0.98%, respectively, indicating that coinfections of ASFV, CSFV and APPV were common in certain pig herds. The results were similar to our previous report [25]. Since coinfection of ASFV and CSFV could exacerbate the manifestations and pathological changes [24], with ASFV potentially suppressing the immune response of pig herds vaccinated with the CSFV vaccine [37], the epidemic situation and economic losses will be aggravated. Moreover, it is very important to accurately detect pathogens and rapidly eliminate infected pigs in the early stage. Wild-type and gene-deleted ASFV strains were recently identified in the field from several provinces in China [38, 39]. To ensure that the established qRT–PCR could detect both of these strains, the B646L gene (p72 gene), which is a conserved region for all ASFVs, was selected as a targeting gene to design the specific primers and probes, and the sequences were further blasted in the NCBI database to ensure their conservation to all ASFVs and their specificity to all other viruses. The results in this study showed the high specificity, sensitivity, repeatability and practicality of the developed qRT–PCR. Therefore, the developed multiplex qRT–PCR in this study could provide a useful tool for the rapid differentiation of ASFV, CSFV and APPV in clinical samples from suspected pigs.

ASF was first identified in China in August 2018 and subsequently reported in other Asian countries [8], and it has caused huge economic losses to the swine industry. Since ASF is a newly emergent disease in China and has spread rapidly across this country [7], it is very interesting to study the genomic characteristics of ASFV. The ASFV genome varies by approximately 170 to 193 kb and encodes 150 to 167 kinds of proteins [40]. Based on partial p72 gene sequences, ASFV strains from different countries are currently classified into 24 genotypes and divided into three lineages [41]. The 21 ASFV strains from Guangxi Province evaluated in this study shared a high level of nucleotide homology (97.3% ~ 100%) and amino acid identity (83.4% ~ 95.1%) with strains from different countries in the world (data not shown). Phylogenetic analysis based on partial p72 gene nucleotide sequences revealed that all ASFV strains from Guangxi Province belonged to two genotypes (genotypes I and II), with most of these strains (17 of 21 strains) grouped into genotype II and the other strains (4 of 17 strains) grouped into genotype I. The results showed that genotype I and II ASFV strains were simultaneously prevalent in Guangxi Province, which increased the complexity of circulating strains and made it harder to prevent and control. To our knowledge, this is the first report showing the prevalence of genotype I ASFV in southern China. To date, two of the 24 currently described ASFV genotypes based on the p72 gene sequence, namely, genotypes I and II, have been reported outside Africa [42]. Recently, genotype I and II ASFVs epidemics were reported in several provinces in China, with genotype I showing decreased virulence and caused mild manifestations and pathological changes [43]. Furthermore, genotype II ASFV strains might enable domestic pigs and wild boars to develop chronic infections and become carriers after recovery [44]. According to the surveillance results in this study, genotype II ASFVs were the main circulating strains in Guangxi Province, although genotype I ASFVs were also prevalent in pig herds. The circulation of different genotypes of ASFV in the field will increase the complexity of the disease and the difficulty of its control and prevention. More attention should be given to clinical surveillance to remain abreast of the molecular characteristics and genetic diversity of epidemic ASFV strains in the field.

Conclusion

In this study, specific primers and probes were designed according to the genomic sequences of ASFV, CSFV and APPV. After optimizing the reaction conditions, including the primer and probe concentrations, annealing temperature, amplification cycles, etc., a one-step multiplex qRT–PCR with high specificity, sensitivity and repeatability was successfully developed for simultaneous and differential detection of ASFV, CSFV and APPV. The ASFV strains from Guangxi Province belonged to genotypes I and II according to the phylogenetic tree, which was based on the nucleotide sequence of the ASFV p72 gene. Thus, the results indicate that at least two genotypes of ASFV are currently prevalent in Guangxi Province, southern China.

Methods

Viruses and clinical samples

CSFV (C vaccine strain), PCV2 (SX07 vaccine strain), PRRSV (TJM-F92 vaccine strain), FMDV (O/Mya98/XJ/2010 vaccine strain), PRV (Bartha-K61 vaccine strain), PPV (N vaccine strain), PEDV (CV777 vaccine strain), TGEV (H vaccine strain), and PRoV (NX vaccine strain) were stored in our laboratory. ASFV-, APPV-, BVDV-1-, BVDV-2-, BDV- and PDCoV-positive clinical samples were collected in the field, confirmed by PCR/RT–PCR and gene sequencing, and stored in our laboratory.

A total of 509 clinical samples, including brain, lung, liver, spleen and lymph nodes from each dead pig, were collected from different pig herds in Guangxi Province, southern China, from October 2018 to December 2020. All clinical samples were stored at − 80 °C until used.

Primers and TaqMan probes

Three pairs of specific primers and corresponding TaqMan probes used for multiplex qRT–PCR assays were designed using Primer Express 3.0 software (ABI, USA) based on the genomic sequences of ASFV (GenBank accession number NC_001659), CSFV (NC_002657) and APPV (KY624591), with a 79 bp fragment amplified for the ASFV p72 gene, a 72 bp fragment amplified for the CSFV 5′UTR and a 90 bp fragment amplified for the APPV 5′UTR. The sequences of the designed primers and probes were analysed using the Blast tool from the National Center for Biotechnology Information (NCBI) and information on published sequences to confirm the high conservation of primers and probes among different reference strains of ASFV, CSFV and APPV. Detailed information on the primers and probes is listed in Table 5.

Table 5.

Primers and probes used for detection of ASFV, CSFV and APPV

Primer and probe Sequence (5′ → 3′) Product size (bp)
ASFV-p72-F GGCGTATAAAAAGTCCAGGAAATTC 79
ASFV-p72-R TTCGGCGAGCGCTTTATC
ASFV-p72-P Texas Red-TCACCAAATCCTTTTGCGATGCAAGCT-BHQ2
CSFV-5’UTR-F CCTGAGTACAGGACAGTCGTCAGT 72
CSFV-5’UTR-R CCCTCGTCCACATAGCATCTC
CSFV-5’UTR-P JOE-TTCGACGTGAGCAGAAGCCCACC-BHQ1
APPV-5’UTR-F GGCGTGCCCAAAGAGAAAT 90
APPV-5’UTR-R GGCACTCTATCAAGCAGTAAGGTCTA
APPV-5’UTR-P FAM-TCGGGTCCACCATGCCCCTTT-BHQ1

Extraction of nucleic acid

All vaccine viruses and the pooled clinical tissue homogenates (20%, W/V) were resuspended in phosphate-buffered saline (PBS, pH 7.2), vortexed and centrifuged at 12,000×g at 4 °C for 5 min. Total RNA and DNA were extracted from the supernatants using MiniBEST RNA/DNA Extraction Kit Ver. 5.0 (TaKaRa, Dalian, China) according to the manufacturer’s instructions and stored at − 80 °C until use.

Construction of standard plasmids

Total DNA was extracted from ASFV-positive samples, and total RNA was extracted from CSFV vaccine- and APPV-positive samples and then reverse transcribed to cDNA. The target fragments of ASFV, CSFV and APPV were amplified by PCR using ASFV DNA and CSFV and APPV cDNA as templates. The amplicons were purified and cloned into the pMD18-T vector (TaKaRa, Dalian, China) and transferred into E. coli DH5α competent cells (TaKaRa, Dalian, China). The positive clones were cultured at 37 °C for 18 h-20 h and extracted by a MiniBEST Plasmid Extraction Kit Ver. 5.0 (TaKaRa, Dalian, China) for the plasmid constructs. The plasmids were named p-ASFV, p-CSFV and p-APPV and stored at − 80 °C until use as standard plasmids.

The standard plasmids were quantified by ultraviolet absorbance at 260 nm and 280 nm with a NanoDrop spectrophotometer (Thermo Fisher, USA). The exact copy numbers of plasmids were calculated using the following formula:

Plasmidcopies/μL=6.02×1023×Xng/μL×10-9/plasmidlengthbp×660

Optimization of the singleplex qRT–PCR assay

The standard plasmids were mixed together and then serially diluted 10-fold from 2.52 × 109 copies/μL to 2.52 × 101 copies/μL (final reaction concentrations: 2.52 × 108 copies/μL to 2.52 × 100 copies/μL) to optimize the reaction conditions of the singleplex qRT–PCR of ASFV, CSFV and APPV. The reaction mixture contained 2× One Step qRT–PCR Buffer III (TaKaRa, Dalian, China) 10 μL, Ex Taq HS (5 U/μL) (TaKaRa, Dalian, China) 0.4 μL, PrimeScript RT Enzyme Mix II (TaKaRa, Dalian, China) 0.4 μL, each primer 0.1-0.6 μL, each probe 0.1-0.6 μL, plasmid template 2.0 μL and distilled water to a total volume of 20 μL. All reactions were amplified by an ABI QuantStudio™ 6 Real-time System (ABI, USA), and the amplification parameters were as follows: 42 °C for 5 min; 95 °C for 10 s; and then 40 cycles of 95 °C for 5 s and 59 °C for 34 s. The fluorescent signals were determined at the end of each cycle.

Optimization of the multiplex qRT–PCR assay

Based on the optimal reaction conditions of the singleplex qRT–PCR, the reaction conditions of the multiplex qRT–PCR, including annealing temperature, primer concentrations, probe concentrations, amplification cycles, etc., were further determined by orthogonal experiments.

The reaction mixture contained 10 μL of 2× One Step qRT–PCR Buffer III (TaKaRa, Dalian, China), 0.4 μL of Ex Taq HS (5 U/μL) (TaKaRa, Dalian, China), 0.4 μL of PrimeScript RT Enzyme Mix II (TaKaRa, Dalian, China), 0.1-0.6 μL of the primer and probe mixture with different final concentrations, 2.0 μL of the three standard plasmids (mixed in a ratio of 1:1:1) with different final concentrations as templates, and sterilized distilled water to a final volume of 20 μL. The amplification parameters were as follows: 42 °C for 5 min; incubation at 95 °C for 10 s; and then 40 cycles of denaturation at 95 °C for 5 s and annealing and extension at 59 °C for 34 s. Finally, the fluorescent signals were determined at the end of each cycle. After amplification, a Ct value was assigned to each sample. The final concentrations of primers, probes and amplification conditions were optimized to obtain the maximum ΔRn and minimal Ct values using standard plasmids of different dilutions as templates.

Specificity analysis of the multiplex qRT–PCR

The DNA or RNA of ASFV, CSFV, APPV, PCV2, PRV, PRRSV, PPV, FMDV, PEDV, TGEV, PRoV, PDCoV, BVDV-1, BVDV-2 and BDV was used as templates of the developed multiplex qRT–PCR to verify the specificity of the assay.

Sensitivity analysis of the multiplex qRT–PCR

The standard plasmids of p-ASFV, p-CSFV and p-APPV were mixed together and then serially diluted 10-fold from 2.52 × 108 copies/μL to 2.52 × 100 copies/μL (final reaction concentrations: 2.52 × 107 copies/μL to 2.52 × 10− 1 copies/μL) and used as templates for multiplex qRT–PCR to determine the sensitivity of the assay.

Repeatability analysis of the multiplex qRT–PCR

The standard plasmids of p-ASFV, p-CSFV and p-APPV were mixed together and then serially diluted 10-fold from 2.52 × 108 copies/μL to 2.52 × 100 copies/μL, and concentrations of 2.52 × 108 copies/μL, 2.52 × 106 copies/μL and 2.52 × 104 copies/μL (final reaction concentrations: 2.52 × 107 copies/μL, 2.52 × 105 copies/μL and 2.52 × 103 copies/μL) were used as templates for the developed multiplex qRT–PCR. The intra-assay was performed in triplicate, and the inter-assay was repeated three times, with an interval of 1 week. The intra- and inter-assay CVs were determined to evaluate the repeatability of the assay.

Detection of clinical samples by multiplex qRT–PCR

A total of 509 clinical samples were collected from pig farms in Guangxi Province, southern China, from October 2018 to December 2020. Total RNA and DNA were extracted from 20% tissue supernatants using a MiniBEST RNA/DNA Extraction Kit Ver. 5.0 (TaKaRa, Dalian, China) and detected by the developed multiplex qRT–PCR for ASFV, CSFV and APPV. The above templates were also detected by real-time PCR/RT–PCR, as recommended for ASFV (Chapter 3.9.1) and CSFV (Chapter 3.9.3) identification by the OIE (OIE Terrestrial Manual 2019), and detected by real-time RT–PCR, as reported for the detection of APPV with modification [25].

Phylogenetic analysis based on ASFV p72 gene

Twenty-one samples were selected randomly from the positive ASFV samples to amplify a partial p72 gene using a pair of primers (P72-U: 5′-GGCACAAGTTCGGACATGT-3′, P72-D: 5′-GTACTGTAACGCAGCACAG-3′) as previously described [45]. The PCR products were purified, ligated to the pMD-18 T vector (TaKaRa, Dalian, China) and transferred to E. coli DH5α competent cells. The positive clones were selected and sequenced (TaKaRa, Dalian, China), and the acquired sequences were edited by the EditSeq program of DNAstar software and aligned with the reference strains retrieved from GenBank using ClustalW. Phylogenetic reconstruction was conducted using the maximum-likelihood algorithm method (T92 + G). Phylogenetic tree reliability was supported using the Kimura distances and a bootstrap method with 1000 replications.

Acknowledgements

We are grateful to Guangxi Center for Animal Disease Control and Prevention (CADC) for providing all the viral strains and clinical samples used in this study. Guangxi CADC was approved by Ministry of Agriculture and Rural Affairs of the People’s Republic of China for collection and detection of ASFV in clinical samples (Approval number: 2018-154-25).

Abbreviations

APPV

Atypical porcine pestivirus

ASFV

African swine fever virus

BDV

Border disease virus

BVDV

Bovine viral diarrhea virus

CSFV

Classical swine fever virus

CV

Coefficient of variation

FMDV

Foot-and-mouth disease virus

LOD

Limit of detection

multiplex qRT-PCR

Multiplex real-time quantitative RT-PCR

OIE

The World Organization for Animal Health

PCV2

Porcine circovirus type 2

PDCoV

Porcine deltacoronavirus

PEDV

Porcine epidemic diarrhoea virus

PPV

Porcine parvovirus

PRRSV

Porcine reproductive and respiratory syndrome virus

PRV

Pseudorabies virus

TGEV

Transmissible gastroenteritis virus

PRoV

Porcine rotavirus

RT-PCR

Reverse-transcription polymerase chain reaction

Authors’ contributions

LHX carried out the experiments, data analysis and drafted the manuscript. SKC initiated the research program, and contributed to manuscript revision and final presentation. ZJ and CYT helped to perform the experiments. YYW and LWJ participated in sample collection. SHB revised the manuscript. QSJ and LF participated in clinical data acquisition. All authors have read and approved the final manuscript.

Funding

This work was supported by Guangxi Science and Technology Bureau, China (AB21238003, AA17204057) and Guangxi Agriculture and Rural Affairs Bureau, China (Z201954, Z202031). The funding sources had no involvement in the design of the research, the collection, analysis and interpretation of data, and the writing of the manuscript.

Availability of data and materials

All data generated or analyzed during this study are included in this article and are available from the corresponding author on reasonable request.

Declarations

Ethics approval and consent to participate

The programs and procedures used in this study have been examined and approved by Guangxi CADC, China. We obtained written informed consent to use the clinical samples in our study from the owners of the animals.

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Footnotes

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Huixin Liu and Kaichuang Shi contributed equally to this work.

Contributor Information

Kaichuang Shi, Email: shikaichuang@126.com.

Hongbin Si, Email: shb2009@gxu.edu.cn.

References

  • 1.Alonso C, Borca M, Dixon L, Revilla Y, Rodriguez F, Escribano JM. ICTV report consortium. ICTV virus taxonomy profile: Asfarviridae. J Gen Virol. 2018;99(5):613–614. doi: 10.1099/jgv.0.001049. [DOI] [PubMed] [Google Scholar]
  • 2.Dixon LK, Sun H, Roberts H. African swine fever. Antivir Res. 2019;165:34–41. doi: 10.1016/j.antiviral.2019.02.018. [DOI] [PubMed] [Google Scholar]
  • 3.Cwynar P, Stojkov J, Wlazlak K. African swine fever status in Europe. Viruses. 2019;11(4):310. doi: 10.3390/v11040310. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Sanchez-Vizcaino JM, Mur L, Martinez-Lopez B. African swine fever: an epidemiological update. Transbound Emerg Dis. 2012;59(Suppl 1):27–35. doi: 10.1111/j.1865-1682.2011.01293.x. [DOI] [PubMed] [Google Scholar]
  • 5.Zhou X, Li N, Luo Y, Liu Y, Miao F, Chen T, Zhang S, Cao P, Li X, Tian K, Qiu HJ, Hu R. Emergence of African swine fever in China, 2018. Transbound Emerg Dis. 2018;65(6):1482–1484. doi: 10.1111/tbed.12989. [DOI] [PubMed] [Google Scholar]
  • 6.Tao D, Sun D, Liu Y, Wei S, Yang Z, An T, Shan F, Chen Z, Liu J. One year of African swine fever outbreak in China. Acta Trop. 2020;211:105602. doi: 10.1016/j.actatropica.2020.105602. [DOI] [PubMed] [Google Scholar]
  • 7.Mighell E, Ward MP. African swine fever spread across Asia, 2018-2019. Transbound Emerg Dis. 2021;68(5):2722–2732. doi: 10.1111/tbed.14039. [DOI] [PubMed] [Google Scholar]
  • 8.Stepien M, Cole L. USDA statement on confirmation of African swine fever in Haiti. Washington D. C.: USDA APHIS; 2021. https://www.aphis.usda.gov/aphis/newsroom/stakeholder-info/sa_by_date/sa-2021/sa-09/asf-haiti
  • 9.Brown VR, Bevins SN. A review of classical swine fever virus and routes of introduction into the United States and the potential for virus establishment. Front Vet Sci. 2018;5:31. doi: 10.3389/fvets.2018.00031. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Smith DB, Meyers G, Bukh J, Gould EA, Monath T, Scott Muerhoff A, Pletnev A, Rico-Hesse R, Stapleton JT, Simmonds P, Becher P. Proposed revision to the taxonomy of the genus Pestivirus, family Flaviviridae. J Gen Virol. 2017;98(8):2106–2112. doi: 10.1099/jgv.0.000873. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Coronado L, Perera CL, Rios L, Frias MT, Perez LJ. A critical review about different vaccines against classical swine fever virus and their repercussions in endemic regions. Vaccines (Basel) 2021;9(2):154. doi: 10.3390/vaccines9020154. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Ganges L, Crooke HR, Bohórquez JA, Postel A, Sakoda Y, Becher P, Ruggli N. Classical swine fever virus: the past, present and future. Virus Res. 2020;289:198151. doi: 10.1016/j.virusres.2020.198151. [DOI] [PubMed] [Google Scholar]
  • 13.Luo Y, Ji S, Lei JL, Xiang GT, Liu Y, Gao Y, Meng XY, Zheng G, Zhang EY, Wang Y, Du ML, Li Y, Li S, He XJ, Sun Y, Qiu HJ. Efficacy evaluation of the C-strain-based vaccines against the subgenotype 2.1d classical swine fever virus emerging in China. Vet Microbiol. 2017;201:154–161. doi: 10.1016/j.vetmic.2017.01.012. [DOI] [PubMed] [Google Scholar]
  • 14.Zhou B. Classical swine fever in China-An update minireview. Front Vet Sci. 2019;6:187. doi: 10.3389/fvets.2019.00187. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Wang X, Mu G, Dang R, Yang Z. Up-regulation of IL-10 upon PRRSV vaccination impacts on the immune response against CSFV. Vet Microbiol. 2016;197:68–71. doi: 10.1016/j.vetmic.2016.11.007. [DOI] [PubMed] [Google Scholar]
  • 16.Chen D, Liu X, Xu S, Chen D, Zhou L, Ge X, Han J, Guo X, Yang H. TNF-α induced by porcine reproductive and respiratory syndrome virus inhibits the replication of classical swine fever virus C-strain. Vet Microbiol. 2019;234:25–33. doi: 10.1016/j.vetmic.2019.05.007. [DOI] [PubMed] [Google Scholar]
  • 17.Hu D, Lv L, Gu J, Chen T, Xiao Y, Liu S. Genetic diversity and positive selection analysis of classical swine fever virus envelope protein gene E2 in East China under C-strain vaccination. Front Microbiol. 2016;7:85. doi: 10.3389/fmicb.2016.00085. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Fatima M, Luo Y, Zhang L, Wang PY, Song H, Fu Y, Li Y, Sun Y, Li S, Bao YJ, Qiu HJ. Genotyping and molecular characterization of classical swine fever virus isolated in China during 2016-2018. Viruses. 2021;13(4):664. doi: 10.3390/v13040664. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Gatto IRH, Sonalio K, de Oliveira LG. Atypical porcine pestivirus (APPV) as a new species of Pestivirus in pig production. Front Vet Sci. 2019;6:35. doi: 10.3389/fvets.2019.00035. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Hause BM, Collin EA, Peddireddi L, Yuan F, Chen Z, Hesse RA, Gauger PC, Clement T, Fang Y, Anderson G. Discovery of a novel putative atypical porcine pestivirus in pigs in the USA. J Gen Virol. 2015;96(10):2994–2998. doi: 10.1099/jgv.0.000251. [DOI] [PubMed] [Google Scholar]
  • 21.Pan S, Mou C, Chen Z. An emerging novel virus: atypical porcine pestivirus (APPV) Rev Med Virol. 2019;29(1):e2018. doi: 10.1002/rmv.2018. [DOI] [PubMed] [Google Scholar]
  • 22.de Groof A, Deijs M, Guelen L, van Grinsven L, van Os-Galdos L, Vogels W, Derks C, Cruijsen T, Geurts V, Vrijenhoek M, Suijskens J, van Doorn P, van Leengoed L, Schrier C, van der Hoek L. Atypical porcine pestivirus: a possible cause of congenital tremor type A-II in newborn piglets. Viruses. 2016;8(10):271. doi: 10.3390/v8100271. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Bradley R, Done JT, Hebert CN, Overby E, Askaa J, Basse A, Bloch B. Congenital tremor type AI: light and electron microscopical observations on the spinal cords of affected piglets. J Comp Pathol. 1983;93(1):43–59. doi: 10.1016/0021-9975(83)90042-7. [DOI] [PubMed] [Google Scholar]
  • 24.Cabezón O, Muñoz-González S, Colom-Cadena A, Pérez-Simó M, Rosell R, Lavín S, Marco I, Fraile L, de la Riva PM, Rodríguez F, Domínguez J, Ganges L. African swine fever virus infection in classical swine fever subclinically infected wild boars. BMC Vet Res. 2017;13(1):227. doi: 10.1186/s12917-017-1150-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Liu H, Shi K, Sun W, Zhao J, Yin Y, Si H, Qu S, Lu W. Development a multiplex RT-PCR assay for simultaneous detection of African swine fever virus, classical swine fever virus and atypical porcine pestivirus. J Virol Methods. 2021;287:114006. doi: 10.1016/j.jviromet.2020.114006. [DOI] [PubMed] [Google Scholar]
  • 26.Agüero M, Fernández J, Romero L, Sánchez Mascaraque C, Arias M, Sánchez-Vizcaíno JM. Highly sensitive PCR assay for routine diagnosis of African swine fever virus in clinical samples. J Clin Microbiol. 2003;41(9):4431–4434. doi: 10.1128/JCM.41.9.4431-4434.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Tignon M, Gallardo C, Iscaro C, Hutet E, Van der Stede Y, Kolbasov D, De Mia GM, Le Potier MF, Bishop RP, Arias M, Koenen F. Development and inter-laboratory validation study of an improved new real-time PCR assay with internal control for detection and laboratory diagnosis of African swine fever virus. J Virol Methods. 2011;178(1-2):161–170. doi: 10.1016/j.jviromet.2011.09.007. [DOI] [PubMed] [Google Scholar]
  • 28.Hoffmann B, Beer M, Schelp C, Schirrmeier H, Depner K. Validation of a real-time RT-PCR assay for sensitive and specific detection of classical swine fever. J Virol Methods. 2005;130(1-2):36–44. doi: 10.1016/j.jviromet.2005.05.030. [DOI] [PubMed] [Google Scholar]
  • 29.Ophuis RJ, Morrissy CJ, Boyle DB. Detection and quantitative pathogenesis study of classical swine fever virus using a real time RT-PCR assay. J Virol Methods. 2006;131(1):78–85. doi: 10.1016/j.jviromet.2005.07.008. [DOI] [PubMed] [Google Scholar]
  • 30.Chen F, Knutson TP, Braun E, Jiang Y, Rossow S, Marthaler DG. Semi-quantitative duplex RT-PCR reveals the low occurrence of porcine pegivirus and atypical porcine pestivirus in diagnostic samples from the United States. Transbound Emerg Dis. 2019;66(3):1420–1425. doi: 10.1111/tbed.13154. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Grau FR, Schroeder ME, Mulhern EL, McIntosh MT, Bounpheng MA. Detection of African swine fever, classical swine fever, and foot-and-mouth disease viruses in swine oral fluids by multiplex reverse transcription real-time polymerase chain reaction. J Vet Diagn Invest. 2015;27(2):140–149. doi: 10.1177/1040638715574768. [DOI] [PubMed] [Google Scholar]
  • 32.Haines FJ, Hofmann MA, King DP, Drew TW, Crooke HR. Development and validation of a multiplex, real-time RT PCR assay for the simultaneous detection of classical and African swine fever viruses. PLoS One. 2013;8(7):e71019. [DOI] [PMC free article] [PubMed]
  • 33.Ge S, Li J, Fan X, Liu F, Li L, Wang Q, Ren W, Bao J, Liu C, Wang H, Liu Y, Zhang Y, Xu T, Wu X, Wang Z. Molecular characterization of African swine fever virus, China, 2018. Emerg Infect Dis. 2018;24(11):2131–2133. doi: 10.3201/eid2411.181274. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Sun E, Huang L, Zhang X, Zhang J, Shen D, Zhang Z, Wang Z, Huo H, Wang W, Huangfu H, Wang W, Li F, Liu R, Sun J, Tian Z, Xia W, Guan Y, He X, Zhu Y, Zhao D, Bu Z. Genotype I African swine fever viruses emerged in domestic pigs in China and caused chronic infection. Emerg Microbes Infect. 2021;10:1–30. doi: 10.1080/22221751.2021.1999779. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Hawkins SFC, Guest PC. Multiplex analyses using real-time quantitative PCR. Methods Mol Biol. 2017;1546:125–133. doi: 10.1007/978-1-4939-6730-8_8. [DOI] [PubMed] [Google Scholar]
  • 36.Hoffmann B, Beer M, Reid SM, Mertens P, Oura CA, van Rijn PA, Slomka MJ, Banks J, Brown IH, Alexander DJ, King DP. A review of RT-PCR technologies used in veterinary virology and disease control: sensitive and specific diagnosis of five livestock diseases notifiable to the world organization for animal health. Vet Microbiol. 2009;139(1-2):1–23. doi: 10.1016/j.vetmic.2009.04.034. [DOI] [PubMed] [Google Scholar]
  • 37.Gallardo C, Sánchez EG, Pérez-Núñez D, Nogal M, de León P, Carrascosa ÁL, Nieto R, Soler A, Arias ML, Revilla Y. African swine fever virus (ASFV) protection mediated by NH/P68 and NH/P68 recombinant live-attenuated viruses. Vaccine. 2018;36(19):2694–2704. doi: 10.1016/j.vaccine.2018.03.040. [DOI] [PubMed] [Google Scholar]
  • 38.Sun E, Zhang Z, Wang Z, He X, Zhang X, Wang L, Wang W, Huang L, Xi F, Huangfu H, Tsegay G, Huo H, Sun J, Tian Z, Xia W, Yu X, Li F, Liu R, Guan Y, Zhao D, Bu Z. Emergence and prevalence of naturally occurring lower virulent African swine fever viruses in domestic pigs in China in 2020. Sci China Life Sci. 2021;64(5):752–765. doi: 10.1007/s11427-021-1904-4. [DOI] [PubMed] [Google Scholar]
  • 39.Patrick BN, Machuka EM, Githae D, Banswe G, Amimo JO, Ongus JR, Masembe C, Bishop RP, Steinaa L, Djikeng A, Pelle R. Evidence for the presence of African swine fever virus in apparently healthy pigs in south-Kivu Province of the Democratic Republic of Congo. Vet Microbiol. 2020;240:108521. doi: 10.1016/j.vetmic.2019.108521. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Gallardo C, Nurmoja I, Soler A, Delicado V, Simón A, Martin E, Perez C, Nieto R, Arias M. Evolution in Europe of African swine fever genotype II viruses from highly to moderately virulent. Vet Microbiol. 2018;219:70–79. doi: 10.1016/j.vetmic.2018.04.001. [DOI] [PubMed] [Google Scholar]
  • 41.de Villiers EP, Gallardo C, Arias M, da Silva M, Upton C, Martin R, Bishop RP. Phylogenomic analysis of 11 complete African swine fever virus genome sequences. Virology. 2010;400(1):128–136. doi: 10.1016/j.virol.2010.01.019. [DOI] [PubMed] [Google Scholar]
  • 42.Giammarioli M, Gallardo C, Oggiano A, Iscaro C, Nieto R, Pellegrini C, Dei Giudici S, Arias M, De Mia GM. Genetic characterisation of African swine fever viruses from recent and historical outbreaks in Sardinia (1978-2009) Virus Genes. 2011;42(3):377–387. doi: 10.1007/s11262-011-0587-7. [DOI] [PubMed] [Google Scholar]
  • 43.Njau EP, Domelevo Entfellner JB, Machuka EM, Bochere EN, Cleaveland S, Shirima GM, Kusiluka LJ, Upton C, Bishop RP, Pelle R, Okoth EA. The first genotype II African swine fever virus isolated in Africa provides insight into the current Eurasian pandemic. Sci Rep. 2021;11(1):13081. doi: 10.1038/s41598-021-92593-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Wang F, Zhang H, Hou L, Yang C, Wen Y. Advance of African swine fever virus in recent years. Res Vet Sci. 2021;136:535–539. doi: 10.1016/j.rvsc.2021.04.004. [DOI] [PubMed] [Google Scholar]
  • 45.Bastos AD, Penrith ML, Crucière C, Edrich JL, Hutchings G, Roger F, Couacy-Hymann E, Thomson R, G. Genotyping field strains of African swine fever virus by partial p72 gene characterisation. Arch Virol. 2003;148(4):693–706. doi: 10.1007/s00705-002-0946-8. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

All data generated or analyzed during this study are included in this article and are available from the corresponding author on reasonable request.


Articles from BMC Veterinary Research are provided here courtesy of BMC

RESOURCES