Skip to main content
PLOS One logoLink to PLOS One
. 2022 Jan 18;17(1):e0258283. doi: 10.1371/journal.pone.0258283

Complete sequences of epidermin and nukacin encoding plasmids from oral-derived Staphylococcus epidermidis and their antibacterial activity

Kenta Nakazono 1,#, Mi Nguyen-Tra Le 2,3,#, Miki Kawada-Matsuo 2,3,*, Noy Kimheang 2, Junzo Hisatsune 3,4, Yuichi Oogai 5, Masanobu Nakata 5, Norifumi Nakamura 1, Motoyuki Sugai 3,4, Hitoshi Komatsuzawa 2,3
Editor: Jean-San Chia6
PMCID: PMC8765612  PMID: 35041663

Abstract

Staphylococcus epidermidis is a commensal bacterium in humans. To persist in the bacterial flora of the host, some bacteria produce antibacterial factors such as the antimicrobial peptides known as bacteriocins. In this study, we tried to isolate bacteriocin-producing S. epidermidis strains. Among 150 S. epidermidis isolates from the oral cavities of 287 volunteers, we detected two bacteriocin-producing strains, KSE56 and KSE650. Complete genome sequences of the two strains confirmed that they carried the epidermin-harboring plasmid pEpi56 and the nukacin IVK45-like-harboring plasmid pNuk650. The amino acid sequence of epidermin from KSE56 was identical to the previously reported sequence, but the epidermin synthesis-related genes were partially different. The prepeptide amino acid sequences of nukacin KSE650 and nukacin IVK45 showed one mismatch, but both mature peptides were entirely similar. pNuk650 was larger and had an additional seven ORFs compared to pIVK45. We then investigated the antibacterial activity of the two strains against several skin and oral bacteria and found their different activity patterns. In conclusion, we report the complete sequences of 2 plasmids coding for bacteriocins from S. epidermidis, which were partially different from those previously reported. Furthermore, this is the first report to show the complete sequence of an epidermin-carrying plasmid, pEpi56.

Introduction

Staphylococci are classified into two groups, Staphylococcus aureus and coagulase -negative staphylococci (CoNS) due to their clinical importance. CoNS are abundant colonizers on the skin and are considered to contribute to the maintenance of skin integrity and homeostasis [1–3]. CoNS assist in immune activity to prevent pathogen colonization by inducing antimicrobial peptides from the epithelium, by direct production of antibacterial factors such as phenol-soluble modulins (PSMs) and bacteriocins [4–6]. Therefore, the colonization of CoNS provides several benefits to the host. However, CoNS are commonly isolated in clinical cultures and considered to be major nosocomial pathogens in humans [7, 8]. CoNS are often isolated from blood and indwelling medical implants such as intravascular catheters and urinary catheters, leading to opportunistic infectious diseases. In addition, most clinical isolates of Staphylococcus epidermidis carry the genes encoding for antibiotic resistance and biofilm formation, which significantly challenge current antibiotic therapy [9, 10].

In the oral cavity, oral bacterial flora is composed of a great diversity of bacterial species. Many oral indigenous bacteria, including oral streptococci, are known to produce antimicrobial factors such as bacteriocins and hydrogen peroxide [11–15]. Bacteriocins exhibit a wide range of antimicrobial activity against the bacterial species that make up the oral flora [16]. Therefore, bacteriocins are thought to be involved in the exclusion and symbiosis of other bacteria in the oral cavity. S. epidermidis is also found in oral cavity [17, 18]. Some S. epidermidis are known to produce antimicrobial peptides known as bacteriocins, including epidermin [19–21], Pep5 [21–23], epilancin K7 [21, 24], epilancin 15X [25, 26], epicidin 280 [27] and Nukacin IVK-45 [28]. These bacteriocins are known to be lantibiotics containing specific amino acids such as lanthionine, β-methyllanthionine, and dehydrated amino acids [11–13]. However, there are no reports about the bacteriocin produced by S. epidermidis isolated from the oral cavity.

So far, there have been many reports on bacteriocins produced by oral isolates of streptococcal species [11–13, 16] but very few reports on other oral bacterial species. To understand the meaning of bacteriocins for bacterial flora formation, more information about bacteriocins produced by many oral bacterial species is required. In this study, we focused on the bacteriocins of oral-derived S. epidermidis to understand the antibacterial activity against oral and skin bacteria. We examined 150 S. epidermidis strains isolated from the oral cavity and investigated their bacteriocin-producing activity. As a result, we found two strains that produced epidermin and nukacin IVK45. We performed the complete-genome analysis of these two strains and identified the plasmids harboring the epidermin or nukacin IVK45-like bacteriocin gene clusters. The nucleotide sequences of these plasmids were not entirely similar to the previously reported sequences. Additionally, we evaluated the antibacterial activity of these two bacteriocins against the skin and oral commensal bacteria.

Materials and methods

Bacterial strains and growth conditions

S. epidermidis clinical isolates were grown in trypticase soy broth (TSB) (Becton, Dickinson and Company [BD], Franklin Lakes, NJ, USA) at 37°C. The Staphylococcus aureus MW2 strain and braRS-inactivated mutant were obtained previously [29]. Other bacteria used in this study are listed in Table 1. Staphylococcal strains and Micrococcus luteus were grown in TSB at 37°C and 30°C, respectively. Streptococcal strains were grown in TSB at 37°C with 5% CO2. Cutibacterium acnes was grown on sheep blood agar at 37°C anaerobically. Corynebacterium and Rothia mucilanginosa were grown at 37°C in R medium and BHI (BD) aerobically, respectively. The composition of R medium is as follows: 1g of bacto peptone (BD), 0.5g of yeast extract (BD), 0.5g of malt extract (BD), 0.5g of casamino acids (BD), 0.2g of beef extract (BD), 0.2g of glycerol, 5mg of Tween 80, 0.1g of MgSO4 in 100 ml distilled water. When necessary, tetracycline (5 μg/ml) was added to the medium.

Table 1. Strains used in this study.

Strains Character origin
Staphylococcus epidermidis
KSE1 Wild type This study
KSE3 Wild type This study
KSE56 Wild type This study
KSE650 Wild type This study
KSE56- KSE56 plasmid deleted This study
KSE650- KSE650 plasmid deleted This study
Staphylococcus warneri ISK-1 Wild type
Staphylococcus hominis JCM31912 Wild type Riken BRC 1
Staphylococcus haemolyticus JCM2416 Wild type Riken BRC 1
Staphylococcus capitis subsp. capitis JCM2420 Wild type Riken BRC 1
Staphylococcus simulans JCM2424 Wild type Riken BRC 1
Cutibacterium acnes JCM6425 Wild type Riken BRC 1
Corynebacterium accolens JCM8331 Wild type Riken BRC 1
Corynebacterium pseudodiphtheriticum JCM1320 Wild type Riken BRC 1
Rothia mucilaginosa JCM10910 Wild type Riken BRC 1
Micrococcus luteus JCM1464 Wild type Riken BRC 1
Streptococcus mutans UA159 Wild type [30]
Streptococcus sanguinis GTC217 Wild type Gifu University
Streptococcus salivarius GTC215 Wild type Gifu University
Streptococcus gordonii JCM12995 Wild type Riken BRC 1
Staphylococcus aureus
COL Wild type [31]
RN4220 NCTS8325 derivative [32]
MW2 clinical strain, methicillin-resistant (mecA+) [33]
ΔTCS16 braRS inactivation in MW2, Tcr2 [29]

1. Japan Collection of Microorganisms.

2. Tetracycline resistance.

Isolation of Staphylococcus epidermidis from the oral cavity

S. epidermidis strains were isolated from the oral cavities of 287 volunteers. Saliva collected from the oral cavity was plated on No.110 medium (Eiken Chemical Co. Ltd, Tokyo, Japan) and incubated for 2 days at 37°C. The strains were picked from a single white colony on the agar and further investigated by PCR with specific primers for S. epidermidis (forward primer: GGCAAATTTGTGGGTCAAGA, reverse primer: TGGCTAATGGTTTGTCACCA). Isolated S. epidermidis strains were replated on TSB containing 2% agar (TSA) medium. The isolated strains were then replated again on TSA to pick up a single colony and finally, S. epidermidis confirmed by PCR was used in this study. Clinical isolates were designated as KSE strains. Saliva collection and S. epidermidis isolation were approved by the Ethical Committee of the Kagoshima University Graduate School of Medical and Dental Sciences (No. 701) and the Ethical Committee for Epidemiology of Hiroshima University (E-1998). Written informed consent was obtained from all participants. All methods were performed in accordance with the approved guidelines and regulations.

Screening of bacteriocin-producing S. epidermidis

To investigate bacteriocin production among S. epidermidis strains, we performed a direct assay using S. aureus MW2 braRS knockout mutant as an indicator strain because this mutant showed increased susceptibility to several bacteriocins [34]. Overnight cultures of S. epidermidis strains were spotted on a TSA plate and cultured at 37°C for 24 h. Then, 3.5 ml of prewarmed half-strength TSB soft agar (1%) containing braRS knockout mutant cells (107 cells/ml) were poured over the TSA plate. The plates were incubated at 37°C for 24 h. The strains which showed the growth inhibition zones surrounding S. epidermidis strain were picked up. The strains were reconfirmed for bacteriocin production by the direct assay again.

Complete genome sequences of bacteriocin-producing S. epidermidis strains

To perform whole-genome sequencing of S. epidermidis strains, DNA was extracted from each strain. S. epidermidis cells grown overnight in 5 ml TSB were collected and then suspended in 0.5 ml of CS buffer (100 mM Tris-HCl [pH 7.5], 150 mM NaCl, 10 mM EDTA) containing lysostaphin (Sigma-Aldrich, St. Louis, MO, USA) (final concentration: 50 μg/ml) and RNase (Nippon Gene, Tokyo, Japan) (final: 20 μg/ml). After incubation at 37°C for 1 h, proteinase K (Nacalai Tesque, Kyoto, Japan) (final: 150 μg/ml) and SDS (final 1%) were added, followed by incubation at 55°C for 5 h. After treatment with phenol followed by phenol-chloroform, DNA was precipitated by ethanol. Whole-genome sequencing (WGS) of S. epidermidis strains was performed using the Illumina MiSeq sequencing platform, followed by annotation with Rapid Annotation using Subsystem Technology (RAST) version 2.0 [35]. After confirming the presence of bacteriocin genes using WGS, long-read sequencing by MinION (Oxford Nanopore Technologies, UK) was carried out to determine the complete sequences of the chromosomes and plasmids of these strains. Hybrid assembly of Illumina short reads and MinION long reads was performed with Unicycler v0.4.8. The complete sequences of plasmids harboring bacteriocin genes were selected, including epidermin-carrying plasmid pEpi56 and nukacin-carrying plasmid pNuk650. Each plasmid was compared with publicly available plasmids or gene clusters, including the epiY’-epiP gene cluster (X62386), epiG-epiT’’ gene cluster (U77778), and pIVK45 (accession number KP702950).

Accession numbers

The complete plasmids carrying epidermin (pEpi56) and nukacin (pNuk650) have been deposited in the NCBI database under accession numbers OK031036 and OK031035, respectively.

Identification of epidermin and nukacin KSE650 produced by S. epidermidis

To identify the bacteriocin, we purified the bacteriocin from two S. epidermidis strains. Overnight cultures (500 ml) of S. epidermidis KSE56 and KSE650 were centrifuged at 4,000 x g for 15 min. Macro-Prep cationic resin (1.5 ml) (Bio rad, USA) was added to the supernatant and stirred for 12 h. The resin was collected into an open column, then washed three times with 10 ml of 25 mM ammonium acetate (pH 7.5). To elute the bacteriocin, the resin was treated with 500 μl of 5% acetic acid. This elution was repeated 10 times. After each fraction was evaporated completely, the samples were dissolved in 50 μl of distilled water. Each solution was tested for antibacterial activity against M. luteus. Overnight cultures of M. luteus (100 μl) were inoculated on TSA plates. Then, 5 μl of each solution was spotted on TSA. After overnight incubation at 37°C, growth inhibition was observed. Samples with antibacterial activity were subjected to HPLC chromatography using an Octadecyl C18 column. After equilibrating the column with 0.1% TFA water, the sample was injected. Thereafter, a linear gradient of 0 to 60% acetonitrile for 30 min was applied to the column. Each peak was fractionated, and the samples were evaporated, then dissolved with 50 μl of distilled water. Subsequently, the antibacterial activity of each fraction was tested with the method above. ESI-MS analysis was performed by LTQ Orbitrap XL (Thermo Fisher Scientific, USA).

Isolation of the strain curing bacteriocin-encoded plasmid

Plasmid deletion in KSE56 and KSE650 was performed with the method described elsewhere [36]. Overnight cultures of KSE56 or KSE650 were inoculated into 5 ml of fresh TSB and incubated at 37°C with shaking. When the OD660 reached 0.5, acriflavine was added at a concentration of 25 μg/ml. After incubation for 12 h, the culture was diluted and plated on TSA. After 24 h of incubation at 37°C, colonies were picked, replated on TSA and then incubated at 37°C for 24 h. Next, 0.75% soft agar (3.5 ml) containing Bacillus coagulans (200 μl of overnight culture) was poured on that plate and incubated at 37°C for 24 h. The strains with no inhibitory zone were picked. Finally, PCR was performed using specific primers for S. epidermidis-specific genes and bacteriocin genes coding for nukacin KSE650 or epidermin.

Susceptibility tests

Two methods were used for the evaluation of bacteriocins. A direct assay was performed with a previously described method [34]. An overnight culture of the bacteriocin-producing strain was spotted on a TSA plate and cultured at 37°C for 24 h. Then, 3.5 ml of prewarmed half-strength TSB soft agar (1%) containing indicator bacterial cells (107 cells/ml) was poured over the TSA plate. The plates were incubated at 37°C for 16 h. The diameters of the growth inhibition zones surrounding the bacteriocin-producing strains were measured in three directions. Three independent experiments were performed, and the average diameter was calculated.

Another method was to evaluate the minimal antibacterial dose of purified bacteriocins. Purified epidermin and nukacin KSE650 were adjusted to 0.5 mg/ml. The bacteriocin solution underwent 2-fold serial dilutions (2-fold to 128-fold dilution). Then, 3.5 ml of prewarmed half-strength TSB soft agar (1%) containing bacterial cells (107 cells/ml) was poured over the TSA plate. Thereafter, 2 μl of the bacteriocin solutions with serial dilution (1 μg to 0.03 μg) were spotted on the plate. After the incubation at 37°C for 16 h, the minimum antibacterial dose for the growth inhibition zones was determined.

Co-culture of S. epidermidis with M. luteus

For analysis of the proportion of each bacterium (S. epidermidis and M. luteus) in co-culture by qPCR, we first set up the method for the calculation of bacterial cell number by qPCR. A single overnight culture of the bacterium was first adjusted to OD660 = 1.0, and then a 10-fold serial dilution was performed in 500 μl of lysis buffer. After heating at 95°C for 15 min, samples were centrifuged at 15,000 x rpm for 10 min. Using the supernatant, qPCR was performed with the respective specific primers. For S. epidermidis, the forward and reverse primers used were GGCAAATTTGTGGGTCAAGA and TGGCTAATGGTTTGTCACCA, respectively. For M. luteus, the forward and reverse primers were GGGTTGCGATACTGTGAGGT and TTCGGGTGTTACCGACTTTC, respectively. Finally, the linear relationship between bacterial cell number and cut off value (Ct value) was constructed in each bacterium. Overnight cultures of S. epidermidis KSE1 (no bacteriocin production), KSE56, KSE650 and M. luteus were adjusted to OD660 = 1.0, and the bacterial culture was diluted to 10-fold. Next, 100 μl of S. epidermidis culture and M. luteus were mixed thoroughly. A small portion (20 μl) of mixed culture was spotted on TSA. After overnight incubation at 37°C, the bacterial colonies growing on agar plates were scraped and suspended in 500 μl of lysis buffer. After heating at 95°C for 15 min, the bacterial suspension was centrifuged at 15,000 x rpm for 10 min and the culture supernatant was stocked as the template for quantitative PCR (qPCR). qPCR was performed using appropriate specific primers to determine the cell number of each bacterium in the co-culture samples. Finally, the proportion of 2 bacterial species was determined. Three independent experiments were performed. Post hoc multiple comparisons were made using Tukey’s test.

Results

Isolation of S. epidermidis that produced bacteriocin

From 287 volunteers, 150 S. epidermidis strains (52.3%) were isolated from the oral cavity. Among 150 S. epidermidis strains, 2 strains showing a clear inhibitory zone against the S. aureus MW2 braRS inactivated mutant were identified by the direct method (Fig 1).

Fig 1. Direct assay of bacteriocin-producing S. epidermidis against braRS-inactivated S. aureus.

Fig 1

The antibacterial activity of bacteriocin-producing S. epidermidis was evaluated by the direct assay using S. aureus MW2 braRS-inactivated mutant.

Nucleotide sequence of epidermin-encoding plasmid

The size of the entire plasmid, pEpi56, is 64,386 bp, with 81 ORFs (Fig 2A and Table 2). The plasmid contains epidermin synthesis genes (epiA coding for epidermin KSE56, modification genes epiBCD, processing genes epiP, export genes epiHT, immunity genes epiGEF, and regulatory gene epiQ), replication-related genes, and other genes including the genes coding for hypothetical proteins (Table 2). Compared with epidermin-related genes in the Tü3298 strain [19] epiT, which codes for an exporter, was intactin pEpi56, while a gene disrupted into two fragments (epiT’ and epiT” or epiY and epiY’) was found in the Tü3298 strain (Figs 2B and S1). The nucleotide sequence of epiA in KSE56 showed 2 mismatches with that of the Tü3298 strain (S2 Fig). However, the amino acid sequence of epidermin KSE56 showed 100% identity with that in the Tü3298 strain.

Fig 2. Gene map of the epidermin-carrying plasmid in KSE56.

Fig 2

(a) Epidermin-encoding plasmid from KSE56 (pEpi56). ORFs are shown as arrows, indicating the orientation of transcription. The arrow numbers indicate the ORF number displayed in Table 2. Colors indicate the classification of gene function. (b) Bacteriocin-coding region (KSE56 epidermin). The bacteriocin-coding region from pEpi56 was compared with pTu32 epiP-Y’ (accession number X62386) and pTu32 epiT"-G (accession number U77778). Striped blue arrows indicate truncated epiT.

Table 2. Genes in pEpi56.

No. Location (bp) Size (aa)a Translation signalb Homologue as determined by BLAST and/or FASTA
Source Description(s) Identity (%) Overlap (aa)c Accession no. Note
1 190–1191 333 GAGGTTTTTTATTATG S. epidermidis replication initiator protein A 99 333/338 WP_002498716.1
2 1423–1983 186 AAGGAGTAATAAAAATG S. epidermidis TIGR00730 family Rossman fold protein 99 186/186 WP_158171994.1
3 2300–2515 71 - S. epidermidis hypothetical protein 67 48/78 MBM0824966.1
4 2889–3014 41 GGAGAATAATTAATAAACCCGTTACAAAATAAGCAATATCTATAAGTTTTTTAAAAATTAAAAATTCTAAAATATGTAAGTATG S. epidermidis SK135 ATP-binding cassette domain-containing protein 100 41/41 EFA87131.1
5 3507–3695 62 GAGTTAGACCAATAAATTGAAACGAAAAAACAATTGTTG S. epidermidis hypothetical protein 100 62/62 MBC8789835.1
6 4346–4513 55 GGAGGCATTTGTCATG S. epidermidis hypothetical protein 100 55/55 WP_002498713.1
7 4819–5685 288 GGAGTGATATATATG S. epidermidis RepB family plasmid replication initiator protein 99 287/288 WP_203085279.1
8 5791–5934 47 GGAGACATAAAAAGTTATG S. epidermidis hypothetical protein 100 47/47 WP_002498711.1
9 6397–7026 209 GAGTAATCATG S. epidermidis ABC transporter, ATP-binding protein 100 209/209 EJD97739.1
10 7029–9071 680 AGGTATTTATACATATG S. epidermidis NIHLM040 bacteriocin-associated integral membrane protein 100 680/680 EJD97738.1
11 9165–9557 130 GGAGGATTAAGTTGATG S. epidermidis NIHLM040 bacteriocin, lactococcin 972 family 100 130/130 EJD97736.1
12 9743–10105 120 GAGAATTATACAAAAATG S. epidermidis DUF3139 domain-containing protein 100 120/120 WP_002498706.1
13 10304–10669 121 GAGGGACATACATTAGATATTTGGTTG S. epidermidis NIHLM040 IS431mec, transposase 100 121/121 EJD97734.1
14 10732–10884 50 GGAGTCTTCTGTATG S. epidermidis NIHLM040 hypothetical protein 100 50/50 EJD97733.1
15 11171–12556 461 GAGGTGCTATATG S. epidermidis NIHLM040 putative epidermin leader peptide-processing serine protease EpiP 100 461/461 EJD97732.1 epiP
16 12567–13184 205 GGAATAAAATG S. epidermidis winged helix family transcriptional regulator 100 205/205 MBM0752529.1 epiQ
17 13181–13726 181 GGAGGAATAAGATATG S. epidermidis NIHLM040 epidermin decarboxylase 100 181/181 EJD97730.1 epiD
18 13742–14992 416 GGATGGTTGTG S. epidermidis NIHLM040 putative epidermin biosynthesis protein EpiC 100 416/416 EJD97729.1 epiC
19 14985–17945 986 GAGGTGAAATAGAATTG S. epidermidis NIHLM040 thiopeptide-type bacteriocin biosynthesis domain protein 100 986/986 EJD97728.1 epiB
20 18011–18169 52 AGGAGTGTTTAAAATG S. epidermidis NIHLM040 lantibiotic epidermin 100 52/52 EJD97726.1 epiA
21 18419–19969 516 GGACTAATATTGAGTTTG S. epidermidis ABC transporter ATP-binding protein/permease 100 516/516 WP_002498696.1 epiT’
22 19985–20977 330 GAGATAAGGGAGATATATG S. epidermidis YdcF family protein 100 330/330 WP_032605946.1 epiH
23 21136–21831 231 GGAGGAATAATTCTTG S. epidermidis lantibiotic protection ABC transporter ATP-binding protein 100 231/231 WP_002498693.1 epiF
24 21833–22597 254 GGAAATAATATG S. epidermidis lantibiotic immunity ABC transporter MutE/EpiE family permease subunit 100 254/254 WP_002498692.1 epiE
25 22587–23279 230 GGAATATAAATG S. epidermidis epidermin immunity protein F 100 230/230 WP_002498691.1 epiG
26 23432–24034 200 GAGGTGGAAATCAATG S. epidermidis NIHLM040 putative transposon DNA-invertase Bin3 100 200/200 EJD97719.1
27 24455–26071 538 GGAGGAAGAAAAATG S. epidermidis NIHLM040 ABC transporter, ATP-binding protein 100 538/538 EJD97718.1
28 26621–27463 280 GGAGCATTAATTATG S. epidermidis hypothetical protein 100 280/280 WP_002498688.1
29 27952–28383 143 AAGGAGTCTTCTGTATG S. epidermidis NIHLM040 IS431mec, transposase family protein 100 143/143 EJD97715.1
30 28376–28627 83 AGGCACCTTCAACGAAGGTAGCAATG S. epidermidis NIHLM040 IS431mec, transposase family protein 100 83/83 EJD97714.1
31 28733–29455 240 GGAGTGTAAGCTTTG S. epidermidis peptide ABC transporter permease 100 240/240 WP_002498749.1
32 29472–30107 211 GGAGCTGTAAACATTG S. epidermidis NIHLM040 ABC transporter, ATP-binding protein 100 211/211 EJD97793.1
33 30389–30484 31 GGAGAGATTAAATG S. epidermidis NIHLM040 hypothetical protein 100 31/31 EJD97792.1
34 30495–30665 56 AGGTTAATTTTATG S. epidermidis hypothetical protein 100 56/56 TID00490.1
35 30897–31535 212 AGGTTCAAGATGAAAACAAAGAAATG S. epidermidis NIHLM040 hypothetical protein 100 212/212 EJD97791.1
36 31698–32063 121 GAGGAGAGAACTTTTAAAATG S. epidermidis NIHLM040 hypothetical protein 100 121/121 EJD97790.1
37 32230–32406 58 GGAGTGATTTAATG S. epidermidis NIHLM040 hypothetical protein 100 58/58 EJD97789.1
38 32573–34183 536 GGAAGGATTATTATG S. epidermidis DNA mismatch repair protein MutS 100 536/536 WP_002498743.1
39 34762–35058 98 GGATTGAATG S. epidermidis replication initiation protein 100 98/98 MBF2337202.1
40 35232–35510 92 GGAGAGATTAAATG S. epidermidis hypothetical protein 100 92/92 WP_002498740.1
41 35521–35691 56 GGATTTTATG S. epidermidis hypothetical protein 100 56/56 WP_099800689.1
42 36232–36369 45 GGAG ACATAAGAAGGTATG S. epidermidis hypothetical protein 100 45/45 MBM6015004.1
43 36517–36732 71 GGAAATGACACATCTTAAATCGACATATTCCAAAAATATGTTTAGAATACTGGTTACATG S. epidermidis hypothetical protein 100 71/71 WP_002498738.1
44 37358–37726 122 GAGACGTCTATG S. epidermidis NIHLM040 hypothetical protein 100 122/122 EJD97781.1
45 37880–38335 151 - S. epidermidis putative plasmid recombination enzyme 100 151/151 TID00443.1
46 38651–38905 84 GGAGTTCCTTTAAATG S. epidermidis hypothetical protein 100 84/84 EJD97779.1
47 38927–39067 46 GGAAGATGAAATAGTCCTAATG S. epidermidis hypothetical protein 100 46/46 WP_151520775.1
48 39102–40481 459 GGAGGTATGATAGATG S. epidermidis NIHLM040 drug resistance MFS transporter, drug:H+ antiporter-2 family 100 459/459 EJD97777.1
49 40630–41637 335 GGAGCGATGGAAATG S. epidermidis tryptophan—tRNA ligase 100 335/335 WP_002498732.1
50 41862–42590 242 AAGGAGAATAAACAATG S. epidermidis NIHLM040 ABC transporter permease 100 242/242 EJD97775.1
51 42594–43457 287 AAGGAGAATAAAATG S. epidermidis NIHLM040 ABC transporter, ATP-binding protein 100 287/287 EJD97774.1
52 43704–44525 273 GGAGGATTTTATG S. epidermidis NIHLM040 transcriptional regulator, LysR family 100 273/273 EJD97773.1
53 44678–45817 379 GAGGATGGGATAATAATG S. epidermidis NIHLM040 MFS transporter 100 379/379 EJD97772.1
54 46236–46613 125 GGAAAAGAGTAAATG S. epidermidis NIHLM040 hypothetical protein 96 125/125 EJE04311.1
55 46649–47338 229 GGAGACGATAATGTG S. epidermidis NIHLM040 ABC transporter, ATP-binding protein 100 229/229 EJD97770.1
56 47346–48107 253 GGAGGAATGAAGCAATTATG S. epidermidis ABC transporter permease 99 253/253 WP_002503830.1
57 48465–48857 130 - S. epidermidis NIHLM040 hypothetical protein 100 130/130 EJD97768.1
58 48948–49919 323 GGAGAAATTATG S. epidermidis DUF418 domain-containing protein 99 323/323 WP_095694513.1
59 49974–50108 44 GGAAGGATTG S. epidermidis hypothetical protein 100 44/44 EFA87101.1
60 50567–50722 51 - S. epidermidis hypothetical protein 100 51/51 MBC2926404.1
61 51633–52454 273 AGGTGTGATTTAAATG S. epidermidis relaxase MobL 99 273/273 WP_161382396.1
62 52466–52849 127 GGAGGAATAAAATG S. epidermidis NIHLM040 hypothetical protein 100 127/127 EJD97765.1
63 52851–53129 92 GGAATGATTTTTTTG S. epidermidis NIHLM040 hypothetical protein 100 92/92 EJD97764.1
64 54078–54224 48 S. epidermidis hypothetical protein 100 48/48 WP_002456268.1
65 54621–54800 59 GGAGGCTTATACATG S. epidermidis NIHLM040 CsbD family protein 100 59/59 EJD97762.1
66 54833–55231 132 GAGGTGTTTGTATATG S. epidermidis YolD-like family protein 100 132/132 WP_002498728.1
67 55394–55651 85 - S. epidermidis NIHLM040 prevent-host-death family protein 100 85/85 EJD97760.1
68 55651–55917 88 - S. epidermidis NIHLM040 addiction module toxin, Txe/YoeB family 100 88/88 EJD97759.1
69 55934–56104 56 GGAGGACTCGTTAATG S. epidermidis hypothetical protein 100 56/56 KAB2267008.1
70 56465–56689 74 S. epidermidis putative glycoside hydrolase 100 74/74 QRX38739.1
71 57190–57546 118 GGAGGTTGTATGTATG S. epidermidis NIHLM040 hypothetical protein 100 118/118 EJD97756.1
72 57860–58408 182 - S. epidermidis NIHLM040 putative resolvase 100 182/182 EJD97755.1
73 59658–60926 422 GGAGAATTTAATAATG S. epidermidis penicillin-binding protein PBP4 99 422/422 WP_002498725.1
74 61202–61603 133 - S. epidermidis transposase DNA-binding domain protein 100 133/133 TID00494.1
75 61744–61926 60 GAGTCGTTTAGATG S. epidermidis transposase 98 60/60 WP_203079065.1
76 61958–62188 76 GAGGTGTATTGACATG S. epidermidis NIHLM040 hypothetical protein 99 76/76 EJD97751.1
77 62255–62407 50 GGAGGAATTAAATTG S. epidermidis NIHLM040 hypothetical protein 100 50/50 EJD97750.1
78 62434–62595 53 GGAGGCGGGAAATTG S. epidermidis BH0509 family protein 100 53/53 EJD97749.1
79 62670–62909 79 GGAGGAAGATAATG S. epidermidis hypothetical protein 100 79/79 WP_002498719.1
80 63024–63272 82 GGAGGTATCAAGGTTATG S. epidermidis CopG family transcriptional regulator 100 82/82 MBM0752797.1
81 63390–64280 296 - S. epidermidis ParA family protein 100 268/296 WP_002498717.1

a aa, amino acids.

b Bold letters indicate start codons. Underlines indicate putative ribosome binding sites complementary to the 3’ end of the 16s rRNA.

c Overlap is indicated as the number of overlapping amino acids/total number of amino acids.

Nucleotide sequence of nukacin-encoding plasmid

The size of the entire plasmid, pNuk650, was 26,160 bp, with 29 open reading frames (ORFs). The plasmid contained nukacin KSE650 synthesis genes (nukA coding for prepeptide nukacin KSE650, posttranslational modification enzyme genes nukM, processing and secretion transporter genes nukT, and immunity protein genes nukFEGH), replication-related genes, and other genes including genes coding for hypothetical proteins (Fig 3A and Table 3). Compared to the plasmid pIVK45 (21,840 bp), which carried the gene coding for nukacin IVK45 [28] pNuk650 was larger with a higher number of ORFs (Fig 3A). The amino acid sequence of nukacin KSE650 showed similarity to nukacin IVK45 with one mismatch at the 4th position, but displayed lower similarity to nukacin ISK-1 with 10 mismatches [36, 37] (Fig 3B). The mature peptide of nukacin KSE650 showed a perfect match with nukacin IVK45 and 5 mismatches with nukacin ISK-1.

Fig 3. Nukacin-carrying plasmids and amino acid sequences of nukacin.

Fig 3

(a) Nukacin-encoding plasmid from KSE650 (pNuk650) and the comparison with pIVK45. (b) Amino acid alignment of nukacin ISK-1, nukacin 3299, nukacin KQU131, nukacin IVK45 and nukacin KSE650.

Table 3. Genes in pNuk650.

No. Location (bp) Size (aa)a Translation signalb Homologue as determined by BLAST and/or FASTA
Source Description(s) Identity (%) Overlap (aa)c Accession no.
1 413–541 42 GGAAAAGATATCCATG S. epidermidis RepB (pAQZ2) 83 42/42 AZL87916
2 680–850 56 - S. epidermidis replication protein 91 56/56 WP_194376762
3 976–1911 311 GGAAGAGGTTTATATTATG S. epidermidis replication initiator protein A 100 311/311 WP_194378689
4 2467–3261 264 AGGAGGTATTATTTTG S. epidermidis ParA family protein 100 264/264 WP_172686110
5 3258–3467 69 GAGGGTGTGTG S. epidermidis plasmid replication associated protein, putative transcriptional regulator 98 66/69 AKQ51589
6 3821–3994 57 AGGGGGTATTATAATG S. epidermidis (pIVK45) NukA 98 57/57 AKQ51579
7 4068–4250 60 AGGTACGCGTTTTTAAATTGTATATATG S. epidermidis transposase family protein 92 38/60 MBV5159007
8 4256–4393 45 GAGACCATG S. epidermidis hypothetical protein 100 45/45 WP_194378692
9 4605–4844 79 - S. epidermidis transposase 100 74/79 WP_172686114
10 5583–6326 247 GAGTGAATTATATG S. epidermidis LytTR family transcriptional regulator DNA-binding domain-containing protein 100 247/247 WP_194378694
11 6570–9323 917 AGGAGAGGTTGTTATATATG S. epidermidis (pIVK45) NukM 100 917/917 AKQ51580
12 9345–11429 694 AGGTGAATACAATTG S. epidermidis (pIVK45) NukT 99 694/694 KP702950
13 11442–12350 302 AGGAGGTTCAATTTATG NukF 99 302/302 AKQ51583
14 12351–13103 250 GGAAAGGAATATTTATAAATG S. epidermidis (pIVK45) NukE 99 250/250 AKQ51582
15 13100–13837 245 AAGGAGAGATTTATCTTG S. epidermidis (pIVK45) NukG 88 245/245 AKQ51591
16 13844–14122 92 GAGGATTAATAACTAATG S. epidermidis (pIVK45) NukH 100 92/92 AKQ51584
17 14444–14623 59 - S. epidermidis replication initiator protein A, partial 88 59/272 WP_064595943
18 14790–14930 46 GGATAACAAAATAACATCAACACAATGTCACGATTTCATAATATAGCATG S. epidermidis hypothetical protein 98 46/46 WP_172686106
19 15014–15157 47 GGAATGATAAATTCAACTTTTTCTTTCCGATCATTAATAAAATAAATG no significant similarity found
20 15425–16423 332 TAAGGTGTCGAATCTAAATAAAACTGGGGGCTTTTTTATG S. epidermidis protein rep 98 332/332 WP_145461985
21 17100–17483 127 AGGGGTTTTTTTATG S. epidermidis IS-K bacterial transcription activator, effector-binding domain protein 99 127/127 EID36019
22 17957–18664 235 GAGAGGTGTTTTTTTATGTCTGGTGAAACAGTAGTATATAGAAATG S. epidermidis RepB family plasmid replication initiator protein 100 235/235 WP_194378685
23 18712–19323 203 AGGAGTAGTTTATG S. epidermidis helix-turn-helix domain-containing protein 99 203/203 WP_194378686
24 19890–20699 269 GGAGAGAAATATATATTG S. epidermidis CPBP family intramembrane metalloprotease 100 269/269 WP_168429436
25 20725–21039 104 GAGGTGTAAAAAATG S. epidermidis helix-turn-helix domain-containing protein 99 104/104 WP_002455864
26 21312–22928 538 AGGATTATTATG S. epidermidis MutS family DNA mismatch repair protein 99 538/538 WP_194378687
27 23374–25119 581 AGGTGAAGTTAAAAGTG S. epidermidis AIPR family protein 100 581/581 WP_194378688
28 25145–25853 202 GGAATCAATG S. epidermidis (pIVK45) Sin recombinase 100 202/202 AKQ51586
29 25976–26077 33 AAGGAGGAATACTATG S. epidermidis NAD-dependent epimerase/dehydratase family protein 100 33/33 WP_172686124

a aa, amino acids.

b Bold letters indicate start codons. Underlines indicate putative ribosome binding sites complementary to the 3’ end of the 16s rRNA.

c Overlap is indicated as the number of overlapping amino acids/total number of amino acid.

Identification of epidermin KSE56 and nukacin KSE650

Epidermin KSE56 and nukacin KSE650 were purified from the culture supernatant of KSE56 and KSE650, respectively. After applying the sample purified by Macro Prep resin to Octadecyl C18 column, peak fractions in both samples were collected and each peak fraction was checked for the antibacterial activity against M. luteus. In both samples, one peak fraction showed a strong antibacterial activity (Fig 4A). Using ESI-MS analysis, the molecular masses of purified epidermin KSE56 and nukacin KSE650 were found to be 2163.97 Da and 2938.36 Da, respectively (Fig 4B). The mass of these peptides corresponded to calculated mass of epidermin (2163.95 Da) and nukacin KSE650 (2938.33 Da).

Fig 4. Purification of epidermin and nukacin KSE650 by reverse phase-HPLC and mass determination by ESI-MS.

Fig 4

(a) RP-HPLC chromatogram of epidermin and nukacin KSE650. The arrow shows the peak corresponding to epidermin (upper) or nukacin KSE650 (lower). (b) Mass determination of epidermin (upper) or nukacin KSE650 (lower) by ESI-MS. Several isotopic peaks in each mass/charge (m/z) state.

Antibacterial activity of epidermin KSE56 and nukacin KSE650 against several skin and oral commensal bacteria

In this study, S. epidermidis strains were isolated from the oral cavity. S. epidermidis is also known as a commensal bacterium. Therefore, we investigated the antibacterial activity of the two bacteriocins against oral and skin commensal bacterial species.

We first performed a direct assay using KSE56, KSE650 and plasmid-deleted strains. The plasmid-deleted strains showed no inhibitory zone against S. hominis, while the wild-type strains, KSE56 and KSE650, displayed inhibitory zones (Fig 5).

Fig 5. Antibacterial activity of KSE56, KSE650, and their plasmid-deleted strains.

Fig 5

Direct assays were performed using KSE56, KSE650, and their plasmid-deleted strains. S. hominis was used as an indicator strain.

Afterwards, we performed a direct assay using KSE56 and KSE650 as bacteriocin-producing strains (Table 4). The epidermin-producing strain, KSE56, showed a strong antibacterial activity (>20 mm diameter inhibitory zone) against M. luteus, and an activity (>5 mm diameter) against R. mucilaginosa, C. pseudodiphtheriticum, S. haemolyticus, S. captis, S. hominis, S. simulans, and S. saprophyticus. KSE56 also showed an antibacterial activity against S. epidermidis without bacteriocin production (KSE1, 10, 12, 16), plasmid-curing KSE56 and plasmid-curing KSE650. The inhibitory zone was not observed in S. epidermidis KSE56, S. epidermidis KSE650, C. accolens, S. warneri ISK-1, and S. aureus strains. Regarding oral streptococci, KSE56 showed a strong activity against S. salivarius and S. gordonii, and modest activity against S. mutans and S. sanguinis.

Table 4. Antibacterial activity of KSE56 and KSE650 against various bacterial species.

Indicator strains Halo size (mm)
KSE56 KSE650 S. warneri
Corynebacterium pseudodiphtheriticum JCM1320 10.0±0.8 10.7±0.5 11.7±0.5
Corynebacterium accolens JCM8331 - - 11.3±0.5
Micrococcus luteus JCM1464 31.7±1.2 27.0±0 33.0±0
Rothia mucilaginosa JCM10910 8.7±0.5 8.0±0 13.0±0
Cutibacterium acnes JCM6425 15.0±0.8 - -
Staphylococcus haemolyticus JCM2416 11.7±0.6 13.3±0.5 16.0±0.8
Staphylococcus capitis JCM2420 11.3±0.6 27.3±0.5 17.3±0.5
Staphylococcus simulans JCM2424 13.7±0.6 28.7±0.5 22.7±0.5
Staphylococcus saprophyticus JCM20595 13.0±0 12.3±0.5 13.3±0.5
Staphylococcus hominis JCM31912 15.3±0.6 16.3±0.5 21.7±0.5
Staphylococcus epidermidis KSE1 12.3±0.5 7.0±0.8 N.D.2
Staphylococcus epidermidis KSE10 12.0±0 7.3±0.5 N.D.
Staphylococcus epidermidis KSE12 17.0±0.8 9.7±0.5 N.D.
Staphylococcus epidermidis KSE16 14.3±0.5 8.7±0.5 N.D.
Staphylococcus epidermidis KSE56 - - -
Staphylococcus epidermidis KSE650 - - -
Staphylococcus epidermidis KSE56 plasmid-deleted 20.3±0.5 11.3±0.5 N.D.
Staphylococcus epidermidis KSE650 plasmid-deleted 11.0±0 11.7±0.5 N.D.
Staphylococcus warneri ISK-1 - - -
Staphylococcus aureus MW2 - - 11.3±0.5
Staphylococcus aureus COL - - 11.0±0
Staphylococcus aureus RN4220 (MSSA) - - 10.7±0.5
Streptococcus mutans UA159 15.0±0.8 - -
Streptococcus sanguinis GTC217 12.0±0 - 10.3±0.9
Streptococcus salivarius GTC215 27.7±0.5 12.3±0.5 18.3±0.5
Streptococcus gordonii JCM12995 29.0±0 17.0±0 23.0±0

"-" and "N.D." represent "no inhibitory zone" and "Not determined", respectively.

The nukacin KSE650-producing strain KSE650, showed strong antibacterial activity (>20 mm diameter) against M. luteus, S. captis, and S. simulans, and an activity (>5 mm diameter) against C. pseudodiphtheriticum, R. mucilaginosa, S. haemolyticus, S. hominis, and S. saprophyticus. KSE650 also showed an antibacterial activity against S. epidermidis without bacteriocin production (KSE1, 10, 12, 16), plasmid-curing KSE56 and plasmid-curing KSE650. The inhibitory zone was not observed in S. epidermidis KSE56, S. epidermidis KSE650, C. accolens, S. warneri ISK-1, and S. aureus strains. Regarding oral streptococci, KSE650 showed activity against S. salivarius and S. gordonii, and no activity against S. mutans and S. sanguinis. Compared to the nukacin ISK-1-producing S. warneri strain, S. warneri showed stronger activity against commensal and oral bacteria except for S. capitis and S. simulans. Notably, S. warneri ISK-1 showed activity against the S. aureus strain.

We also checked the antibacterial activity using purified epidermin and nukacin KSE650 (Table 5). The antibacterial pattern against each bacterium was similar to the results of the direct assay.

Table 5. Minimum antibacterial dose of purified epidermin and nukacin KSE650.

Indicator strains Minimum antibacterial dose (μg)
Epidermin Nukacin KSE650
Corynebacterium pseudodiphtheriticum JCM1320 2 2
Corynebacterium accolens JCM8331 > 2 > 2
Micrococcus luteus JCM1464 < 0.03 < 0.03
Rothia mucilaginosa JCM10910 0.5 1
Staphylococcus haemolyticus JCM2416 0.125 0.25
Staphylococcus capitis JCM2420 0.125 < 0.03
Staphylococcus simulans JCM2424 0.125 < 0.03
Staphylococcus saprophyticus JCM20595 0.5 0.25
Staphylococcus hominis JCM31912 0.06 0.25
Staphylococcus epidermidis KSE1 0.5 1
Staphylococcus aureus MW2 2 2
Streptococcus mutans UA159 1 > 2
Streptococcus sanguinis GTC217 0.5 1
Streptococcus salivarius GTC215 0.06 0.25
Streptococcus gordonii JCM12995 0.06 0.125

Co-culture of S. epidermidis with M. luteus

Co-cultures of S. epidermidis KSE1 (bacteriocin negative), KSE56, and KSE650 with M. luteus JCM1464 were analyzed. M. luteus was utilized as an indicator bacterium in co-culture assay because in the direct method, KSE56 and KSE650 showed a significant antibacterial effect against M. luteus. In co-culture with M. luteus, the proportion of S. epidermids KSE1 was 46.2%, while the proportions of KSE56 and KSE650 were 70.4% and 79.8%, respectively (Fig 6).

Fig 6. The proportion of S. epidermidis KSE1, KSE56, and KSE650 in co-culture with M. luteus.

Fig 6

Co-culture assays were performed according to the method described in the Materials and methods. Post hoc multiple comparisons were made using Tukey’s test.

Discussion

In this study, we tried to isolate S. epidermidis strains that produced bacteriocin. We used the S. aureus MW2 braRS-inactivated mutant as the indicator strain for screening. We previously reported that BraRS was involved in resistance to several bacteriocins including nisin A, nukacin ISK-1 and bacitracin [34]; therefore, a braRS-inactivated mutant increased susceptibility to these bacteriocins. Nisin A and nukacin ISK-1 are lantibiotics that act against lipid II molecules, which are responsible for cell wall biosynthesis, and subsequently, form a pour complex [38]. In addition, it was reported that many gram-positive bacteria, including staphylococci, streptococci, bacilli, lactococci and enterococci, produced lantibiotics that bind to lipid II [12, 19–27, 39, 40] Therefore, the braRS-inactivated mutant is a good indicator strain to screen lipid II-binding lantibiotics. Finally, we identified 2 strains that produce epidermin and nukacin IVK45-like bacteriocins. Whole genome analysis of the 2 strains revealed that both genes were located on the plasmids (S2A and 4 Figs).

Epidermin was first identified in the S. epidermidis Tü3298 strain [19, 41]. In the Tü3298 strain, epidermin is located on the plasmid, pTu32. Recently, the whole genome sequence of the Tü3298 strain was determined [42], but the entire plasmid sequence of pEpi56 was not reported. Therefore, our study is the first to report the complete nucleotide sequence of epidermin harboring plasmids. Additionally, the epidermin-producing strain identified in this study was the second strain, following the Tü3298 strain. The nucleotide sequence of the epiA coding epidermin showed 2 mismatches between the two strains, but the amino acid sequence was similar. When the epidermin synthesis genes were compared between the 2 strains, epiT showed a significant difference (Fig 2B). epiT in KSE56 was intact, while this gene in Tu3298 was disrupted into 2 genes, epiT’ and epiT” in Tü3298.

EpiT is involved in the secretion of the peptide. In previous reports that demonstrated the antibacterial activity of epidermin in Tü3298 [19–21], epidermin was correctly modified and secreted externally. However, Peschel A et al reported that the introduction of intact gdmT, encoding the secretion protein for gallidermin, which was close to epidermin in Tü3298, increased the production of epidermin in culture supernatant [43]. Therefore, the secretion activity of epiT’/T” is considered to be partial, while the intact epiT gene in KSE56 may be responsible for full secretion of the epidermin peptide.

Nukacin IVK-1 was first identified in S. warneri [37]. Since then, nukacin ISK-1 like bacteriocins have been identified in S. epidermidis [28], S. hominis [44], and S. simulans [45]. The amino acid sequence of KSE650 shows a high similarity with that of IVK45 by only one mismatch in the entire peptide, and 100% match with the mature peptide. Comparison of the plasmid between the two strains showed that KSE650 was larger than Tü3298, but the composition and the order of nukacin-related genes were identical (Fig 2A). The larger size of pNuk650 was due to the insertion of an approximately 8 kbp fragment, which was detected in pNuk650 but not in pIVK45 (Fig 3A, red arrows).

The antibacterial activity of these peptides against skin and oral commensal bacteria (oral streptococci) showed different patterns. In particular, the epidermin-producing strain (KSE56) had antibacterial activity against oral streptococci, while nukacin-producing strains had less activity. Interestingly, comparing nukacin ISK-1 and nukacin KSE650 suggested that 5 amino acid differences (Fig 7) were responsible for the different activities against several bacteria used in this study. Previously, it was reported that the structure of ring A in nukacin ISK-1 binds to the pyrophosphate moiety of lipid II, the precursor for cell wall peptidoglycan biosynthesis, and ring C was also associated with the binding of the isoprene chain [46]. Since lipid II molecules are widely conserved among gram positive bacteria, the different antibacterial activities between nukacin ISK-1 and nukacin KSE650 are influenced by the other molecules specific to each bacterial species. Furthermore, it is noteworthy that epidermin and nukacin KSE650 showed no inhibitory zone against S. epidermidis KSE650 and KSE56, respectively, while epidermin and nukacin KSE650 showed an activity against plasmid-curing KSE650 and plasmid-curing KSE56, respectively (Table 4). Although the immunity factors for epidermin and nukacin KSE650 were EpiFEG and NukFEG/NukH, respectively, which could be found in a respective plasmid, our results indicate that these immunity factors showed a cross-resistance to another bacteriocin. We previously reported that BraRS and ApsRS, TCSs, are involved in resistance to nisin A and nukacin ISK-1 [34]. Since S. epidermidis also possesses TCSs with similarity to BraRS and ApsRS, S. epidermidis TCSs may be involved in the resistance to epidermin and nukacin KSE650.

Fig 7. Structure of nukacin ISK-1 and nukacin KSE650.

Fig 7

The mature peptide sequences of nukacin ISK-1 and nukacin KSE650 are shown. The deduced calculated mass of mature nukacin KSE650 is consistent with that observed by ESI-MS. The structure is identical to that of nukacin ISK-1, except for the residues indicated by gray circles. Dhb, Ala-S-Ala, and Abu-S-Ala indicate dehydrobutyrine, lanthionine, and 3-methyllanthionine respectively.

In conclusion, we determined the complete sequence of two plasmids encoding epidermin and nukacin KSE650 in S. epidermidis isolated from the oral cavity. S. epidermidis is the major commensal bacterium in human skin and the oral cavity. Based on our findings of the direct assay and co-culture assay, it is speculated that bacteriocins produced by S. epidermidis affect the bacterial composition of the host flora, including the skin, nasal and oral flora. However, in this study, we focused on the isolation of lantibiotic-producing strains using a braRS-inactivated strain as the indicator. Therefore, it is possible that S. epidermidis also produces other types of bacteriocins. Further studies are required to demonstrate the influence of S. epidermidis bacteriocins on the formation of bacterial flora.

Supporting information

S1 Fig. Comparison of amino acid sequences of EpiT between the KSE56 and Tü3298 strains.

(PDF)

S2 Fig

Comparison of nucleotide (A) and amino acid sequences (B) of epiA between the KSE56 and Tü3298 strains.

(PDF)

Acknowledgments

We thank Dr. Tomoko Amimoto, the Natural Science Center for Basic Research and Development (N-BARD), Hiroshima University for the measurement of ESI-MS analysis.

Data Availability

All complete plasmid files are available from the NCBI database (accession numbers OK031036 and OK031035).

Funding Statement

Research Program on Emerging and Re-emerging Infectious Diseases from the Japan Agency for Medical Research and Development (AMED) under grant number 21fk0108604j0001. Grant in Aid for Scientific Research (C) (Grant No: 21K09858A) from the Ministry of Education, Culture, Sports, Sciences, and Technology of Japan.

References

  • 1.Parlet CP, Brown MM, Horswill AR. Commensal Staphylococci Influence Staphylococcus aureus Skin Colonization and Disease. Trends Microbiol. 2019;27: 497–507. doi: 10.1016/j.tim.2019.01.008 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Grice EA, Kong HH, Conlan S, Deming CB, Davis J, Young AC, et al. Topographical and temporal diversity of the human skin microbiome. Science. 2009;324: 1190–1192. doi: 10.1126/science.1171700 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Byrd AL, Belkaid Y, Segre JA. The human skin microbiome. Nat Rev Microbiol. 2018;16: 143–155. doi: 10.1038/nrmicro.2017.157 [DOI] [PubMed] [Google Scholar]
  • 4.Nguyen TH, Park MD, Otto M. Host Response to Staphylococcus epidermidis Colonization and Infections. Front Cell Infect Microbiol. 2017;7: 90. doi: 10.3389/fcimb.2017.00090 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Lai Y, Cogen AL, Radek KA, Park HJ, Macleod DT, Leichtle A, et al. Activation of TLR2 by a small molecule produced by Staphylococcus epidermidis increases antimicrobial defense against bacterial skin infections. J Invest Dermatol. 2010;130: 2211–2221. doi: 10.1038/jid.2010.123 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Scharschmidt TC, Vasquez KS, Truong H-A, Gearty S V, Pauli ML, Nosbaum A, et al. A Wave of Regulatory T Cells into Neonatal Skin Mediates Tolerance to Commensal Microbes. Immunity. 2015;43: 1011–1021. doi: 10.1016/j.immuni.2015.10.016 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Rogers KL, Fey PD, Rupp ME. Coagulase-negative staphylococcal infections. Infect Dis Clin North Am. 2009;23: 73–98. doi: 10.1016/j.idc.2008.10.001 [DOI] [PubMed] [Google Scholar]
  • 8.Uçkay I, Pittet D, Vaudaux P, Sax H, Lew D, Waldvogel F. Foreign body infections due to Staphylococcus epidermidis. Ann Med. 2009;41: 109–119. doi: 10.1080/07853890802337045 [DOI] [PubMed] [Google Scholar]
  • 9.Otto M. Staphylococcus epidermidis—the “accidental” pathogen. Nat Rev Microbiol. 2009;7: 555–567. doi: 10.1038/nrmicro2182 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Miragaia M, Couto I, de Lencastre H. Genetic diversity among methicillin-resistant Staphylococcus epidermidis (MRSE). Microb Drug Resist. 2005;11: 83–93. doi: 10.1089/mdr.2005.11.83 [DOI] [PubMed] [Google Scholar]
  • 11.Cotter PD, Hill C, Ross RP. Bacteriocins: developing innate immunity for food. Nat Rev Microbiol. 2005;3: 777–788. doi: 10.1038/nrmicro1273 [DOI] [PubMed] [Google Scholar]
  • 12.Jack RW, Tagg JR, Ray B. Bacteriocins of gram-positive bacteria. Microbiol Rev. 1995;59: 171–200. doi: 10.1128/mr.59.2.171-200.1995 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Nissen-Meyer J, Nes IF. Ribosomally synthesized antimicrobial peptides: their function, structure, biogenesis, and mechanism of action. Arch Microbiol. 1997;167: 67–77. [PubMed] [Google Scholar]
  • 14.Ryan CS, Kleinberg I. Bacteria in human mouths involved in the production and utilization of hydrogen peroxide. Arch Oral Biol. 1995;40: 753–763. doi: 10.1016/0003-9969(95)00029-o [DOI] [PubMed] [Google Scholar]
  • 15.García-Mendoza A, Liébana J, Castillo AM, de la Higuera A, Piédrola G. Evaluation of the capacity of oral streptococci to produce hydrogen peroxide. J Med Microbiol. 1993;39: 434–439. doi: 10.1099/00222615-39-6-434 [DOI] [PubMed] [Google Scholar]
  • 16.Watanabe A, Kawada-Matsuo M, Le MN-T, Hisatsune J, Oogai Y, Nakano Y, et al. Comprehensive analysis of bacteriocins in Streptococcus mutans. Sci Rep. 2021;11: 12963. doi: 10.1038/s41598-021-92370-1 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Vieira AR, Hiller NL, Powell E, Kim LH-J, Spirk T, Modesto A, et al. Profiling microorganisms in whole saliva of children with and without dental caries. Clin Exp Dent Res. 2019;5: 438–446. doi: 10.1002/cre2.206 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.McManus BA, Daly B, Polyzois I, Wilson P, Brennan GI, Fleming TE, et al. Comparative Microbiological and Whole-Genome Analysis of Staphylococcus aureus Populations in the Oro-Nasal Cavities, Skin and Diabetic Foot Ulcers of Patients With Type 2 Diabetes Reveals a Possible Oro-Nasal Reservoir for Ulcer Infection. Front Microbiol. 2020;11: 748. doi: 10.3389/fmicb.2020.00748 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Allgaier H, Jung G, Werner RG, Schneider U, Zähner H. Epidermin: sequencing of a heterodetic tetracyclic 21-peptide amide antibiotic. Eur J Biochem. 1986;160: 9–22. doi: 10.1111/j.1432-1033.1986.tb09933.x [DOI] [PubMed] [Google Scholar]
  • 20.Schnell N, Entian KD, Schneider U, Götz F, Zähner H, Kellner R, et al. Prepeptide sequence of epidermin, a ribosomally synthesized antibiotic with four sulphide-rings. Nature. 1988;333: 276–278. doi: 10.1038/333276a0 [DOI] [PubMed] [Google Scholar]
  • 21.Bierbaum G, Götz F, Peschel A, Kupke T, van de Kamp M, Sahl HG. The biosynthesis of the lantibiotics epidermin, gallidermin, Pep5 and epilancin K7. Antonie Van Leeuwenhoek. 1996;69: 119–127. doi: 10.1007/BF00399417 [DOI] [PubMed] [Google Scholar]
  • 22.Kaletta C, Entian KD, Kellner R, Jung G, Reis M, Sahl HG. Pep5, a new lantibiotic: structural gene isolation and prepeptide sequence. Arch Microbiol. 1989;152: 16–19. doi: 10.1007/BF00447005 [DOI] [PubMed] [Google Scholar]
  • 23.Weil HP, Beck-Sickinger AG, Metzger J, Stevanovic S, Jung G, Josten M, et al. Biosynthesis of the lantibiotic Pep5. Isolation and characterization of a prepeptide containing dehydroamino acids. Eur J Biochem. 1990;194: 217–223. doi: 10.1111/j.1432-1033.1990.tb19446.x [DOI] [PubMed] [Google Scholar]
  • 24.van de Kamp M, Horstink LM, van den Hooven HW, Konings RN, Hilbers CW, Frey A, et al. Sequence analysis by NMR spectroscopy of the peptide lantibiotic epilancin K7 from Staphylococcus epidermidis K7. Eur J Biochem. 1995;227: 757–771. doi: 10.1111/j.1432-1033.1995.tb20199.x [DOI] [PubMed] [Google Scholar]
  • 25.Ekkelenkamp MB, Hanssen M, Danny Hsu S-T, de Jong A, Milatovic D, Verhoef J, et al. Isolation and structural characterization of epilancin 15X, a novel lantibiotic from a clinical strain of Staphylococcus epidermidis. FEBS Lett. 2005;579: 1917–1922. doi: 10.1016/j.febslet.2005.01.083 [DOI] [PubMed] [Google Scholar]
  • 26.Velásquez JE, Zhang X, van der Donk WA. Biosynthesis of the antimicrobial peptide epilancin 15X and its N-terminal lactate. Chem Biol. 2011;18: 857–867. doi: 10.1016/j.chembiol.2011.05.007 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Heidrich C, Pag U, Josten M, Metzger J, Jack RW, Bierbaum G, et al. Isolation, characterization, and heterologous expression of the novel lantibiotic epicidin 280 and analysis of its biosynthetic gene cluster. Appl Environ Microbiol. 1998;64: 3140–3146. doi: 10.1128/AEM.64.9.3140-3146.1998 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Janek D, Zipperer A, Kulik A, Krismer B, Peschel A. High Frequency and Diversity of Antimicrobial Activities Produced by Nasal Staphylococcus Strains against Bacterial Competitors. PLoS Pathog. 2016;12: e1005812. doi: 10.1371/journal.ppat.1005812 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Matsuo M, Kato F, Oogai Y, Kawai T, Sugai M, Komatsuzawa H. Distinct two-component systems in methicillin-resistant Staphylococcus aureus can change the susceptibility to antimicrobial agents. The Journal of antimicrobial chemotherapy. 2010. pp. 1536–1537. doi: 10.1093/jac/dkq141 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Murchison HH, Barrett JF, Cardineau GA, Curtiss R 3rd. Transformation of Streptococcus mutans with chromosomal and shuttle plasmid (pYA629) DNAs. Infect Immun. 1986;54: 273–282. doi: 10.1128/iai.54.2.273-282.1986 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Kornblum J, Hartman BJ, Novick RP, Tomasz A. Conversion of a homogeneously methicillin-resistant strain of Staphylococcus aureus to heterogeneous resistance by Tn551-mediated insertional inactivation. Eur J Clin Microbiol. 1986;5: 714–718. doi: 10.1007/BF02013311 [DOI] [PubMed] [Google Scholar]
  • 32.Kreiswirth BN, Löfdahl S, Betley MJ, O’Reilly M, Schlievert PM, Bergdoll MS, et al. The toxic shock syndrome exotoxin structural gene is not detectably transmitted by a prophage. Nature. 1983;305: 709–712. doi: 10.1038/305709a0 [DOI] [PubMed] [Google Scholar]
  • 33.Four pediatric deaths from community-acquired methicillin-resistant Staphylococcus aureus—Minnesota and North Dakota, 1997–1999. MMWR Morb Mortal Wkly Rep. 1999;48: 707–710. [PubMed] [Google Scholar]
  • 34.Kawada-Matsuo M, Yoshida Y, Zendo T, Nagao J, Oogai Y, Nakamura Y, et al. Three Distinct Two-Component Systems Are Involved in Resistance to the Class I Bacteriocins, Nukacin ISK-1 and Nisin A, in Staphylococcus aureus. Otto M, editor. PLoS One. 2013;8: e69455. doi: 10.1371/journal.pone.0069455 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Overbeek R, Olson R, Pusch GD, Olsen GJ, Davis JJ, Disz T, et al. The SEED and the Rapid Annotation of microbial genomes using Subsystems Technology (RAST). Nucleic Acids Res. 2014;42: D206–14. doi: 10.1093/nar/gkt1226 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Aso Y, Koga H, Sashihara T, Nagao J-I, Kanemasa Y, Nakayama J, et al. Description of complete DNA sequence of two plasmids from the nukacin ISK-1 producer, Staphylococcus warneri ISK-1. Plasmid. 2005;53: 164–178. doi: 10.1016/j.plasmid.2004.08.003 [DOI] [PubMed] [Google Scholar]
  • 37.Aso Y, Sashihara T, Nagao J-I, Kanemasa Y, Koga H, Hashimoto T, et al. Characterization of a gene cluster of Staphylococcus warneri ISK-1 encoding the biosynthesis of and immunity to the lantibiotic, nukacin ISK-1. Biosci Biotechnol Biochem. 2004;68: 1663–1671. doi: 10.1271/bbb.68.1663 [DOI] [PubMed] [Google Scholar]
  • 38.Islam MR, Nagao J-I, Zendo T, Sonomoto K. Antimicrobial mechanism of lantibiotics. Biochem Soc Trans. 2012;40: 1528–1533. doi: 10.1042/BST20120190 [DOI] [PubMed] [Google Scholar]
  • 39.Vogel V, Spellerberg B. Bacteriocin Production by Beta-Hemolytic Streptococci. Pathog (Basel, Switzerland). 2021;10. doi: 10.3390/pathogens10070867 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Barbosa J, Caetano T, Mendo S. Class I and Class II Lanthipeptides Produced by Bacillus spp. J Nat Prod. 2015;78: 2850–2866. doi: 10.1021/np500424y [DOI] [PubMed] [Google Scholar]
  • 41.Schnell N, Engelke G, Augustin J, Rosenstein R, Ungermann V, Götz F, et al. Analysis of genes involved in the biosynthesis of lantibiotic epidermin. Eur J Biochem. 1992;204: 57–68. doi: 10.1111/j.1432-1033.1992.tb16605.x [DOI] [PubMed] [Google Scholar]
  • 42.Moran JC, Horsburgh MJ. Whole-Genome Sequence of Staphylococcus epidermidis Tü3298. Genome Announc. 2016;4. doi: 10.1128/genomeA.00112-16 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Peschel A, Schnell N, Hille M, Entian KD, Götz F. Secretion of the lantibiotics epidermin and gallidermin: sequence analysis of the genes gdmT and gdmH, their influence on epidermin production and their regulation by EpiQ. Mol Gen Genet. 1997;254: 312–318. doi: 10.1007/s004380050421 [DOI] [PubMed] [Google Scholar]
  • 44.Wilaipun P, Zendo T, Okuda K, Nakayama J, Sonomoto K. Identification of the nukacin KQU-131, a new type-A(II) lantibiotic produced by Staphylococcus hominis KQU-131 isolated from Thai fermented fish product (Pla-ra). Biosci Biotechnol Biochem. 2008;72: 2232–2235. doi: 10.1271/bbb.80239 [DOI] [PubMed] [Google Scholar]
  • 45.Ceotto H, Holo H, da Costa KFS, Nascimento J dos S, Salehian Z, Nes IF, et al. Nukacin 3299, a lantibiotic produced by Staphylococcus simulans 3299 identical to nukacin ISK-1. Vet Microbiol. 2010;146: 124–131. doi: 10.1016/j.vetmic.2010.04.032 [DOI] [PubMed] [Google Scholar]
  • 46.Fujinami D, Mahin A-A, Elsayed KM, Islam MR, Nagao J-I, Roy U, et al. The lantibiotic nukacin ISK-1 exists in an equilibrium between active and inactive lipid-II binding states. Commun Biol. 2018;1: 150. doi: 10.1038/s42003-018-0150-3 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

S1 Fig. Comparison of amino acid sequences of EpiT between the KSE56 and Tü3298 strains.

(PDF)

S2 Fig

Comparison of nucleotide (A) and amino acid sequences (B) of epiA between the KSE56 and Tü3298 strains.

(PDF)

Data Availability Statement

All complete plasmid files are available from the NCBI database (accession numbers OK031036 and OK031035).


Articles from PLoS ONE are provided here courtesy of PLOS

RESOURCES