ABSTRACT
Echinocandins are noncompetitive inhibitors of the GSC1 subunit of the enzymatic complex involved in synthesis of 1,3-beta-d-glucan, a cell wall component of most fungi, including Pneumocystis spp. Echinocandins are widely used for treating systemic candidiasis and rarely used for treating Pneumocystis pneumonia. Consequently, data on P. jirovecii gsc1 gene diversity are still scarce compared to that for the homologous fks1 gene of Candida spp. In this study, we analyzed P. jirovecii gsc1 gene diversity and the putative selection pressure of echinocandins on P. jirovecii. gsc1 gene sequences of P. jirovecii specimens from two patient groups were compared. One group of 27 patients had prior exposure to echinocandins, whereas the second group of 24 patients did not, at the time of P. jirovecii infection diagnoses. Two portions of the P. jirovecii gsc1 gene, HS1 and HS2, homologous to hot spots described in Candida spp., were sequenced. Three single-nucleotide polymorphisms (SNPs) at positions 2204, 2243, and 2303 close to the HS1 region and another SNP at position 4540 more distant from the HS2 region were identified. These SNPs represent synonymous mutations. Three gsc1 HS1 alleles, A, B, and C, and two gsc1 HS2 alleles, a and b, and four haplotypes, Ca, Cb, Aa, and Ba, were defined, without significant difference in haplotype distribution in both patient groups (P = 0.57). Considering the identical diversity of P. jirovecii gsc1 gene and the detection of synonymous mutations in both patient groups, no selection pressure of echinocandins among P. jirovecii microorganisms can be pointed out so far.
KEYWORDS: Pneumocystis jirovecii; gsc1; 1,3-beta-d-glucan; echinocandins; genomic diversity; hot spots
INTRODUCTION
Pneumocystis jirovecii is an opportunistic ascomycete responsible for severe pneumonia in immunosuppressed patients (1). Pneumocystis pneumonia (PCP) remains the most frequent AIDS-defining illness in developed countries, including France (2, 3). PCP is also observed with increased frequency in non-HIV-infected immunosuppressed patients, such as solid-organ transplant recipients and patients with hematological malignancies or solid cancers (4). For these reasons, PCP is still a public health issue. The drugs for PCP prophylaxis or treatment target enzymes or co-enzymes that are involved in Pneumocystis metabolic pathways. The sulfonamides that target the dihydropteroate synthase (DHPS) are widely used in association with trimethoprim or trimethoprim analogues. P. jirovecii organisms with nonsynonymous mutations mostly at nucleotide positions 165 (A165G; Thr55Ala) and 171 (C171T; Pro57Ser) on the dhps locus have been detected in patients with PCP (reviewed in reference 5). Prior exposure to sulfonamide drugs has been identified as a predictor of mutant genotypes (reviewed in reference 5). Establishing correlations between mutants and resistance is problematic, since Pneumocystis spp. are uncultivable. Nonetheless, it was shown that the corresponding mutations in a cultivable yeast Saccharomyces cerevisiae model may confer sulfonamide resistance (6–8). Trimethoprim and trimethoprim analogues target the dihydrofolate reductase (DHFR). The diversity of the DHFR gene of P. jirovecii has been investigated, and it showed numerous nonsynonymous mutations (9, 10). Although it is usually admitted that monotherapy with trimethoprim or trimethoprim analogues plays a minimal role in PCP treatment, specific mutations may contribute to resistance to this drug (9, 10). Atovaquone is a second-line drug for PCP treatment and prophylaxis. The drug targets the co-enzyme cytochrome b. Nonsynonymous mutations in the cytochrome b gene that may confer resistance to atovaquone have been identified (11). Specifically, we recently described a previously unreported A144V mutation (C431T; Ala144Val) that potentially diminished the sensitivity of P. jirovecii to atovaquone, resulting in spread of the fungus among heart transplant recipients submitted to atovaquone prophylaxis (12). Echinocandins are noncompetitive inhibitors of the GSC1 subunit of the enzymatic complex involved in 1,3-beta-d-glucan synthesis, 1,3-beta-d-glucan being a major cell wall component of most fungi, including Pneumocystis species asci (13). However, the use of these drugs for PCP treatment was not initially considered (13). On the other hand, echinocandins are widely used as a treatment for systemic candidiasis (14) or invasive aspergillosis (15). In these circumstances, nonsynonymous mutations that confer resistance to caspofungin, the most widely used echinocandin, have been identified on the fks1 gene of the fungal pathogens Candida spp. (16), whereas data on the diversity of the gsc1 gene (homologous to fks1 gene) of P. jirovecii are still scarce (17). The aforementioned mutations were found in two hot spots of the fks1 gene, named HS1 and HS2 (18, 19). The objectives of the present study were to provide original data on the diversity of the gsc1 gene of P. jirovecii and to test the hypothesis that echinocandins exert selective pressure on P. jirovecii organisms. Partial sequences of the gsc1 gene of P. jirovecii specimens obtained from two patient groups were compared. One group had prior exposure to echinocandins, whereas the second one did not, at the time of P. jirovecii infection diagnoses.
RESULTS
The sequencing of the gsc1 gene was performed on P. jirovecii specimens from 51 patients focusing on two regions, HS1 and HS2. However, the HS1 region was not amplified in patient B31 and the HS2 region was not amplified in patients B27 and B29. Three SNPs were observed at nucleotide positions 2204 (A or G), 2243 (C or T), and 2303 (C or A), as previously reported by Luraschi et al. (17), based on sequences referenced by Cissé et al. (20) and Ma et al. (21). A previously undescribed SNP was observed at nucleotide position 4540 with residue A or G (Fig. 1, Tables 1 and 2). The aforementioned SNPs close to the HS1 region and more distant from the HS2 region correspond to synonymous mutations that were not involved in codon changes. However, examination of HS1 and HS2 regions stricto sensu did not reveal any SNPs. Alignments of P. jirovecii GSC1 proteins with GSC1 proteins of C. albicans, C. tropicalis, C. krusei (18), and S. cerevisiae (22) determined that P. jirovecii HS1 and HS2 regions were located at amino acids positions 714 to 722 and 1393 to 1400, respectively (Fig. 2).
FIG 1.
Single-nucleotide polymorphisms in Pneumocystis jirovecii hot spot 1 (HS1) and HS2 DNA regions after sequencing. Analysis of 51 P. jirovecii specimens led to the identification of three SNPs close to the HS1 region at positions 2204, 2243, and 2303 and one SNP more distant from the HS2 region at position 4540. Only the surrounding regions of polymorphic positions are shown. Sequence logos were created using the WebLogo application (https://weblogo.berkeley.edu/logo.cgi). The height of each amino acid symbol indicates the relative frequency of each amino acid at that position. Dots indicate identical nucleotides to the reference sequence. Pjgsc1-Cisse, gsc1 gene sequence of P. jirovecii retrieved from Cissé and colleagues’ genome (20); Pjgsc1-Ma, gsc1 gene sequence of P. jirovecii retrieved from Ma and colleagues’ genome (21); Pjgsc1-B4, gsc1 gene sequence of P. jirovecii from patient B4; Pjgsc1-B20, gsc1 gene sequence of P. jirovecii from patient B20; Pjgsc1-N10, gsc1 gene sequence of P. jirovecii from patient N10.
TABLE 1.
SNPs, alleles, and haplotypes of Pneumocystis jirovecii gsc1 gene identified in patients with prior exposure to echinocandins at the time of diagnosis of P. jirovecii infections
| Patient or reference | HS1 region |
HS2 region |
Haplotype | ||||
|---|---|---|---|---|---|---|---|
| 2204 | 2243 | 2303 | Allele | 4540 | Allele | ||
| Cissé et al. (20) | A | C | C | B | G | a | Ba |
| Ma et al. (21) | G | T | A | A | G | a | Aa |
| B25 | G | C | C | C | A | b | Cb |
| B26 | G | C | C | C | G | a | Ca |
| B27 | G | C | C | C | ND | ND | —b |
| B28 | G | C | C | C | G | a | Ca |
| B29 | G | C | C | C | ND | ND | —b |
| B30 | G | C | C | C | G | a | Ca |
| B31 | NDa | ND | ND | ND | A | b | —b |
| B32 | G | C | C | C | A | b | Cb |
| B33 | G | C | C | C | G | a | Ca |
| B34 | G | C | C | C | G | a | Ca |
| N1 | G | C | C | C | G | a | Ca |
| N2c | G | C | C | C | A/G | a and b | Ca and Cb |
| N3 | G | C | C | C | G | a | Ca |
| N4 | G | C | C | C | G | a | Ca |
| N5 | G | C | C | C | A | b | Cb |
| N6 | G | C | C | C | G | a | Ca |
| N7 | G | C | C | C | G | a | Ca |
| N8 | G | C | C | C | G | a | Ca |
| N9 | G | C | C | C | A | b | Cb |
| N10 | A | C | C | B | G | a | Ba |
| N11 | G | C | C | C | A | b | Cb |
| N12c | G | C/T | C/A | A and C | A/G | a and b | —b |
| N13 | G | C | C | C | A | b | Cb |
| N14 | G | C | C | C | G | a | Ca |
| N15c | G | C | C | C | A/G | a and b | Ca and Cb |
| N16 | G | C | C | C | A | b | Cb |
| N17 | G | T | A | A | G | a | Aa |
ND, not determined.
Haplotype was not determined because of mixed infections that concerned the two HS1 and HS2 regions or because of undetermined alleles of HS1 or HS2 regions.
Mixed infections in patients N2, N12, and N15.
TABLE 2.
SNPs, alleles, and haplotypes of Pneumocystis jirovecii gsc1 gene identified in patients without prior exposure to echinocandins at the time of diagnosis of P. jirovecii infections
| Patient or reference | HS1 region |
HS2 region |
Haplotype | ||||
|---|---|---|---|---|---|---|---|
| 2204 | 2243 | 2303 | Allele | 4540 | Allele | ||
| Cissé et al. (20) | A | C | C | B | G | a | Ba |
| Ma et al. (21) | G | T | A | A | G | a | Aa |
| B1 | G | C | C | C | G | a | Ca |
| B2 | A/G | C | C | B and C | A/G | a and b | —a,b |
| B3 | G | C | C | C | G | a | Ca |
| B4 | G | C | C | C | A | b | Cb |
| B5 | G | C | C | C | G | a | Ca |
| B6 | G | C | C | C | G | a | Ca |
| B7 | G | C | C | C | G | a | Ca |
| B8 | G | C | C | C | A | b | Cb |
| B9 | G | C | C | C | G | a | Ca |
| B10 | G | C | C | C | G | a | Ca |
| B11 | G | C | C | C | G | a | Ca |
| B12 | G | C | C | C | G | a | Ca |
| B13 | G | C | C | C | G | a | Ca |
| B14 | G | C | C | C | G | a | Ca |
| B15 | G | C | C | C | G | a | Ca |
| B16 | G | C | C | C | A | b | Cb |
| B17 | G | C | C | C | G | a | Ca |
| B18 | G | C | C | C | A | b | Cb |
| B19 | G | C | C | C | G | a | Ca |
| B20 | G | T | A | A | G | a | Aa |
| B21 | G | C | C | C | A/G | a and b | Ca and Cbb |
| B22 | G | C | C | C | G | a | Ca |
| B23 | G | C/T | C/A | A and C | G | a | Ca and Aab |
| B24 | G | C | C | C | A | b | Cb |
Haplotype was not determined because of mixed infections that concerned the two HS1 and HS2 regions simultaneously.
Mixed infections in patients B2, B21, and B23.
FIG 2.
Position of HS1 and HS2 of wild GSC1 protein types of C. albicans, C. tropicalis, C. krusei (Desnos-Olivier et al. [18]), and Saccharomyces cerevisiae (Luraschi et al. [22]) aligned with the GSC1 protein type of P. jirovecii (Cissé et al. [20], Ma et al. [21]). Boldfaced amino acids indicate known positions of mutations at HS1 and HS2 of GSC1 protein of Candida species. HS1 and HS2 GSC1 protein sequences of P. jirovecii in the present study were identical to those described by Cissé et al. (20) and Ma et al. (21).
Three P. jirovecii gsc1 HS1 alleles, named A, B, and C, were determined considering the SNPs found close to the HS1 region. Two gsc1 HS2 alleles, named a and b, were determined considering the SNP found close to the HS2 region (Tables 1 and 2). Allele C was observed in 24 patients of the first group and in 23 patients of the second group. Allele B was observed in one patient of each group. Allele A was observed in two patients of each group.
Allele a was observed in 17 patients of the first group and in 19 patients of the second group. Allele b was observed in 11 patients of the first group and in seven patients of the second group. Considering the aforementioned SNPs, four haplotypes combining HS1 and HS2 alleles, named Ca, Cb, Aa, and Ba, were identified. Mixed infections that corresponded to more than one putative haplotype in the same specimen were detected in three patients, N2, N12, and N15, of the first group and in three patients, B2, B21, and B23, of the second group. Haplotypes were not determined when mixed infections concerned the two hot spots simultaneously, e.g., in patients B2 and N12, or when HS1 or HS2 region amplification failed, e.g., in patients B27, B29, and B31 (Tables 1 and 2). Ca was the most frequent haplotype and was detected in 14 out of 23 patients of the first group for whom positive results of haplotype identification were obtained and in 17 out of 23 patients of the second group (Table 2). No significant difference in haplotype distribution was shown between the two groups of patients (Fisher’s exact test, P = 0.57). Thus, both groups of patients appear to be infected with similar strains of P. jirovecii.
DISCUSSION
In this study, we obtained the first results of diversity of the gsc1 gene among P. jirovecii specimens from 51 patients routinely diagnosed with P. jirovecii infections, whereas Cissé et al. (20) and Ma et al. (21) examined only one specimen each when they sequenced the whole genome of P. jirovecii and Luraschi et al. (17) did not examine clinical specimens when they characterized the gsc1 gene of P. jirovecii or investigated P. jirovecii sensitivity to caspofungin (22). We chose to examine HS1 and HS2, since nonsynonymous mutations that confer resistance to caspofungin have been identified on homologous sequences of Candida spp. (16, 18, 19, 23). The amplification of HS1 failed in patient B31, and the amplification of HS2 failed in patients B27 and B29. These results could be explained by technical issues due to low burdens of P. jirovecii DNA in pulmonary specimens combined with putative DNA degradation in relationship with successive freezing-thawing cycles contemporaneous to specimen reexamination. Indeed, patients B31 and B27 did not develop overt PCP, were colonized by the fungus, and consistently harbored low P. jirovecii pulmonary burdens. Patient B29 developed PCP but only a sputum sample was examined, this kind of sample being characterized by poor cellular quality and low P. jirovecii burdens.
Since echinocandins were not initially considered for PCP treatment (13) and were only secondarily proposed as a second line of PCP treatment in leukemic patients (24), no archival P. jirovecii specimens from patients who were effectively treated with echinocandins for one or recurrent episodes of PCP were available in our laboratory. For these reasons, our approach consisted of examining P. jirovecii specimens from patients who developed a PCP episode after being treated with echinocandins for another invasive fungal infection. This method made possible the collection of 27 P. jirovecii specimens in this context. It was noteworthy that two patients, B34 and B30, were treated with echinocandins when PCP was diagnosed. Echinocandin treatment was maintained after PCP diagnosis during 5 days and 15 days in the first and second patient, respectively. These two patients were treated with caspofungin because of allergic bronchopulmonary aspergillosis and invasive pulmonary aspergillosis, respectively. Both harbored allele Ca, which was the major allele for all patients enrolled in this study, whatever their characteristics. The other 25 patients were no longer treated with echinocandins when PCP was diagnosed, the median duration of echinocandin treatment being 15 days (range, 1 to 29 days) and the median time between the end of echinocandin treatment and PCP diagnosis was 562 days (range, 152 to 1,533 days) (Table 3). Considering the hypothesis that PCP results from reactivation of long-term pulmonary colonization with P. jirovecii, the patients could have still been under selection pressure, whatever the duration of echinocandin treatment and the time between the end of echinocandin treatment and PCP diagnosis. The second hypothesis is that PCP results from de novo acquisition of the fungus. In this case, the duration of PCP incubation is considered highly variable, from 7 to 90 days (25–28), but a duration of less than 3 months is generally assumed. In 25 patients who were no longer treated with caspofungin during the 3 months preceding PCP diagnoses, there would no longer be any selection pressure at the time of the acquisition of P. jirovecii, while for the two patients who had been treated with caspofungin during the three preceding months, caspofungin might have exerted selection pressure at the time of the acquisition of P. jirovecii. This small number of two patients could represent the main limit of the study. It could be interesting to enroll a number of patients effectively treated with echinocandins or having been treated with echinocandins within the 3 months preceding PCP diagnosis. This will be possible in future years, given the new ECIL recommendations that retain echinocandins as a second line of PCP treatment (24). Recurrences or relapses of PCP in patients initially treated with echinocandins will provide P. jirovecii specimens that may be examined for this purpose.
TABLE 3.
Characteristics of 27 patients with prior exposure to echinocandins at the time of Pneumocystis jirovecii infection diagnoses
| Patient codea,b | Sexc | Age (yr) | Underlying disease | Prior echinocandin treatment | Time between echinocandin treatment start and Pneumocystis infection onset (days) | Duration of echinocandin treatment (days) | Sample | Presentation of Pneumocystis infection (alternative diagnosis of PCP) | Treatment of Pneumocystis Infection | Outcome |
|---|---|---|---|---|---|---|---|---|---|---|
| B25 | F | 58 | Chronic myelogenous leukemia | Caspofungin | 181 | 29 | BALe | Colonizationf | Improvement | |
| B26 | F | 46 | Acute myeloid leukemia | Micafungin, caspofungin | 447 | 29 | BAL | Colonization (bacterial pneumonia) | Improvement | |
| B27 | M | 63 | Bronchial carcinoma | Caspofungin | 1,134 | 18 | BAL | Colonization (bacterial pneumonia) | Improvement | |
| B28 | M | 57 | Acute myeloid leukemia | Caspofungin | 822 | 23 | Sputum | PCPg | SMX-TMPh | Improvement |
| B29 | M | 65 | Acute myeloid leukemia | Caspofungin | 308 | 3 | Sputum | PCP | SMX-TMP | Deteriorationj |
| B30 | M | 35 | Biphenotypic acute leukemia | Caspofungin | 56 | 71k | BAL | PCP | SMX-TMP | Improvement |
| B31 | F | 82 | Rheumatoid arthritis, methotrexate | Caspofungin | 197 | 14 | BAL | Colonization (bacterial pneumonia) | Improvement | |
| B32 | F | 50 | Acute myeloid leukemia | Caspofungin | 522 | 1 | BAL | PCP | SMX-TMP | Improvement |
| B33 | F | 34 | Acute myeloid leukemia | Caspofungin | 936 | 16 | BAL | PCP | SMX-TMP | Improvement |
| B34 | M | 60 | Asthma | Caspofungin | 1 | 6k | BAL | Colonization (hypersensitivity pneumonitis) | Improvement | |
| N1 | F | 37 | Lung transplant | Caspofungin | 405 | 15 | BAL | PCP | SMX-TMP | Improvement |
| N2 | F | 21 | Lung transplant | Caspofungin, micafungin | 454 | 18 | BAL | PCP | SMX-TMP | Improvement |
| N3 | M | 25 | Lung transplant | Caspofungin | 956 | 4 | BAL | PCP | SMX-TMP | Improvement |
| N4 | F | 35 | Heart-lung transplant | Caspofungin, micafungin | 724 | 20 | BAL | PCP | SMX-TMP | Improvement |
| N5 | M | 34 | Acute myeloid leukemia | Micafungin | 1,000 | 28 | BAL | PCP | SMX-TMP | Improvement |
| N6 | F | 47 | Myelodysplasia | Caspofungin | 365 | 8 | BAL | PCP | SMX-TMP | Improvement |
| N7 | M | 23 | Lung transplant | Caspofungin | 580 | 18 | BAL | PCP | SMX-TMP | Improvement |
| N8 | F | 53 | Acute lymphoid leukemia | Micafungin | 721 | 29 | BAL | PCP | SMX-TMP | Improvement |
| N9 | F | 58 | Kidney-pancreas transplant | Micafungin | 432 | 9 | BAL | PCP | SMX-TMP | Improvement |
| N10 | M | 64 | Acute myeloid leukemia | Micafungin | 1,114 | 20 | BAL | PCP | Atovaquone | Improvement |
| N11 | F | 47 | Lung transplant | Micafungin | 833 | 14 | BAL | PCP | SMX-TMP | Improvement |
| N12 | M | 58 | Lung transplant | Caspofungin | 706 | 15 | BAL | PCP | SMX-TMP | Improvement |
| N13 | F | 56 | Lung transplant | Caspofungin | 535 | 29 | BAL | PCP | Atovaquone | Improvement |
| N14 | M | 43 | Acute lymphoid leukemia | Micafungin | 497 | 13 | BAL | PCP | —i | Deterioration |
| N15 | F | 47 | Lung transplant | Caspofungin | 450 | 8 | BAL | PCP | Atovaquone | Deterioration |
| N16 | M | 31 | Heart-lung transplant | Caspofungin | 621 | 9 | BAL | PCP | Atovaquone | Improvement |
| N17 | M | 54 | Myeloma, COPDd | Caspofungin | 1,547 | 14 | BAL | PCP | Atovaquone | Improvement |
Patients numbered B25 to B34 were monitored in Brest University Hospital, Brest, France. P. jirovecii detection was performed using microscopy (Calcofluor white and Wright-Giemsa stains) and a PCR assay amplifying the mitochondrial large subunit RNA gene after DNA extraction using NucliSens easyMag (bioMérieux, Marcy l’Etoile, France).
Patients numbered N1 to N17 were monitored in Nantes University Hospital, Nantes, France. P. jirovecii detection was performed using microscopy (Gomori-Grocott stain) and a PCR assay amplifying the mitochondrial large subunit RNA gene after DNA extraction using EZ1 DSP virus kit (Qiagen, Courtaboeuf, France).
M, male, F, female.
Chronic obstructive pulmonary disease.
Bronchoalveolar lavage.
P. jirovecii was not detected by microscopic examination; it was only detected by PCR assay, the patients presented alternative diagnoses of PCP, and they improved despite the absence of specific treatment against P. jirovecii.
Pneumocystis pneumonia.
Sulfamethoxazole-trimethoprim.
—, limitation of therapy.
Concomitant bacteremia was a potential factor of deterioration.
Patients B30 and B34 were treated with echinocandins when Pneumocystis infections were diagnosed. Echinocandin treatment was maintained after PCP diagnosis during 15 days and 5 days in the first and second patient, respectively.
The analysis of the gsc1 gene focusing on the two hot spots permitted the identification of three P. jirovecii gsc1 HS1 alleles, two P. jirovecii gsc1 HS2 alleles, and four haplotypes combining the HS1 and HS2 alleles. The Hunter (H) index (29) of the putative genotyping method, based on examination of the HS1 and HS2 regions, was evaluated at 0.21 and 0.44, respectively. The H index based on the two hot spots taken together was evaluated at 0.67. These values appeared insufficient according to recommendations (30, 31). The discriminatory power of a genotyping method requires an H index of ≥0.95 (30). Nonetheless, analysis of HS1 and HS2 can be added to our multilocus sequence type genotyping approach, consisting of mtLSUrRNA, cytochrome b (CYB), and superoxide dismutase (SOD) examination, which we have used in the past (32, 33).
In conclusion, our results show similar diversity of the P. jirovecii gsc1 gene in patients with or without prior exposure to echinocandins at the time of PCP onset. The SNPs that were identified correspond to synonymous mutations that are not involved in codon changes. Despite the limitation of the present study, the results showed that no specific pressure of echinocandins among P. jirovecii microorganisms can be pointed out so far. However, given the resistance of Candida species fks1 mutants to echinocandins as previously published (16, 18, 19, 23), the monitoring of the potential emergence of P. jirovecii gsc1 mutants remains justified.
MATERIALS AND METHODS
A total of 51 patients who tested positive for P. jirovecii infection were retrospectively enrolled in the study. They were monitored at Brest University Hospital (34 patients) and Nantes University Hospital (17 patients) from 2 July 2008 to 31 August 2020. These two hospitals are located in the same region of France, 300 km apart.
Twenty-seven patients were selected from the databases of the two pharmacy units. This patient group was defined on the basis of (i) the patients’ prior exposure to echinocandins at the time of P. jirovecii infection diagnoses, whatever the duration of this exposure, and the time between the end of echinocandin treatment and P. jirovecii infection diagnoses, and (ii) the availability of patients’ archival P. jirovecii DNA specimens. The median age was 47 years (range, 21 to 82 years); the male-female ratio was 13:14. Underlying diseases were solid-organ transplantation (11 patients), hematological malignancy (13 patients), bronchial carcinoma (one patient), rheumatoid arthritis (one patient), and asthma (one patient) (Table 3).
Another group served as a control group and consisted of 24 patients who had no prior exposure to echinocandins at the time of P. jirovecii infection diagnoses. The median age was 65 years (range, 30 to 89 years); the male-female ratio was 17:7. Underlying diseases were cancer (seven patients), HIV infection (six patients), hematological malignancy (four patients), solid-organ transplantation (five patients), esophageal carcinoma and chronic obstructive pulmonary disease (one patient), and Horton disease (one patient) (Table 4).
TABLE 4.
Characteristics of 24 patients without prior exposure to echinocandins at the time of Pneumocystis jirovecii infection diagnoses
| Patient codea | Sexb | Age (yr) | Underlying condition | Sample | Presentation of P. jirovecii infection (alternative diagnosis of PCP) | Treatment of P. jirovecii Infection | Outcome |
|---|---|---|---|---|---|---|---|
| B1 | M | 65 | HIV infection | BALd | PCPf | SMX-TMPh | Improvement |
| B2 | M | 33 | HIV infection | BAL | PCP | SMX-TMP | Improvement |
| B3 | M | 60 | Esophageal carcinoma, COPDc | BAL | Colonizationg (iatrogenic lung disease) | Improvement | |
| B4 | M | 74 | Kidney transplant | BAL | PCP | SMX-TMP, atovaquone | Deterioration |
| B5 | M | 70 | Myeloma | BAL | PCP | SMX-TMP | Deterioration |
| B6 | M | 81 | Cholangiocarcinoma | BAL | PCP | SMX-TMP | Deterioration |
| B7 | M | 76 | Prostatic carcinoma | BAL | PCP | SMX-TMP | Deterioration |
| B8 | F | 78 | Kidney transplant | BAL | PCP | SMX-TMP | Improvement |
| B9 | F | 55 | HIV infection | BAL | PCP | SMX-TMP | Improvement |
| B10 | M | 42 | HIV infection | BAL | Colonizationg (bacterial pneumonia) | Improvement | |
| B11 | M | 73 | Esophageal carcinoma | BAL | PCP | SMX-TMP | Deterioration |
| B12 | M | 58 | Lymphoma | BAL | PCP | SMX-TMP | Deterioration |
| B13 | M | 54 | HIV infection | Sputum | PCP | Atovaquone | Deterioration |
| B14 | M | 77 | Glioblastoma | Sputum | PCP | SMX-TMP | Deterioration |
| B15 | F | 69 | Glioblastoma | Sputum | PCP | SMX-TMP | Improvement |
| B16 | M | 64 | Kidney transplant | BAL | PCP | SMX-TMP | Deterioration |
| B17 | M | 30 | HIV infection | BAL | PCP | SMX-TMP | Improvement |
| B18 | M | 51 | Lung carcinoma | Sputum | PCP | SMX-TMP | Deterioration |
| B19 | F | 64 | Kidney-Liver transplant | Sputum | PCP | SMX-TMP | Deterioration |
| B20 | F | 74 | Acute myeloid leukemia | BAL | PCP | SMX-TMP, atovaquone | Deterioration |
| B21 | F | 70 | Lymphoma | ETAe | PCP | SMX-TMP | Improvement |
| B22 | F | 89 | Horton disease | BAL | PCP | SMX-TMP | Improvement |
| B23 | M | 63 | Bronchial carcinoma | BAL | PCP | SMX-TMP | Improvement |
| B24 | M | 58 | Lymphoma | Sputum | PCP | Atovaquone, caspofungin, pentamidine | Deterioration |
Patients numbered from B1 to B24 were monitored at Brest University Hospital, Brest, France. P. jirovecii detection was performed using microscopy (Calcofluor white and Wright-Giemsa stains) and a PCR assay amplifying the mitochondrial large subunit RNA gene after DNA extraction using NucliSens easyMag (bioMérieux, Marcy l’Etoile, France).
M, male, F, female.
Chronic obstructive pulmonary disease.
Bronchoalveolar lavage.
Endotracheal aspiration.
Pneumocystis pneumonia.
P. jirovecii was not detected by microscopic examination; the fungus was only detected by PCR assay, the patients presented alternative diagnoses of PCP, and they improved despite the absence of specific treatment against P. jirovecii.
Sulfamethoxazole-trimethoprim.
The diagnoses of P. jirovecii infections had initially been performed in the laboratories of parasitology and mycology at Brest University Hospital or Nantes University Hospital using direct microscopy on bronchoalveolar lavage (BAL) specimens (Calcofluor-white and Wright-Giemsa stainings or Grocott-Gomori staining, respectively) and a real-time PCR assay targeting the P. jirovecii mitochondrial large subunit rRNA gene (mtLSUrRNA) (34, 35) on BAL, endotracheal aspirate (ETA), or induced sputum (IS) specimens. The PCR assays were performed after DNA extraction procedure using NucliSens easyMag (bioMérieux, Marcy l’Etoile, France) in Brest and EZ1 DSP virus kit (Qiagen, Courtaboeuf, France) in Nantes. Seven patients were considered colonized by P. jirovecii, since they presented alternative diagnoses of PCP and/or they did not receive specific treatment against P. jirovecii, whereas 44 patients had overt PCP, diagnosis of which was based on clinical and radiological signs combined with positive results of P. jirovecii detection (Tables 3 and 4). The corresponding 51 P. jirovecii specimens were stored at −20°C for further experiments.
P. jirovecii sequence analysis was performed at Brest University Hospital. Two primer pairs, HS1-2042F (AGGCCTGTTTGGGAATTATTTA)/HS1-2440R (CAAGGCGTCCATATAGAAACTC) and HS2-4207F (TGCTCATCCTGGGTTTCA)/HS2-4623R (AATCCACGACCAGTACCAATA), were designed using PrimerQuest Tools software (Integrated DNA Technology) to amplify and sequence the HS1 and HS2 regions of the gsc1 gene. Primer specificity was checked using Basic Local Alignment Search Tool (https://blast.ncbi.nlm.nih.gov/Blast.cgi). PCRs were carried out in a final volume of 50 μl, containing 200 μM each deoxynucleoside triphosphate (deoxynucleoside triphosphate set; Eurogentec, Seraing, Belgium), 0.5 μM forward and reverse primers, 2 U of DNA polymerase (HGS Diamond Taq DNA polymerase, Eurogentec), and MgCl2 under final concentrations of 3 mM (first primer pair) and 1.5 mM (second primer pair). Amplification was conducted under the following conditions: activation step at 95°C for 10 min followed by 45 cycles including denaturation at 94°C for 30 s, annealing at 60°C for 45 s, extension at 72°C for 1 min, and a final extension step at 72°C for 10 min. The PCR products were electrophoresed on a 1.5% agarose gel containing ethidium bromide to visualize the expected bands for HS1 and HS2 (399 and 417 bp, respectively). To avoid contamination, each step was performed in different areas with different sets of micropipettes. The reagents used in the PCR mixtures were prepared in a laminar-flow cabinet. Negative controls were included to monitor for possible contamination. PCR products were purified using ExoSAP-IT (Affymetrix Inc., US) and sequenced from the two strands using the dideoxy chain termination method (BigDye Terminator version 1.1 cycle sequencing kit; Applied Biosystems, Foster City, CA) on the 3130XL Genetic Analyzer (Applied Biosystems, Courtaboeuf, France).
DNA sequences of the HS1 and HS2 regions were edited using Pregap and Gap software (Staden package version 2.0.0b11-2016; Staden Group) (36). Consensus sequences were aligned using BioEdit software with the Clustal W program. The gsc1 genomic sequences and open reading frames (ORFs) used for the alignment with consensus sequences corresponded to the PNEJI1_001061 locus in the P. jirovecii genome assembly version ASM33397v2 (20) and to the T551_02309 locus in the P. jirovecii genome assembly version Pneu_jiro_RU7_V2 (21).
Statistical analyses were performed using Prism software (version 7.0; GraphPad Software, San Diego, CA, USA). Qualitative variables were compared using Fisher’s exact test. A two-sided P value of <0.05 was considered significant. The study was noninterventional and did not require informed consent and ethical approval according to French laws and regulations (CSP Art L1121e1.1).
Nucleotide sequence accession numbers.
The nucleotide sequences of the gsc1 gene obtained in the present study have been deposited in GenBank under accession numbers MZ670330 to MZ670428.
Contributor Information
Pierre L. Bonnet, Email: pierre.bonnet@chu-brest.fr.
Solène Le Gal, Email: solene.legal@chu-brest.fr.
Gilles Nevez, Email: gilles.nevez@chu-brest.fr.
REFERENCES
- 1.Nevez G, Hauser PM, Le Gal S. 2020. Pneumocystis jirovecii. Trends Microbiol 28:1034–1035. 10.1016/j.tim.2020.03.006. [DOI] [PubMed] [Google Scholar]
- 2.Cazein F, Pillonel J, Le Strat Y, Pinget R, Le Vu S, Brunet S, Thierry D, Brand D, Leclerc M, Benyelles L, Da Costa C, Barin F. 2015. Découvertes de séropositivité VIH et de sida, France, 2003–2013. Bull Epidémiol Hebd 9–10:152–161. http://www.invs.sante.fr/beh/2015/9-10/2015_9-10_1.html. [Google Scholar]
- 3.Bitar D, Lortholary O, Le Strat Y, Nicolau J, Coignard B, Tattevin P, Che D, Dromer F. 2014. Population-based analysis of invasive fungal infections, France, 2001–2010. Emerg Infect Dis 20:1149–1155. 10.3201/eid2007.140087. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Roux A, Canet E, Valade S, Gangneux-Robert F, Hamane S, Lafabrie A, Maubon D, Debourgogne A, Le Gal S, Dalle F, Leterrier M, Toubas D, Pomares C, Bellanger AP, Bonhomme J, Berry A, Durand-Joly I, Magne D, Pons D, Hennequin C, Maury E, Roux P, Azoulay E. 2014. Pneumocystis jirovecii pneumonia in patients with or without AIDS, France. Emerg Infect Dis 20:1490–1497. 10.3201/eid2009.131668. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Matos O, Esteves F. 2010. Epidemiology and clinical relevance of Pneumocystis jirovecii Frenkel, 1976 dihydropteroate synthase gene mutations. Parasite 17:219–232. 10.1051/parasite/2010173219. [DOI] [PubMed] [Google Scholar]
- 6.Meneau I, Sanglard D, Bille J, Hauser PM. 2004. Pneumocystis jiroveci dihydropteroate synthase polymorphisms confer resistance to sulfadoxine and sulfanilamide in Saccharomyces cerevisiae. Antimicrob Agents Chemother 48:2610–2616. 10.1128/AAC.48.7.2610-2616.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Iliades P, Meshnick SR, Macreadie IG. 2004. Dihydropteroate synthase mutations in Pneumocystis jiroveci can affect sulfamethoxazole resistance in a Saccharomyces cerevisiae model. Antimicrob Agents Chemother 48:2617–2623. 10.1128/AAC.48.7.2617-2623.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Iliades P, Meshnick SR, Macreadie IG. 2005. Mutations in the Pneumocystis jirovecii DHPS gene confer cross-resistance to sulfa drugs. Antimicrob Agents Chemother 49:741–748. 10.1128/AAC.49.2.741-748.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Nahimana A, Rabodonirina M, Bille J, Francioli P, Hauser PM. 2004. Mutations of Pneumocystis jirovecii dihydrofolate reductase associated with failure of prophylaxis. Antimicrob Agents Chemother 48:4301–4305. 10.1128/AAC.48.11.4301-4305.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Queener SF, Cody V, Pace J, Torkelson P, Gangjee A. 2013. Trimethoprim resistance of dihydrofolate reductase variants from clinical isolates of Pneumocystis jirovecii. Antimicrob Agents Chemother 57:4990–4998. 10.1128/AAC.01161-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Hill P, Kessl J, Fisher N, Meshnick S, Trumpower BL, Meunier B. 2003. Recapitulation in Saccharomyces cerevisiae of cytochrome b mutations conferring resistance to atovaquone in Pneumocystis jiroveci. Antimicrob Agents Chemother 47:2725–2731. 10.1128/AAC.47.9.2725-2731.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Argy N, Le Gal S, Coppée R, Song Z, Vindrios W, Massias L, Kao WC, Hunte C, Yazdanpanah Y, Lucet JC, Houzé S, Clain J, Nevez G. 2018. Pneumocystis cytochrome b mutants associated with atovaquone prophylaxis failure as the cause of Pneumocystis infection outbreak among heart transplant recipients. Clin Infect Dis 67:913–919. 10.1093/cid/ciy154. [DOI] [PubMed] [Google Scholar]
- 13.Denning D. 2003. Echinocandin antifungal drugs. Lancet 362:1142–1151. 10.1016/S0140-6736(03)14472-8. [DOI] [PubMed] [Google Scholar]
- 14.Pappas PG, Kauffman CA, Andes D, Benjamin DK, Jr, Calandra TF, Edwards JE, Jr, Filler SG, Fisher JF, Kullberg BJ, Ostrosky-Zeichner L, Reboli AC, Rex JH, Walsh TJ, Sobel JD, Infectious Diseases Society of America . 2009. Clinical practice guidelines for the management of candidiasis: 2009 update by the Infectious Diseases Society of America. Clin Infect Dis 48:503–535. 10.1086/596757. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Maertens J, Raad I, Petrikkos G, Boogaerts M, Selleslag D, Petersen FB, Sable CA, Kartsonis NA, Ngai A, Taylor A, Patterson TF, Denning DW, Walsh TJ, Caspofungin Salvage Aspergillosis Study Group . 2004. Efficacy and safety of caspofungin for treatment of invasive aspergillosis in patients refractory to or intolerant of conventional antifungal therapy. Clin Infect Dis 39:1563–1571. 10.1086/423381. [DOI] [PubMed] [Google Scholar]
- 16.Park S, Kelly R, Kahn JN, Robles J, Hsu MJ, Register E, Li W, Vyas V, Fan H, Abruzzo G, Flattery A, Gill C, Chrebet G, Parent SA, Kurtz M, Teppler H, Douglas CM, Perlin DS. 2005. Specific substitutions in the echinocandin target Fks1p account for reduced susceptibility of rare laboratory and clinical Candida sp. isolates. Antimicrob Agents Chemother 49:3264–3273. 10.1128/AAC.49.8.3264-3273.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Luraschi A, Cissé OH, Pagni M, Hauser PM. 2017. Identification and functional ascertainment of the Pneumocystis jirovecii potential drug targets Gsc1 and Kre6 involved in glucan synthesis. J Eukaryot Microbiol 64:481–490. 10.1111/jeu.12385. [DOI] [PubMed] [Google Scholar]
- 18.Desnos-Ollivier M, Bretagne S, Raoux D, Hoinard D, Dromer F, Dannaoui E, European Committee on Antibiotic Susceptibility Testing . 2008. Mutations in the fks1 gene in Candida albicans, C. tropicalis, and C. krusei correlate with elevated caspofungin MICs uncovered in AM3 medium using the method of the European Committee on Antibiotic Susceptibility Testing. Antimicrob Agents Chemother 52:3092–3098. 10.1128/AAC.00088-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Dannaoui E, Desnos-Ollivier M, Garcia-Hermoso D, Grenouillet F, Cassaing S, Baixench MT, Bretagne S, Dromer F, Lortholary O, French Mycoses Study Group . 2012. Candida spp. with acquired echinocandin resistance, France, 2004–2010. Emerg Infect Dis 18:86–90. 10.3201/eid1801.110556. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Cissé OH, Pagni M, Hauser PM. 2012. De novo assembly of the Pneumocystis jirovecii genome from a single bronchoalveolar lavage fluid specimen from a patient. mBio 4:e00428-12. 10.1128/mBio.00428-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Ma L, Chen Z, Huang da W, Kutty G, Ishihara M, Wang H, Abouelleil A, Bishop L, Davey E, Deng R, Deng X, Fan L, Fantoni G, Fitzgerald M, Gogineni E, Goldberg JM, Handley G, Hu X, Huber C, Jiao X, Jones K, Levin JZ, Liu Y, Macdonald P, Melnikov A, Raley C, Sassi M, Sherman BT, Song X, Sykes S, Tran B, Walsh L, Xia Y, Yang J, Young S, Zeng Q, Zheng X, Stephens R, Nusbaum C, Birren BW, Azadi P, Lempicki RA, Cuomo CA, Kovacs JA. 2016. Genome analysis of three Pneumocystis species reveals adaptation mechanisms to life exclusively in mammalian hosts. Nat Commun 7:10740. 10.1038/ncomms10740. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Luraschi A, Richard S, Hauser PM. 2018. Site-directed mutagenesis of the 1,3-β-glucan synthase catalytic subunit of Pneumocystis jirovecii and susceptibility assays suggest its sensitivity to caspofungin. Antimicrob Agents Chemother 62:e01159-18. 10.1128/AAC.01159-18. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Prigent G, Aït-Ammar N, Levesque E, Fekkar A, Costa JM, El Anbassi S, Foulet F, Duvoux C, Merle JC, Dannaoui E, Botterel F. 2017. Echinocandin resistance in Candida species isolates from liver transplant recipients. Antimicrob Agents Chemother 61:e01229-16. 10.1128/AAC.01229-16. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Maschmeyer G, Helweg-Larsen J, Pagano L, Robin C, Cordonnier C, Schellongowski P, 6th European Conference on Infections in Leukemia (ECIL-6), a joint venture of The European Group for Blood and Marrow Transplantation (EBMT), The European Organization for Research and Treatment of Cancer (EORTC), the International Immunocompromised Host Society (ICHS) and The European LeukemiaNet (ELN) . 2016. ECIL guidelines for treatment of Pneumocystis jirovecii pneumonia in non-HIV-infected haematology patients. J Antimicrob Chemother 71:2405–2413. 10.1093/jac/dkw158. [DOI] [PubMed] [Google Scholar]
- 25.Rabodonirina M, Vanhems P, Couray-Targe S, Gillibert RP, Ganne C, Nizard N, Colin C, Fabry J, Touraine JL, van Melle G, Nahimana A, Francioli P, Hauser PM. 2004. Molecular evidence of interhuman transmission of Pneumocystis pneumonia among renal transplant recipients hospitalized with HIV-infected patients. Emerg Infect Dis 10:1766–1773. 10.3201/eid1010.040453. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Helweg-Larsen J. 2004. Applied molecular microbiology, epidemiology and diagnosis. Dan Med Bull 51:251–273. [PubMed] [Google Scholar]
- 27.Le Gal S, Damiani C, Rouillé A, Grall A, Tréguer L, Virmaux M, Moalic E, Quinio D, Moal MC, Berthou C, Saliou P, Le Meur Y, Totet A, Nevez G. 2012. A cluster of Pneumocystis infections among renal transplant recipients: molecular evidence of colonized patients as potential infectious sources of Pneumocystis jirovecii. Clin Infect Dis 54:e62–e71. 10.1093/cid/cir996. [DOI] [PubMed] [Google Scholar]
- 28.Le Gal S, Bonnet P, Huguenin A, Chapelle C, Boulic P, Tonnelier JM, Moal MC, Gut-Gobert C, Barnier A, Nevez G. 2021. The shift from pulmonary colonization to Pneumocystis pneumonia. Med Mycol 59:510–513. 10.1093/mmy/myaa107. [DOI] [PubMed] [Google Scholar]
- 29.Hunter PR, Gaston MA. 1988. Numerical index of the discriminatory ability of typing systems: an application of Simpson's index of diversity. J Clin Microbiol 26:2465–2466. 10.1128/jcm.26.11.2465-2466.1988. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Struelens MJ. 1996. Consensus guidelines for appropriate use and evaluation of microbial epidemiologic typing systems. Clin Microbiol Infect 2:2–11. 10.1111/j.1469-0691.1996.tb00193.x. [DOI] [PubMed] [Google Scholar]
- 31.Hauser PM, Blanc DS, Sudre P, Senggen Manoloff E, Nahimana A, Bille J, Weber R, Francioli P. 2001. Genetic diversity of Pneumocystis carinii in HIV-positive and -negative patients as revealed by PCR-SSCP typing. AIDS 15:461–466. 10.1097/00002030-200103090-00004. [DOI] [PubMed] [Google Scholar]
- 32.Vindrios W, Argy N, Le Gal S, Lescure FX, Massias L, Le MP, Wolff M, Yazdanpanah Y, Nevez G, Houze S, Dorent R, Lucet JC. 2017. Outbreak of Pneumocystis jirovecii infection among heart transplant recipients: molecular investigation and management of an interhuman transmission. Clin Infect Dis 65:1120–1126. 10.1093/cid/cix495. [DOI] [PubMed] [Google Scholar]
- 33.Nevez G, Morio F, Bonnet P, Le Nan N, Blanc FX, Le Gal S. 2021. A proposal for pragmatic investigation of possible clonal clusters of Pneumocystis pneumonia cases. J Hosp Infect 108:215–216. 10.1016/j.jhin.2020.11.022. [DOI] [PubMed] [Google Scholar]
- 34.Meliani L, Develoux M, Marteau-Miltgen M, Magne D, Barbu V, Poirot JL, Roux P. 2003. Real time quantitative PCR assay for Pneumocystis jirovecii detection. J Eukaryot Microbiol 50:651. 10.1111/j.1550-7408.2003.tb00670.x. [DOI] [PubMed] [Google Scholar]
- 35.Totet A, Meliani L, Lacube P, Pautard JC, Raccurt C, Roux P, Nevez G. 2003. Immunocompetent infants as a human reservoir for Pneumocystis jirovecii: rapid screening by non-invasive sampling and real-time PCR at the mitochondrial large subunit rRNA gene. J Eukaryot Microbiol 50:668–669. 10.1111/j.1550-7408.2003.tb00678.x. [DOI] [PubMed] [Google Scholar]
- 36.Bonfield JK, Staden R. 1996. Experiment files and their application during large-scale sequencing projects. DNA Seq 6:109–117. 10.3109/10425179609010197. [DOI] [PubMed] [Google Scholar]