Effects of Troponoids on Mitochondrial Function and Cytotoxicity

ABSTRACT

The α-hydroxytropolones (αHTs) are troponoid inhibitors of hepatitis B virus (HBV) replication that can target HBV RNase H with submicromolar efficacies. αHTs and related troponoids (tropones and tropolones) can be cytotoxic in cell lines as measured by 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS) assays that assess mitochondrial function. Previous studies suggest that tropolones induce cytotoxicity through inhibition of mitochondrial respiration. Therefore, we screened 35 diverse troponoids for effects on mitochondrial function, mitochondrial/nuclear genome ratios, cytotoxicity, and reactive oxygen species (ROS) production. Troponoids as a class did not inhibit respiration or glycolysis, although the α-ketotropolone subclass interfered with these processes. The troponoids had no impact on the mitochondrial DNA/nuclear DNA ratio after 3 days of compound exposure. The patterns of troponoid-induced cytotoxicity among three hepatic cell lines were similar for all compounds, but three potent HBV RNase H inhibitors were not cytotoxic in primary human hepatocytes. Tropolones and αHTs increased ROS production in cells at cytotoxic concentrations but had no effect at lower concentrations that efficiently inhibit HBV replication. Troponoid-mediated cytotoxicity was significantly decreased upon the addition of the ROS scavenger N-acetylcysteine. These studies show that troponoids can increase ROS production at high concentrations within cell lines, leading to cytotoxicity, but are not cytotoxic in primary hepatocytes. Future development of αHTs as potential therapeutics against HBV may need to mitigate ROS production by altering compound design and/or by coadministering ROS antagonists to ameliorate increased ROS levels.

INTRODUCTION

Troponoids contain a conjugated seven-membered ring with a ketone. Having a single ketone defines the tropones. The addition of one hydroxyl adjacent to the ketone characterizes the tropolones, and the addition of two adjacent hydroxyls yields the α-hydroxytropolones (αHTs) (Fig. 1) (1). This diverse class of compounds has antiviral, antibacterial, and antifungal activities (2–5). Notably, the αHTs can inhibit the replication of hepatitis B virus (HBV), human immunodeficiency virus (HIV), herpes simplex virus (HSV), Cryptococcus neoformans, Escherichia coli, and Staphylococcus aureus (2–14). We have been developing αHTs as a class of HBV replication inhibitors targeting viral RNase H, with the best compounds having selectivity indices (SIs) of >200 (11–13). RNase H is an attractive target for the development of novel HBV drugs despite the availability of nucleos(t)ide analog drugs that also inhibit HBV DNA replication (15) because RNase H inhibitors do not need to be activated by cellular kinases, they target a different viral active site than the nucleos(t)ide analogs, and they are synergistic versus HBV replication in cell culture with the nucleoside analog lamivudine (16).

FIG 1.

Troponoid structures. (A) Backbone structures of the troponoid chemotype. (B) Structures of the compounds used in this study.

The mechanism by which αHTs inhibit HIV and HBV is primarily by binding to the viral RNase H enzymes via chelating the two divalent cations in the active sites (17, 18). Although the αHTs primarily target viral RNase H activities, some inhibition has also been observed for HIV RNase H active-site inhibitors against HIV DNA polymerase and integrase activities (19, 20). Structure-activity relationships for troponoids against HBV replication have been partially defined. Inhibition is completely dependent on the presence of an intact oxygen trident on the troponoid ring (hence, all tropones, tropolones, and αHTs with an adduct on one of the trident oxygens are inactive), a wide range of substitutions are tolerated at all tested positions on the troponoid ring, and longer R groups that can bind longitudinally to the extended nucleic acid binding cleft can improve efficacy (11). The cytotoxicity of the αHTs is proportional to both the degree of hydrophobicity of the compounds and the total number of aromatic rings on the molecule (16). Consequently, most αHTs that work well against HBV are fairly hydrophilic.

While troponoids are active against a range of pathogens, the class can suffer from variable cytotoxicity in vitro (12, 13). Therefore, understanding the mechanism(s) of cytotoxicity would help guide the synthesis of αHT derivatives to mitigate toxicity and aid the development of troponoids as therapeutics. Previous studies focusing on the tropolone β-thujaplicin indicate that tropolone-mediated cell death can occur for a myriad of reasons, including inhibiting the electron transport chain (ETC), acting as an uncoupler of the ETC, and generating reactive oxygen species (ROS) in cells, resulting in apoptosis (21–26). While mechanisms of cytotoxicity have been investigated for β-thujaplicin, little effort has gone into identifying the causes of cytotoxicity of the closely related αHT chemotype. Here, we evaluated the mitochondrial impact on hepatically derived cell lines of 35 structurally diverse troponoids synthesized as part of our ongoing development of HBV RNase H inhibitors (Fig. 1).

RESULTS

Cytotoxicity.

Thirty-five structurally diverse troponoids (Fig. 1) were assessed for cytotoxicity in three liver cell lines: HepDES19, HepG2, and Huh7. HepDES19 is a HepG2 derivative carrying a stable, tetracycline-repressible HBV genomic expression cassette that was also used to screen compounds for their half-maximal effective concentrations (EC₅₀s) (27, 28). Cytotoxicity was measured using a 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS) assay following 3-day compound exposure (Table 1). Eight of the 35 troponoids had 50% cytotoxic concentrations (CC₅₀s) of >50 μM in all three cell lines. Compounds 47, 55, 339, and 391 had CC₅₀s of >50 μM in at least one cell line. The remaining 23 troponoids had CC₅₀ values below 50 μM in all three cell lines. CC₅₀s were comparable for a given compound across all three cell lines tested (Fig. 2). In sum, the majority of troponoids tested had substantial cytotoxicity in the fully transformed hepatic tumor lines that are routinely used to assess HBV replication.

TABLE 1.

Troponoid effects on HBV, HepDES19 cells, Huh7 cells, HepG2 cells, PHHs, and HuRNase H1^a

Compound	EC50 (μM)	HepDES19 CC50 (μM)	Huh7 CC50 (μM)	HepG2 CC50 (μM)	PHH CC50 (μM) (MTS/LDH)	huRNase H1 IC50 (μM)	SI (DES19 CC50/EC50 ratio)
46	0.903	10.7	19.8	14.4	100/100	4.95	11.8
47	−	66.3	39.2	85.6	NA	200	−
51	−	100	100	99.7	NA	200	−
55	−	49.6	80.9	52.3	NA	200	−
110	0.253	11.0	29.2	20.3	100/100	3.59	43.7
118	3.46	10.5	8.49	15.7	NA	0.165	3.04
195	−	100	93.9	94.6	NA	95.0	−
262	4.91	19.2	23.1	21.9	NA	3.54	3.91
280	0.490	22.8	13.1	40.7	NA	NA	46.6
310	2.03	38.4	24.3	11.8	NA	NA	18.9
313	8.34	4.63	15.0	10.9	NA	0.91	0.556
320	3.06	25.6	37.0	13.4	NA	9.17	8.34
338	84.9	66.2	74.0	86.0	NA	200	0.780
339	−	49.6	45.0	80.5	NA	200	−
340	25.2	7.70	8.95	15.1	NA	200	0.306
341	11.8	12.1	5.93	6.19	NA	200	1.03
342	25.3	18.3	11.5	9.73	NA	200	0.722
343	4.50	3.44	6.29	3.61	NA	200	0.765
344	8.80	5.49	9.97	6.59	NA	200	0.623
345	−	100	100	95.3	NA	167	−
347	6.35	92.3	96.7	100	NA	171	14.5
350	−	53.0	75.9	89.2	NA	127	−
381	9.02	12.6	24.9	24.4	NA	200	1.39
382	0.584	63.2	84.5	96.6	NA	138	108
389	0.431	16.0	14.4	10.3	NA	8.48	37.2
390	0.314	20.0	15.4	34.3	100/100	4.36	63.7
391	0.464	29.6	66.7	60.6	NA	4.05	63.9
536	50.0	95.6	89.0	87.2	NA	NA	1.91
694	6.57	3.02	2.24	16.5	NA	7.27	0.460
714	4.15	6.76	4.75	21.5	NA	0.0348	1.63
737	4.63	1.95	3.09	NA	NA	NA	0.421
738	5.23	2.82	2.52	3.14	NA	0.495	0.548
741	3.10	7.10	5.13	12.1	NA	0.0134	2.29
798	3.47	5.20	9.61	16.2	NA	7.06	1.50
1016	0.667	10.0	10.8	8.47	NA	1.46	15.0

^aAll values reported are the means from at minimum three independent replicates. For the CC₅₀, the highest concentration tested was 100 μM. For the IC₅₀, the highest concentration tested was 200 μM. −, no inhibition in a qualitative screen at 5 μM; NA, not available.

FIG 2.

Cytotoxicity in hepatic cell lines. Cells were incubated with compounds for 72 h. Cytotoxicity was measured using the MTS assay. Results are shown as means ± 1 standard deviation.

We next tested the cytotoxicity of three αHTs (compounds 46, 110, and 390) in primary human hepatocytes (PHHs). These compounds were selected as they are the initial αHT hit compound (29) and two well-characterized αHTs with favorable selectivity indices (SIs) against HBV replication in HepDES19 cells (SI = 11.8 for compound 46, SI = 43.7 for compound 110, and SI = 63.7 for compound 390) (Table 1) (4, 11–13). Compounds 46, 110, and 390 all had CC₅₀s below 35 μM in each of the three immortal cell lines but were not toxic (CC₅₀ ≥ 100) in PHHs as measured by both MTS and lactate dehydrogenase (LDH) assays (Table 1). Decreased cytotoxicity within primary cells has been reported previously with β-thujaplicin (26) but has not been observed previously with αHTs.

Effects of troponoids on mitochondrial respiration.

It has been reported that tropolones can inhibit mitochondrial respiration and act as uncouplers of the electron transport chain (ETC) (21, 25). We expanded upon this observation by screening 35 troponoids at 50 μM for effects on Huh7 cells to determine their impact on the oxygen consumption rate (OCR) and the ETC using Seahorse XFp analyses. These assays work by measuring the oxygen consumption of cells as they are treated with a series of known inhibitors of enzymes in the ETC that isolate various components of the ETC (Fig. 3A). Twenty-eight of the 35 troponoids had no immediate impact on the OCR upon addition to cells compared to the vehicle control (Fig. 3B). Compounds 340, 342, 350, 389, and 798 all significantly increased the OCR and compounds 341 and 344 significantly decreased the OCR in Huh7 cells immediately upon addition to the cells (Fig. 3B). Similarly, compounds 340, 341, 342, 343, 344, 350, 694, 714, and 798 significantly reduced the oligomycin-induced OCR decrease associated with ATP production (Fig. 3C). Compounds 51 and 55 increased the OCR upon 2-{2-[4-(trifluoromethoxy)phenyl]hydrazinylidene}-propanedinitrile (FCCP) addition as measured by both maximal respiration and spare capacity (Fig. 3D and E). Interestingly, compound 350, a tribrominated tropolone, caused an increase in cellular respiration that was resistant to oligomycin addition and yielded a negative spare capacity upon FCCP addition (see Fig. S1 in the supplemental material). This pattern is similar to that of an uncoupling compound such as FCCP (30, 31). Additionally, compounds 341, 343, and 344 also produced oligomycin-resistant signals (Fig. S1), but rather than inducing an increase in cellular respiration, they decreased or had no impact on cellular respiration upon addition to the cells. Compounds 313, 340, 341, 342, 343, 344, 350, 694, 714, and 798 increased proton leak as measured by the difference between nonmitochondrial respiration and ATP-linked respiration (Fig. 3F). This suggests that these compounds either increased the diffusion of protons out of the mitochondrial intermembrane space or inhibited the OCR signal change caused by oligomycin.

FIG 3.

Compound effect on cellular respiration. Extracellular flux analysis of Huh7 cells treated with 50 μM the indicated compounds was performed. (A) Example oxygen consumption rate (OCR) data and compound addition diagram of vehicle control-treated cells. (B) Measurement of the OCR immediately after compound addition. (C to F) Measurement of compound effects on the OCR associated with the electron transport chain. Each treatment was performed three independent times. Data were analyzed by one-way ANOVA compared to the vehicle control. *, P < 0.05; **, P < 0.01. Mean OCRs ± 1 standard deviation are reported.

Effects of troponoids on glycolysis.

Twenty troponoids were selected based on the mitochondrial flux data for their ability to inhibit glycolysis in Huh7 cells. These experiments employed Seahorse XFp analyses to measure the extracellular acidification rate (ECAR) using a series of known inhibitors of glycolytic enzymes that isolate various components of glycolysis (Fig. 4A). Two troponoids (compounds 280 and 694) caused significant differences in the ECAR compared to the vehicle control immediately upon compound addition (Fig. 4B). Compound 280 increased the ECAR, but this spike was observed in ECAR experiments with no cells present (data not shown). Consequently, the increase was due to a chemical interaction with the medium and not a cellular response. Compounds 340, 344, 350, and 694 significantly decreased the glycolysis rate upon glucose addition (Fig. 4C). Compounds 341 and 342 also decreased the glycolysis rate albeit to a nonsignificant level. Compounds 340, 341, 343, 344, and 350 significantly reduced the glycolytic capacity of cells upon oligomycin addition, suggesting that these compounds either inhibit glycolysis specifically or inhibit the effect of oligomycin addition (Fig. 4D). Furthermore, compounds 341, 343, and 344 eliminated the glycolytic reserve of Huh7 cells (Fig. 4E). Compound 350 caused a significant reduction in the percent glycolytic capacity but did not significantly affect the glycolytic reserves of the cells. Notably, the most promising αHT HBV inhibitors, such as compounds 46, 110, 389, and 390, did not cause significant changes in the ECAR.

FIG 4.

Compound effect on the extracellular acidification rate. Extracellular flux analysis of Huh7 cells treated with 50 μM the indicated compounds was performed. (A) Extracellular acidification rate (ECAR) data and compound addition diagram of vehicle control-treated cells. (B) Measurement of the ECAR immediately after compound addition. (C to E) Measurement of compound effects on the glycolytic pathway. Each treatment was performed three independent times. Data were analyzed by one-way ANOVA compared to the vehicle control. *, P < 0.05; **, P < 0.01. Mean ECARs ± 1 standard deviation are reported.

One troponoid subgroup, the α-ketotropolones (compounds 340, 341, 342, 343, 344, and 345), inhibited both the ETC and glycolysis (Fig. 3 and 4). All members of this group except compound 345, the only member of the class that was not cytotoxic, caused significant effects on both the OCR and ECAR measurements. As such, we investigated this compound class and representative members of both the tropolone and αHT classes for their impact on mitochondria and cytotoxicity.

Effects of troponoids on the mitochondrial/nuclear DNA ratio.

Mitochondrial DNA (mtDNA) replication occurs independently of nuclear DNA (nucDNA) replication and requires the activity of human RNase H1 (huRNase H1) to remove the long RNA primers used to initiate DNA synthesis (32–35). We have previously shown that αHTs can inhibit both huRNase H1 and HBV RNase H (Table 1) (4, 11–13). Inhibition of huRNase H1 could therefore lead to cytotoxicity by decreasing the number of mitochondrial genomes within a cell. To this end, we assessed the effects that troponoids have on the mtDNA/nucDNA ratio by screening 30 troponoids in Huh7 cells and measuring the mtDNA/nucDNA ratio by quantitative PCR (qPCR) after treatment of the cells for 3 days. The cells divide about once per day, so a total shutoff of mtDNA synthesis would result in an ∼8-fold reduction in the mtDNA/nucDNA ratio. Due to the variable cytotoxicities of the compounds tested, cells were treated with either 2× CC₅₀ or 50 μM, whichever was lower, for 72 h. Compound 47 (β-thujaplicin), a tropolone that does not inhibit huRNase H1 (IC₅₀ [50% inhibitory concentration] >200 μM), significantly decreased the mtDNA/nucDNA ratio (Fig. 5). Only compound 382 significantly increased the mtDNA/nucDNA ratio. Notably, neither the most potent αHT anti-HBV inhibitors (compounds 46, 110, 280, 382, 389, 390, 391, and 1016) nor the most potent huRNase H1 inhibitors (compounds 118, 313, 714, 738, 741, and 1016) significantly altered the mtDNA/nucDNA ratio after a 72-h incubation (Fig. 5).

FIG 5.

Compound effect on the mtDNA/nucDNA ratio. Huh7 cells were treated with 2× CC₅₀ (compounds 46, 118, 340, 341, 342, 343, 344, 389, 390, 694, 714, 738, 741, 789, and 1016) or 50 μM in 1% DMSO for 3 days. The proportion of mitochondrial DNA to nuclear DNA was determined by qPCR. Data are presented as the means ± 1 standard deviation. *, P < 0.05; **, P < 0.01.

Impact of troponoids on mitochondrial morphology.

Mitochondria are morphologically dynamic, and their size, shape, and intracellular distribution can respond rapidly to cellular and/or mitochondrial stressors (36, 37). To determine if troponoids affected mitochondrial morphology, Huh7 cells were treated for 24 h with 1× CC₅₀ of representative compounds from the tropolone (compound 47), αHT (compounds 46, 110, 390, and 1016), and α-ketotropolone (compounds 340, 341, 342, 343, 344, and 345) chemotypes, and mitochondria were stained with MitoTracker red. Longer time periods are not reported as viable cells could not be imaged for cells treated with the α-ketotropolones due to advancing cytotoxicity. Cells treated with compounds 46, 47, 110, 345, 390, and 1016 had normal mitochondrial morphologies, including mitochondrial networks, compared to vehicle-treated cells. In contrast, Huh7 cells treated with compounds 340, 341, and 342 had large bright-staining mitochondria with an apparent reduction in the proportion of networked and total mitochondria. Cells treated with compounds 343 and 344 exhibited fragmented mitochondrial morphologies indicative of cells exposed to a mitochondrial stressor such as ROS (Fig. 6) (36).

FIG 6.

Effect of troponoids on mitochondrial morphology. Huh7 cells were treated with the indicated compounds at 1× CC₅₀ in 1% DMSO for 24 h. Mitochondria were stained with MitoTracker red CMXRos (red), and nuclei were stained with DAPI (blue). Arrowheads point to examples of normally networked mitochondrial morphologies, and arrows point to examples of fragmented mitochondria. Bars, 10 μm.

Troponoids can increase ROS production.

Previous reports have shown that the tropolone β-thujaplicin (compound 47) could increase ROS production preceding cell death (24, 26). We therefore assessed the ability of β-thujaplicin and other troponoids to elicit the production of ROS under cytotoxic concentrations. Cells were treated with 1× CC₅₀ for 3 days, stained with MitoSOX red, and analyzed by flow cytometry. All troponoids tested (compounds 46, 47, 110, 343, and 390) caused a significant increase in ROS production compared to the vehicle control (Fig. 7A). To determine if troponoid-mediated ROS production could be mitigated with an antioxidant, cells were cotreated with the ROS scavenger N-acetylcysteine (NAC) (38) plus compound 47 or 110. NAC treatment caused a significant decrease in ROS production in compound-treated cells but no significant change in vehicle-treated cells (Fig. 7B).

FIG 7.

Troponoid-mediated production of ROS and effect of NAC on cytotoxicity. (A) Huh7 cells were treated with 1× CC₅₀ for 72 h, stained with MitoSOX red, and analyzed for ROS by flow cytometry. Data were compared by one-way ANOVA to vehicle-treated cells. (B) Cells were treated and stained as described above with or without 10 mM NAC. t tests were performed to compare NAC- and non-NAC-treated groups. (C) Huh7 cells were treated with 2× EC₅₀ for 72 h, stained with MitoSOX red, and analyzed for ROS by flow cytometry. Data were compared by one-way ANOVA to vehicle-treated cells. (D and E) Huh7 cells were treated with a dilution of the compound with or without NAC for 72 h. Compounds 134, 514, 1073, and 1133 are cytotoxic nontroponoid compounds. Each pair of CC₅₀ values was compared by a pairwise t test. (E) Fold changes in CC₅₀ values with or without NAC were compared for cytotoxic troponoid and nontroponoid compounds by a t test. Data are reported as means ± 1 standard deviation. *, P < 0.05; **, P < 0.01; ***, P < 0.001; ****, P < 0.0001; ns, not significant.

The troponoids increased ROS production at cytotoxic concentrations; however, these concentrations are much higher than those used to inhibit HBV replication. To test if troponoids increased ROS production at concentrations used to inhibit HBV replication, Huh7 cells were treated with 2× EC₅₀ of compounds 46, 110, and 390 (1.81, 0.506, and 0.628 μM, respectively) and incubated for 3 days. Compound 47 was also analyzed, but as it is unable to inhibit HBV replication (EC₅₀ > 100 μM) (Table 1), cells were treated with the same amount of compound 47 as that of its structural analog compound 46. ROS levels were measured after 3 days of compound exposure as described above. No significant change in ROS production was measured in cells that were treated with 2× EC₅₀ compared to the vehicle control (Fig. 7C).

Troponoid cytotoxicity is ameliorated by N-acetylcysteine treatment.

NAC treatment mitigated troponoid-mediated ROS production (Fig. 7). Therefore, the cytotoxicity of 14 troponoids and 4 nontroponoids was measured in Huh7 cells with or without the addition of 10 mM NAC for 72 h. CC₅₀ values for each troponoid tested with measurable cytotoxicity (CC₅₀ < 100 μM) increased upon NAC treatment. In contrast, there was no significant increase in CC₅₀ values when NAC was present for each of the four cytotoxic nontroponoid compounds from three different chemotypes (Fig. 7D). Comparison of the fold changes of CC₅₀ values upon the addition of NAC in troponoid- and non-troponoid-treated cells revealed a significant difference between the groups (P < 0.0001) (Fig. 7E).

DISCUSSION

Our goal was to analyze the mitochondrially mediated cytotoxicity of troponoid compounds to help guide the future development of the αHTs as potential drugs targeting HBV RNase H. Previous studies revealed that tropolones can inhibit the ETC, act as uncouplers of the ETC, activate the unfolded protein response, and induce ROS production, resulting in autophagic cell death and apoptosis (21–26). Here, we show that troponoids as a broad class of compounds do not inhibit the electron transport chain or the glycolytic pathway and do not affect the mtDNA/nucDNA ratio but that troponoids can induce the production of ROS at cytotoxic concentrations.

Troponoid cytotoxicities were similar in the three fully transformed liver cancer cell lines, but three αHTs with substantial efficacy against HBV replication and measurable cytotoxicity in transformed hepatic cell lines were not cytotoxic in PHHs as measured by both MTS and LDH assays (Table 1). Similar cytotoxicity patterns have been observed with the tropolone β-thujaplicin (compound 47) (26). This difference may be caused by the large amount of ROS present within cancer cells, such as the cell lines typically used to study liver cell metabolism and HBV replication. The high ROS levels in cancer cells have been exploited for chemotherapeutic treatment with agents such as cisplatin, which further increases ROS levels and causes DNA damage in cancer cells to cause cell death (39–41). In normal healthy cells, there may also be a troponoid-mediated increase in ROS production, but at least under the conditions employed here, it was not to levels sufficient to induce cell death (Table 1). This implies that troponoids with moderate cytotoxicity in transformed cell lines may be adequately tolerated in vivo.

huRNase H1 removes long RNA primers used to initiate the replication of the mitochondrial genome. The ablation of huRNase H1 blocks the subsequent replication of the mitochondrial genome and is embryonically lethal in mice (32–34). αHTs can inhibit huRNase H1 (Table 1), potentially inhibiting the synthesis of new mtDNA. Consequently, the effects of the troponoids on the ratio were measured. None of the most potent huRNase H1 inhibitors decreased the mtDNA/nucDNA ratio; however, compound 47, which does not inhibit huRNase H1, decreased the mtDNA/nucDNA ratio (Fig. 5) (Table 1). This indicates that the main mode of cytotoxicity for the troponoids evaluated here is independent of specifically altering the mtDNA/nucDNA ratio. These data are from a 3-day incubation where we would expect a 4- to 8-fold reduction in the mtDNA/nucDNA ratio based on the growth rate of the cells if huRNase H1 activity was fully ablated, but the ratios were largely unchanged. This implies that cytotoxicity from suppressing mtDNA levels in cells is unlikely to occur in vivo, at least during relatively short-term drug treatments.

Previous reports indicate that the tropolone β-thujaplicin (42) can inhibit the electron transport chain to decrease ATP levels in isolated mitochondria and rat hepatocytes upon treatment with 200 μM or 1 to 4 mM, depending on the study (21, 25). We expanded upon this observation by screening 35 diverse troponoids at 50 μM, which is lower than the concentrations used previously but still much higher than the effective concentrations of the αHTs against HBV replication (Table 1). This high level was used to reveal any effects on cellular respiration that may be present. We found that β-thujaplicin, αHTs, and other troponoids do not act directly upon glycolysis or the ETC. In contrast, all cytotoxic α-ketotropolones tested impacted both the ETC and glycolytic pathways. Interestingly, the α-ketotropolones were somewhat resistant to the effects of oligomycin addition in both assays. This oligomycin resistance could be a result of preventing oligomycin from binding to and inhibiting ATP synthase (Fig. 3C), acting as an uncoupler, or disrupting the mitochondrial membrane. In contrast, the α-ketotropolone compound 345 was not cytotoxic and had no impact on cellular respiration. The reason for this is unknown, but the presence of the pyridine ring may impact cellular permeability or other interactions of the compound with cells. Our data are not consistent with previous reports that troponoids, particularly β-thujaplicin (compound 47), are general inhibitors of cellular respiration (21, 25). This discrepancy could be due to the high compound concentrations previously used to measure β-thujaplicin’s effect on cellular respiration. However, while Nakagawa and Tayama (25) concluded that β-thujaplicin inhibits both respiration and ATP production, their data also show minimal effects on ATP production from 1 mM β-thujaplicin and 2 mM two other troponoids in isolated rat hepatocytes and oxygen consumption in isolated mitochondria. Our study with a wider range of compounds revealed that troponoids, and specifically αHTs, do not generally inhibit cellular respiration at concentrations well above inhibitory levels against HBV.

Previous studies have stated that troponoids, specifically β-thujaplicin, can uncouple the ETC (25). However, we found that troponoids as a general class do not act as uncouplers, but one troponoid, compound 350, had uncoupler-like activities. Compound 350 significantly increased the OCR in Huh7 cells immediately upon addition and was resistant to the effects of both oligomycin and FCCP addition (Fig. 3). A similar uncoupling effect has been seen by van der Stel et al. (31), where cyazofamid immediately increased OCR signaling, and the elevated OCR was resistant to oligomycin and FCCP addition. The uncoupling-like effect caused by compound 350 can be seen on the linear readout of the Seahorse data (see Fig. S1 and S2 in the supplemental material).

β-Thujaplicin (compound 47) has been studied extensively as the prototypical member of the troponoid class. It can induce multiple cellular responses, including cell cycle arrest, autophagy, and ROS generation that is rescuable by treatment with the ROS scavenger NAC (22, 24, 26). Here, we looked at the broader troponoid class and showed that other troponoids similarly increased ROS production within cells and that treatment with NAC decreased both ROS production and cytotoxicity. The most plausible mechanism for ROS-mediated cell death is apoptosis, as previously determined for β-thujaplicin (26). The inability of NAC to fully suppress the cytotoxicity of the troponoids (Fig. 7D) indicates that ROS induction is not the only mechanism of cytotoxicity for this chemotype. The other mechanism(s) remains unknown but may stem from the action of either the compounds themselves or their metabolites, and it is possible that the degradation of the 7-membered aromatic ring may produce by-products that induce a chemotype-wide cytotoxic mechanism. However, not all troponoids have the same capacity to induce cytotoxicity, as evidenced by the widely varying CC₅₀ values within the class (Table 1). This suggests that while cytotoxic troponoids may have similar mechanisms of cytotoxicity, not all troponoids induce all aspects of cytotoxicity associated with this chemotype to the same degree. Therefore, one compound cannot represent the entire troponoid chemotype.

αHTs elicit ROS production within fully transformed cells at their cytotoxic concentrations (Fig. 7). However, the concentrations used to determine troponoid-mediated effects throughout this study were 12- to 200-fold higher than the submicromolar EC₅₀s of the best αHTs. These high concentrations were used to reveal sources of cytotoxicity and not to mimic effects during treatment. The best HBV inhibitors caused no significant effects on mitochondrial function (Fig. 3 and 4), the mtDNA/nucDNA ratio (Fig. 5), or mitochondrial morphologies (Fig. 6), even at concentrations known to be cytotoxic, much less at their anti-HBV effective concentrations. Additionally, no significant increase in ROS was measured for compounds 46, 110, and 390 at concentrations sufficient to inhibit HBV. It is possible that the SIs of the anti-HBV RNase H inhibitors will be substantially higher in normal cells than in transformed cells, as evidenced by the lack of cytotoxicity in PHHs and negligible ROS induction in Huh7 cells at concentrations known to greatly inhibit HBV replication. Therefore, the αHTs remain a promising chemotype for development into anti-HBV therapeutics. However, future development of the αHTs needs to focus on both the inhibitory capacity of the compound and mitigating ROS production. If cytotoxicity persists with more advanced compounds, investigation of the coadministration of a safe and robust antioxidant such as NAC (29, 38, 42–44) to mitigate possible side effects would be merited.

MATERIALS AND METHODS

Cell culture.

Huh7, HepG2, and HepDES19 cells were incubated on collagen-coated plates (Corning) at 37°C in Dulbecco’s modified Eagle’s medium (DMEM)–F-12 medium (General Electric Healthcare) containing 10% fetal bovine serum (FBS), penicillin (100 IU/mL), and streptomycin (100 μg/mL) in the presence of 5% CO₂ at saturating humidity. HepDES19 cells are a HepG2 derivative carrying a stable, tetracycline-repressible HBV genomic expression cassette and were maintained in the presence of tetracycline (27). Cryopreserved, preplated primary human hepatocytes (PHHs) were obtained from Sekisui Xenotech and were maintained in OptiCulture medium (Sekisui Xenotech).

Cytotoxicity. (i) Hepatic cell lines.

HepDES19, HepG2, and Huh7 cells were plated on 96-well plates (Greiner) at 1.0 × 10⁴ cells per well and incubated for 48 h as described previously (45). Cells were treated with the compound in 1% dimethyl sulfoxide (DMSO) for 72 h. Cellular viability was measured using the CellTiter 96 aqueous nonradioactive cell proliferation assay (Promega) that measures mitochondrial function. A solution containing 2 mg/mL 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium, inner salt (MTS), and 0.043 mg/mL phenazine methosulfate (PMS) was added to the cells, and the mixture was incubated for 2 h at 37°C. Background absorbance values were subtracted, and data were converted to percent cell viability. The 50% cytotoxic concentration (CC₅₀) values were determined with GraphPad Prism using the four-parameter variable slope algorithm with the bottom set to zero. Three or more replicate assays were done on separate days for each cell line.

(ii) Primary human hepatocytes.

Primary human hepatocytes were preplated at 5.6 × 10⁴ cells per well in a 96-well plate. Upon receipt, cells were incubated for 24 h with fresh medium before treating them with the compound (1% DMSO, final concentration) for 72 h. Cytotoxicity was measured by both MTS assays as described above and the Pierce lactate dehydrogenase (LDH) cytotoxicity assay kit (Thermo Fisher). Briefly, 50 μL of medium was transferred to a new 96-well plate and assessed for LDH release according to the manufacturer’s instructions. The absorbance was measured at 490 nm. Data were analyzed as described above. Assays were performed in duplicate.

(iii) Effects of N-acetyl-l-cysteine on cytotoxicity.

Huh7 cells were plated onto two 96-well plates (Greiner) at 1.0 × 10⁴ cells per well and incubated for 48 h. Cells were washed with phosphate-buffered saline (PBS), and medium was added to both plates, one supplemented with 10 mM N-acetyl-l-cysteine (NAC) (Sigma-Aldrich). Cells were incubated for 1 h prior to compound addition and then for 72 h with a compound and NAC refreshment at 48 h. Cells were washed twice with PBS, and fresh medium was added to each plate. Cytotoxicity was measured by MTS assays, and data were analyzed as described above.

Anti-HBV efficacy.

HBV replication inhibition assays were performed in HepDES19 cells, and 50% effective concentration (EC₅₀) values were calculated from the suppression of the HBV plus-polarity DNA strand using a strand-preferential quantitative PCR (qPCR) assay as described previously (28).

Mitochondrial DNA/nuclear DNA ratio.

Huh7 cells were plated into a 12-well plate (Corning) at 1.0 × 10⁵ cells per well and incubated at 37°C for 48 h. Cells were washed with PBS and treated with the compound in 1% DMSO for 72 h. Cells were lysed with mitochondrial lysis buffer (0.5% sodium dodecyl sulfate [SDS], 100 mM NaCl, 10 mM EDTA, and 20 mM Tris-HCl [pH 7.4]) supplemented with 100 μg/mL of proteinase K (Thermo Fisher). Lysates were incubated for 2 h at 37°C, and DNA was purified via phenol-chloroform extraction.

Mitochondrial and nuclear DNA levels were measured by TaqMan qPCR. Primer-probe sets and qPCR methods were adapted from methods described previously by Bai and Wong (46). Briefly, qPCR was performed with 45 cycles of 95°C for 15 s and 57°C for 1 min with 300 nM each primer and 100 nM probe employing Kappa Probe Force universal PCR master mix (Roche) with 4 ng of purified template DNA. The primers and probe (IDT Inc.) targeting the mitochondrial D-loop were 5′-CATCTGGTTCCTACTTCAGGG-3′, 5′-TGAGTGGTTAATAGGGTGATAGA-3′, and 5′–6-carboxyfluorescein (6FAM)–CTTAAATAAGACATCACGATGGATCAC–5-carboxytetramethylrhodamine (6-TAMsp)–3′. The primers and probe targeting the nuclear β₂-microglobulin gene were 5′-TGCTGTCTCCATGTTTGATGTATCT-3′, 5′-TCTCTGCTCCCCACCTCTAAGT-3′, and 5′–6FAM–TTGCTCCACAGGTAGCTCTAGGAGG–6-TAMsp–3′. Mitochondrial DNA (mtDNA)/nuclear DNA (nucDNA) ratios were determined by subtracting the mitochondrial D-loop threshold cycle (C_T) value from the nuclear β₂-microglobulin C_T value and then inserting the ΔC_T value into the following equation: mtDNA/nucDNA = 2 × 2^ΔCT. mtDNA/nucDNA ratios were then normalized to the vehicle controls from the same assay. Each compound was tested at least three independent times.

Human RNase H1 inhibition.

Recombinant human RNase H1 (huRNase H1) was purified as described previously by Nowotny et al. (47), with minor modifications. Glucose (1%) was included in the induction medium to suppress leaky expression during cell growth in Escherichia coli LOBSTR. Additionally, 1 mM Tris(2-carboxyethyl)phosphine (TCEP) (Sigma-Aldrich) was used instead of 2-mercaptoethanol in purification buffers. Protein was >95% pure after Ni²⁺ affinity purification. The buffer was exchanged via Zeba desalting spin columns (Thermo Fisher) into a storage buffer containing 50 mM HEPES, 1 M NaCl, 5% glycerol, and 2 mM TCEP (pH 7.5).

RNase H reactions were carried out with 2 nM or less recombinant huRNase H1 and 100 nM heteroduplex substrate in a solution containing 50 mM HEPES (pH 7.5), 100 mM NaCl, 2 mM TCEP, 0.5 mg/mL bovine serum albumin (BSA), and 0.2 U of RNase Out (Sigma-Aldrich) in a 96-well black plate (Thermo Fisher) at 28°C. The substrate was RHSF5 (GAUCUGAGCCUGGGAGCU–3′-6FAM) annealed to DQ9 (5′-Iowa Black fluorescent quencher [IABkFQ]–AGCTCCCAGGCTCAGATC) (IDT Inc.). Compound dilutions were added to the reaction buffer in 5% DMSO, and reactions were initiated by the addition of prewarmed MgCl₂ to 5 mM. The fluorescence of each reaction was read at regular intervals in a Synergy HTX plate reader (BioTek) using 485/20-nm and 528/20-nm excitation and emission filters. The background fluorescence from the control reaction mixtures lacking MgCl₂ was subtracted from the fluorescence of each reaction, and initial rates were determined from the linear phase of the reaction curve. Fifty percent inhibitory concentration (IC₅₀) values were calculated from the reaction rates with Prism (GraphPad) using the three-parameter nonlinear fitting algorithm.

Mitochondrial flux analysis.

Extracellular flux assays were performed with the Seahorse XFp flux analyzer (Agilent). The oxygen consumption rate (OCR) and extracellular acidification rate (ECAR) of Huh7 cells were assessed using the Agilent mitochondrial stress test and the Agilent glycolytic stress test, respectively, according to the manufacturer’s procedures. Huh7 cells were seeded at 1.6 × 10⁴ cells per well in an XFp cell cartridge plate (Agilent) and incubated overnight. Test compounds were added so that the final concentration was 50 μM in 1% DMSO. Control compounds were used at the following concentrations: oligomycin at 1.5 μM, 2-{2-[4-(trifluoromethoxy)phenyl]hydrazinylidene}-propanedinitrile (FCCP) at 0.5 μM, and antimycin A/rotenone at 0.5 μM. All assays were done in at least triplicate, with each assay being performed on separate days.

Mitochondrial staining. (i) MitoTracker red CMXRos.

Huh7 cells were plated onto coverslips at 1.5 × 10⁵ cells per well in a 6-well plate (Corning) and incubated for 48 h at 37°C. Cells were treated with 1× CC₅₀ in 1% DMSO for 24 h, stained with 50 nM MitoTracker red CMXRos (Invitrogen) for 45 min, and fixed with 3.7% paraformaldehyde. Coverslips were mounted onto microscope slides with Prolong gold antifade reagent with 4′,6-diamidino-2-phenylindole (DAPI) (Thermo Fisher) and imaged with a DM IRB microscope (Leica Microsystems). Representative images were selected from two independent experiments.

(ii) MitoSOX red.

Huh7 cells were plated into 60-mm dishes (Corning) at 8.0 × 10⁵ cells per plate and incubated for 48 h at 37°C. Cells were treated with 1× CC₅₀ or 2× EC₅₀ in 1% DMSO for 72 h. Cells were lifted from the plate with trypsin and washed once with PBS before staining with 5 μM MitoSOX red (Invitrogen) for 10 min at 37°C. Cells were washed three times with PBS before flow cytometric analysis on an LSRFortessa X-20 cell analyzer (BD Biosciences) by the Saint Louis University Flow Cytometry Core Facility. Flow cytometry data were analyzed using FlowJo v.10 software (Tree Star Inc.).

Statistical analysis.

Statistical analysis of the Seahorse XFp data was performed by using the method described previously by Nicholas et al. as a guide (48). For every independent assay, the median nonmitochondrial respiration or nonglycolytic acidification rate was subtracted from each data point. Each data point was then normalized to the mean of the final three points of the basal oxygen consumption rate or mean basal acidification rate and reported as a percentage. Data were compared to the vehicle control using analysis of variance (ANOVA) with Dunnett’s post hoc test for significance. Significance between CC₅₀ values of compounds in the presence and absence of NAC was determined with pairwise t tests. Fold changes in CC₅₀ values were determined by dividing the CC₅₀ value of NAC-treated cells by that of non-NAC-treated cells, and troponoids and nontroponoids were then grouped and analyzed by a parametric t test. All data, unless otherwise specified, were compared to the vehicle control using ANOVA and are reported as means ± 1 standard deviation.