Abstract
Background
Strong multiple stress-tolerance is a desirable characteristic for Saccharomyces cerevisiae when different feedstocks are used for economical industrial ethanol production. Random mutagenesis or genome shuffling has been applied for improving multiple stress-tolerance, however, these techniques are generally time-consuming and labor cost-intensive and their molecular mechanisms are unclear. Genetic engineering, as an efficient technology, is poorly applied to construct multiple stress-tolerant industrial S. cerevisiae due to lack of clear genetic targets. Therefore, constructing multiple stress-tolerant industrial S. cerevisiae is challenging. In this study, some target genes were mined by comparative transcriptomics analysis and applied for the construction of multiple stress-tolerant industrial S. cerevisiae strains with prominent bioethanol production.
Results
Twenty-eight shared differentially expressed genes (DEGs) were identified by comparative analysis of the transcriptomes of a multiple stress-tolerant strain E-158 and its original strain KF-7 under five stress conditions (high ethanol, high temperature, high glucose, high salt, etc.). Six of the shared DEGs which may have strong relationship with multiple stresses, including functional genes (ASP3, ENA5), genes of unknown function (YOL162W, YOR012W), and transcription factors (Crz1p, Tos8p), were selected by a comprehensive strategy from multiple aspects. Through genetic editing based on the CRISPR/Case9 technology, it was demonstrated that expression regulation of each of these six DEGs improved the multiple stress-tolerance and ethanol production of strain KF-7. In particular, the overexpression of ENA5 significantly enhanced the multiple stress-tolerance of not only KF-7 but also E-158. The resulting engineered strain, E-158-ENA5, achieved higher accumulation of ethanol. The ethanol concentrations were 101.67% and 27.31% higher than those of the E-158 when YPD media and industrial feedstocks (straw, molasses, cassava) were fermented, respectively, under stress conditions.
Conclusion
Six genes that could be used as the gene targets to improve multiple stress-tolerance and ethanol production capacities of S. cerevisiae were identified for the first time. Compared to the other five DEGs, ENA5 has a more vital function in regulating the multiple stress-tolerance of S. cerevisiae. These findings provide novel insights into the efficient construction of multiple stress-tolerant industrial S. cerevisiae suitable for the fermentation of different raw materials.
Graphical Abstract
Supplementary Information
The online version contains supplementary material available at 10.1186/s13068-022-02109-x.
Keywords: Saccharomyces cerevisiae, Multiple stress-tolerance, Comparative transcriptome, ENA5, ASP3, Crz1p
Highlights
Novel genes related to stress tolerance were mined by a comprehensive strategy.
Stress tolerance was improved by regulating expression of each of the novel genes.
Overexpression of ENA5 enhanced ethanol production under all stress conditions.
Ethanol titer of the engineered strain increased by 41.35% at high temperature.
Ethanol titer of the engineered strain increased by 121.42% at salt stress condition
Supplementary Information
The online version contains supplementary material available at 10.1186/s13068-022-02109-x.
Background
Bioethanol, an eco-friendly renewable biofuel, is one of the alternatives of fossil gasoline [1]. Bioethanol production is based on the fermentation of starchy (cassava, corn, microalgae, etc.), sugary (molasses, sweet sorghum/sugarcane juice, etc.), or lignocellulosic (straw, corn cob, etc.) biomass [1, 2]. Species including Saccharomyces cerevisiae, Kluyveromyces marxianus, Zymomonas mobilis, and Pichia stipites are bioethanol producers [3–5]. S. cerevisiae is the main species used for industrial ethanol production due to its good fermentation performance and stress resistance [6–8]. However, S. cerevisiae is commonly exposed to different kinds of environmental stresses in the industrial fermentation process with different feedstocks. For example, in simultaneous saccharification and fermentation (SSF) with lignocellulosic or starchy biomass as feedstock, S. cerevisiae is expected to resist high temperatures (since the optimal enzymatic saccharification temperature is 45–50 °C) and high ethanol concentration [9–11]. Similarly, during very high gravity (VHG) fermentation using sugar-based raw materials (molasses, concentrated sweet sorghum juice, and sugarcane juice), strains should withstand the high concentration of sugar at the early stage and high ethanol concentration at the later stage [12]. Moreover, molasses without acid pretreatment has high salt content, which notably impedes the fermentation efficiency of S. cerevisiae [13, 14]. Such environmental stresses possibly cause lipid peroxidation, protein denaturation, DNA damage, cell apoptosis, etc., of S. cerevisiae [15, 16]. Extensive improvements of the multiple stress-tolerance and robustness of S. cerevisiae are of paramount to achieve high bioethanol production.
However, breeding multiple stress-tolerant industrial S. cerevisiae strains that perform well when using whichever feedstocks is still challenging [17]. Presently, some studies have reported that stress-tolerance of strains can be improved by random mutagenesis [18], genome shuffling [19], and genetic engineering [17]. Compared with random mutagenesis and genome shuffling, genetic engineering is of great significance because of short breeding time, clear gene targeting and clear relationship between gene and phenotype. Over the past decades, studies have reported that a number of genes were closely related to ethanol, heat, or osmosis stress tolerance of S. cerevisiae [9, 20–22], which can be used as the potential targets to improve stress tolerance of the strains. Based on these findings, a number of trials have been performed. For example, overexpression of ISU1 and JAC1 increased the ethanol tolerance [23] and overexpression of HSF1 and MSN2 promoted cell growth and high temperature fermentation [24]. Salt tolerance can be enhanced by over expressing CDS1 and CHO1 [25]. However, these studies mainly focused on the improvement of resistance to single stress (high ethanol or high temperature). To our knowledge, none of the genes linking to multiple stress-tolerance has been reported to date. Since S. cerevisiae strains are forced to face diverse environmental stresses during the industrial fermentation, it is vital to identify gene targets that could be engineered to improve multiple stress-tolerance of S. cerevisiae.
In our previous study, a S. cerevisiae strain E-158 was obtained by random mutagenesis and hybridization, which shows higher capability of multiple stress-tolerance than its original strain KF-7 [18]. To identify potential target genes related to multiple stress-tolerance, in the present study, the comparative transcriptome analysis was performed between strain E-158 and its original strain KF-7 under five stress conditions. Six target genes which possibly contribute to the multiple stress-tolerant phenotypes of S. cerevisiae were mined by a comprehensive strategy. CRISPR/Cas9 technology was used to regulate the expression of these six target genes to explore their impacts on the multiple stress-tolerance phenotypes of S. cerevisiae. Moreover, the stress tolerance of the engineered strains was assessed using three kinds of typical industrial feedstocks.
Results
Fermentation performance of original strain KF-7 and resistant strain E-158
In our previous study, an excellent multiple stress-tolerant strain E-158 was obtained by using a strategy of random mutagenesis and hybridization [18]. The strain E-158 showed higher ethanol production and glucose consumption rates than the original strain KF-7 under five stress conditions. The final concentrations of ethanol produced by E-158 during batch fermentations were 66.89%, 33.37%, 81.02%, 10.14%, and 35.98%, respectively, higher than those of KF-7 under five stress conditions: (1) 8.0% (v/v) initial ethanol, (2) 44 °C, (3) 43 °C and 2.6% (v/v) initial ethanol, (4) 27% glucose, (5) 1.25 M NaCl (Fig. 1).
Fig. 1.
Fermentation characteristics under five stress conditions. Fermentation kinetics (A–E) of KF-7 (open squares: glucose; closed squares: ethanol) and E-158 (open circles: glucose; closed circles: ethanol) were shown. Data are averages of three independent experiments (error bars represent SD)
Comprehensive strategy of mining key genes regulating stress-tolerant phenotypes of S. cerevisiae
To mine the potential key genes governing the multiple stress-tolerant phenotypes of S. cerevisiae, transcriptional profiles of strains KF-7 and E-158 under five stress conditions were investigated based on RNA-seq with three biological replicates (the RNA extraction times were shown in Fig. 1, and the gene expression levels of KF-7 under same stress conditions were taken as the control group). According to differential expression analysis of RNA-seq data, hundreds of DEGs were found under each kind of stress condition (Fig. 2A).
Fig. 2.
A comprehensive selection of key genes potentially related to the multiple stress-tolerant phenotypes. A DEGs under five stress conditions; B Venn diagram of DEGs under the five stress conditions, including 28 shared DEGs; C GO enrichment analyses of 28 shared DEGs; D the pathway of cyanoamino acid metabolism; E protein–protein interaction network of 28 shared DEGs. In the plot, the bluer the circle, the greater the contribution of the gene, the thicker the line, the stronger the interaction between the two genes; F Relative expression level of the DEGs of unknown function in 28 shared DEGs; G DEGs regulated by the two identified TFs in 28 shared DEGs
Twenty-eight DEGs were found shared under all five stress conditions via Venn diagram (Fig. 2B, Additional file 1: Table S1), suggesting their potential contributions to multiple stress-tolerant phenotypes. GO and KEGG analyses revealed that these DEGs were involved in multiple biological processes. The functional gene ASP3, whose expression largely decreased (log2FC: − 10 ~ − 12), was involved in both processes of response to stress (GO: 0006950) and cellular nitrogen compound metabolism (GO: 0034641) (Fig. 2C). ASP3 was also involved in cyanoamino acid metabolism (KEGG Pathway: sce00460), the only pathway significantly enriched by the KEGG analysis, suggesting ASP3 may be one of the key genes regulating multiple-tolerant phenotypes of S. cerevisiae (Fig. 2D). To reveal the relationship among DEGs and to find the core regulatory target genes, protein–protein interaction network analysis was performed for the 28 shared DEGs. As shown in Fig. 2E, gene ENA5 (log2FC: 2 ~ 16) was located at the core of the network and had strong relationships with other DEGs. ENA5 encodes a P-type ATPase (extrudes Na+ probably in exchange for H+), which may assist the efflux of sodium ions, thus reducing cytotoxicity [26]. It could be one key functional gene responsible for regulating multiple-tolerant phenotypes of S. cerevisiae.
Six DEGs with unknown function (putative protein with unknown function in Saccharomyces Genome Database) in 28 shared DEGs were all significantly down-regulated (Fig. 2F). Among these six DEGs, the expression of DEGs named YOL162W (log2FC: − 8 ~ − 11), YOL163W (log2FC: − 8 ~ − 10) and YOR012W (log2FC: − 8 ~ − 10) decreased more than other three DEGs, suggesting they may have a greater impact on the tolerance phenotype [27]. Genes YOL162W and YOL163W have high sequence similarity and were proposed to have similar function [28]. Hence, YOL162W and YOR012W were selected as candidate genes to explore their effects on multiple-tolerant phenotypes of S. cerevisiae.
Crz1p (log2FC: 1 ~ 2) and Tos8p (log2FC: − 9 ~ − 13) were two transcriptional factors (TFs) found in the 28 shared DEGs (Fig. 2G). The regulatory relationship between these two TFs and the 28 shared DEGs was explored through YEASTRACT database. The results showed that the DEGs including SPO24, ENA5, WSC2, HSP150, YOL162W, and YOL163W among the 28 shared DEGs were potentially regulated by Crz1p. DEGs of GEX2 and YDR222W were potentially regulated by Tos8p. Therefore, Crz1p and Tos8p may be key TFs regulating multiple-tolerant phenotypes of S. cerevisiae.
Growth and fermentation abilities of engineered strains using original strain KF-7 as host
To experimentally verified whether the identified key DEGs are responsible for the multiple-tolerant phenotypes in strain E-158, using its original strain KF-7 as a host, genes CRZ1 and ENA5 were over expressed, and genes ASP3, TOS8, YOL162W, and YOR012W were knocked out to result in strains KF-7-CRZ1, KF-7-ENA5, KF-7ΔASP3, KF-7ΔTOS8, KF-7ΔYOL162W, and KF-7ΔYOR012W, respectively. The growth of these engineered strains under different stress conditions was compared with that of KF-7 through the spot assay (Fig. 3). Under the condition without stress, strains showed similar growth capacities. When exposed to 13% (v/v) ethanol, all strains, except strain KF-7-CRZ1, grew better than KF-7. Under the heat stress, strain KF-7ΔYOL162W did not grow when the temperature was 44 °C. However, the growth of other strains was significantly better than that of KF-7. When the spot assay was respectively performed under the osmotic stress conditions, i.e., 400 g/L glucose and 3 mol/L sorbitol, strains KF-7-CRZ1, KF-7-ENA5, KF-7ΔASP3, KF-7ΔTOS8, and KF-7ΔYOR012W grew better than KF-7, but there was no significant difference between KF-7ΔYOL162W and KF-7.
Fig. 3.
Growth abilities of engineered strains using original strain KF-7 as the host under different stress conditions
To evaluate the ability of ethanol tolerance of the engineered strains, batch fermentations were performed using YPD150 media with 8.0% (v/v) initial ethanol concentration (Fig. 4A). Except for KF-7-CRZ1 and KF-7ΔYOL162W, the other strains produced significantly (P < 0.05) more ethanol than KF-7 (Table 1). After 96-h fermentation, the order of the final ethanol concentrations produced by these strains was as follows: KF-7-ENA5 > KF-7ΔASP3 > KF-7ΔYOR012W > KF-7ΔTOS8 > KF-7ΔYOL162W > KF-7 > KF-7-CRZ1. The ethanol concentration of KF-7-ENA5 was the highest (23.96 ± 0.73 g/L), which was 27.57% higher than that of KF-7 (18.79 ± 2.11 g/L) (Table 1).
Fig. 4.
Fermentation abilities of engineered strains using original strain KF-7 as the host under five stress conditions. A 8.0% initial ethanol; B 44 °C; C 43 °C with 2.6% initial ethanol; D 270 g/L glucose; E 1.25 mol/L NaCl; F 1.5 mol/L NaCl. Data are averages of three independent experiments (error bars represent SD)
Table 1.
Comparisons of fermentation performance of engineered strains using original strain KF-7 as the host
Indexes | Strains | 8.0% (v/v) Initial ethanol (YPD150) |
44 °C (YPD100) |
43 °C + 2.6% (v/v) Initial ethanol (YPD100) |
27% Glucose (YPD270) |
1.25 M NaCl (YPD150) |
---|---|---|---|---|---|---|
KF-7 | 18.79 ± 2.11c | 31.39 ± 2.54c | 13.00 ± 1.84b | 123.92 ± 0.79c | 43.78 ± 1.37d | |
Final generated ethanol concentration (g/L) | KF-7-CRZ1 | 14.82 ± 1.48d | 40.11 ± 2.42ab | 21.93 ± 1.49a | 128.99 ± 1.05b | 63.66 ± 1.50a |
KF-7-ENA5 | 23.96 ± 0.73a | 41.69 ± 0.66ab | 22.50 ± 1.70a | 131.65 ± 0.99a | 64.26 ± 1.12a | |
KF-7ΔASP3 | 22.76 ± 1.12ab | 44.37 ± 1.86a | 25.91 ± 2.24a | 128.19 ± 0.69b | 45.16 ± 1.17d | |
KF-7ΔTOS8 | 20.26 ± 1.57ab | 36.58 ± 2.19bc | 14.63 ± 1.79b | 129.40 ± 0.96ab | 54.78 ± 0.81bc | |
KF-7ΔYOL162W | 19.49 ± 0.94bc | 17.70 ± 3.60d | 4.24 ± 1.26c | 122.80 ± 1.19c | 57.77 ± 1.62b | |
KF-7ΔYOR012W | 22.45 ± 1.11ab | 37.63 ± 1.54bc | 16.94 ± 1.43b | 126.95 ± 1.99bc | 51.16 ± 1.33c | |
KF-7 | 100.12 ± 4.07ab | 29.51 ± 3.57b | 71.80 ± 3.41b | 25.09 ± 1.49a | 40.18 ± 4.81a | |
Residual glucose (g/L) | KF-7-CRZ1 | 105.01 ± 3.12a | 13.75 ± 3.78 cd | 50.59 ± 2.80d | 13.48 ± 2.58c | 0.00 ± 0.00c |
KF-7-ENA5 | 86.88 ± 1.55d | 12.62 ± 4.69 cd | 50.10 ± 3.37d | 10.90 ± 1.88c | 0.00 ± 0.00c | |
KF-7ΔASP3 | 89.53 ± 1.29 cd | 5.89 ± 2.90d | 41.76 ± 4.16d | 15.05 ± 1.31bc | 34.11 ± 2.72a | |
KF-7ΔTOS8 | 95.74 ± 2.71bc | 19.88 ± 3.72bc | 67.85 ± 3.33bc | 13.74 ± 1.91c | 9.76 ± 1.88b | |
KF-7ΔYOL162W | 98.98 ± 1.86ab | 57.75 ± 5.06a | 85.36 ± 2.35a | 29.66 ± 2.92a | 1.36 ± 0.53c | |
KF-7ΔYOR012W | 90.97 ± 1.13 cd | 18.56 ± 2.63c | 61.66 ± 2.84c | 19.48 ± 1.17b | 14.66 ± 3.09b | |
Ethanol yield (g ethanol/g consumed glucose) | KF-7 | 0.45 ± 0.01a | 0.45 ± 0.01bc | 0.47 ± 0.01a | 0.50 ± 0.01a | 0.42 ± 0.02ab |
KF-7-CRZ1 | 0.41 ± 0.01b | 0.46 ± 0.00ab | 0.46 ± 0.01a | 0.50 ± 0.00a | 0.44 ± 0.02ab | |
KF-7-ENA5 | 0.44 ± 0.00a | 0.48 ± 0.02a | 0.46 ± 0.01a | 0.50 ± 0.01a | 0.45 ± 0.01a | |
KF-7ΔASP3 | 0.44 ± 0.00a | 0.47 ± 0.00ab | 0.46 ± 0.01a | 0.50 ± 0.00a | 0.41 ± 0.00bc | |
KF-7ΔTOS8 | 0.44 ± 0.02a | 0.46 ± 0.01ab | 0.47 ± 0.01a | 0.49 ± 0.01a | 0.41 ± 0.00bc | |
KF-7ΔYOL162W | 0.46 ± 0.01a | 0.42 ± 0.01c | 0.32 ± 0.02b | 0.49 ± 0.01a | 0.41 ± 0.01bc | |
KF-7ΔYOR012W | 0.45 ± 0.01a | 0.46 ± 0.01ab | 0.45 ± 0.02a | 0.50 ± 0.01a | 0.39 ± 0.01c |
The data in the table are those at the end of fermentation. Values indicate mean ± standard deviation of three biological replications. Values followed by different lowercase letters in the same column indicate significant differences at the level of P < 0.05 (Tukey-test) among strains. Same lowercase letters, no difference. KF-7-CRZ1: overexpression of TF Crz1p in KF-7; KF-7-ENA5: overexpression of ENA5 in KF-7; KF-7ΔASP3: Knockout ASP3 in KF-7; KF-7ΔTOS8: Knockout TOS8 in KF-7; KF-7ΔYOL162W: Knockout YOL162W in KF-7; KF-7ΔYOR012W: Knockout YOR012W in KF-7
During the batch fermentations at 44 °C, the ethanol concentration of KF-7ΔYOL162W was only 56.39% of that of KF-7, but the ethanol concentrations of other strains were significantly (P < 0.05) higher than that of KF-7 (Fig. 4B, Table 1). Among them, KF-7ΔASP3 (44.37 ± 1.86 g/L) had the highest ethanol production, which was 41.35% higher than KF-7 (31.39 ± 2.54 g/L). Meanwhile, the ethanol concentration of KF-7ΔASP3 (25.91 ± 2.24 g/L) was 99.31% higher than that of KF-7 (13.00 ± 1.84 g/L) under two stresses of ethanol and heat (Fig. 4C, Table 1).
VHG fermentations were conducted using YP medium with 271.09 g/L glucose concentration. Except for strain KF-7ΔYOL162W, the ethanol concentrations of other strains were increased by 2.45% (KF-7ΔYOR012W) ~ 6.24% (KF-7-ENA5) compared with that of KF-7 (Fig. 4D, Table 1). All strains had improved fermentation performance when fermenting YPD150 medium supplemented with 1.25 mol/L (7.31%) NaCl (Fig. 4E). Especially, after 96-h fermentation, strains KF-7-CRZ1 and KF-7-ENA5 utilized all glucose, but the residual glucose was 43.78 ± 1.37 g/L for KF-7 (Table 1). When the concentration of NaCl was increased to 1.5 mol/L, strains KF-7-CRZ1 and KF-7-ENA5 showed high ethanol production and glucose consumption rates (Fig. 4F). The final ethanol concentrations were 52.48 ± 0.97 g/L and 44.93 ± 1.58 g/L, which were 121.42% and 89.56% higher than those of KF-7, respectively.
Growth and fermentation abilities of engineered strains using resistant strain E-158 as host
Since the overexpression of ENA5 or CRZ1 significantly improved multiple stress-tolerance of the original strain KF-7, the effects of overexpression of these two genes on resistant strain E-158 were further explored. Overexpression of ENA5 and CRZ1 using E-158 as host resulted in strains KF-7-CRZ1 and E-158-ENA5, respectively. The growth of E-158-ENA5 was significantly better than that of E-158 in the presence of 13% (v/v) ethanol, while the growth of E-158-CRZ1 was poor (Fig. 5). E-158-CRZ1 and E-158-ENA5 grew better than E-158 under heat stress at 44 °C. Under the high osmotic conditions of 400 g/L glucose, 3 mol/L sorbitol, or 2 mol/L NaCl, the growths of E-158-CRZ1 and E-158-ENA5 were better than that of E-158. Particularly, under 2 mol/L NaCl stress, both the engineered strains showed excellent growth capacities.
Fig. 5.
Growth abilities of engineered strains using resistant strain E-158 as the host under different stress conditions
Batch fermentations of E-158-CRZ1 and E-158-ENA5 were conducted under five stress conditions. Overexpression of ENA5 further increased the ethanol tolerance of E-158. The ethanol produced by E-158-ENA5 (32.39 ± 1.02 g/L) was 13.09% higher than that of E-158 (28.64 ± 1.66 g/L) when YPD150 medium with 8.0% (v/v) initial ethanol concentration was fermented (Fig. 6A, Table 2). However, the ethanol concentration of strain E-158-CRZ1 was lower than that of E-158.
Fig. 6.
Fermentation abilities of engineered strains using resistant strain E-158 as the host under five stress conditions. A 8.0% initial ethanol; B 44 °C; C 43 °C with 2.6% initial ethanol; D 280 g/L glucose; E 1.25 mol/L NaCl; F 1.5 mol/L NaCl. Data are averages of three independent experiments (error bars represent SD)
Table 2.
Comparisons of fermentation performance of engineered strains using resistant strain E-158 as the host
Indexes | Strains | 8.0% (v/v) Initial ethanol (YPD150) |
44 °C (YPD100) |
43 °C + 2.6% (v/v) Initial ethanol (YPD100) |
28% Glucose (YPD280) |
1.5 M NaCl (YPD150) |
---|---|---|---|---|---|---|
Final generated ethanol concentration (g/L) | E-158 | 28.64 ± 1.66bc | 38.12 ± 1.90b | 18.66 ± 1.62b | 128.40 ± 1.17b | 28.13 ± 1.58c |
E-158-CRZ1 | 25.24 ± 1.99c | 42.64 ± 1.71a | 24.34 ± 1.76a | 131.77 ± 0.79a | 46.90 ± 2.10b | |
E-158-ENA5 | 32.39 ± 1.02a | 43.52 ± 1.17a | 23.43 ± 0.95a | 132.90 ± 1.80a | 56.73 ± 1.05a | |
E-158 | 78.00 ± 3.40a | 17.91 ± 1.72a | 56.25 ± 3.00a | 25.75 ± 2.22a | 72.47 ± 4.53a | |
Residual glucose (g/L) | E-158-CRZ1 | 82.34 ± 2.35a | 9.70 ± 2.66b | 43.99 ± 3.30b | 19.21 ± 1.95b | 34.24 ± 4.36b |
E-158-ENA5 | 70.44 ± 1.74b | 7.21 ± 2.03b | 44.13 ± 1.40b | 17.79 ± 2.79b | 8.75 ± 2.54c | |
Ethanol yield (g ethanol/g consumed glucose) |
E-158 | 0.45 ± 0.01ab | 0.46 ± 0.00a | 0.44 ± 0.00a | 0.50 ± 0.00a | 0.40 ± 0.01b |
E-158-CRZ1 | 0.43 ± 0.01b | 0.47 ± 0.01a | 0.44 ± 0.01a | 0.50 ± 0.01a | 0.43 ± 0.00a | |
E-158-ENA5 | 0.46 ± 0.01a | 0.47 ± 0.01a | 0.43 ± 0.01a | 0.50 ± 0.01a | 0.42 ± 0.01a |
The data in the table are those at the end of fermentation. Values indicate mean ± standard deviation of three biological replications. Values followed by different lowercase letters in the same column indicate significant differences at the level of P < 0.05 (Tukey-test) among strains. Same lowercase letters, no difference. E-158-CRZ1: Overexpression of TF Crz1p in E-158; E-158-ENA5: Overexpression of ENA5 in E-158
Under fermentation at 44 °C, the ethanol concentrations of E-158-CRZ1 and E-158-ENA5 were increased by 11.86% and 14.17%, respectively, compared with that of E-158 (Fig. 6B, Table 2). Meanwhile, the ethanol production and glucose consumption rates of E-158-CRZ1 and E-158-ENA5 were significant higher (P < 0.05) than those of E-158 under the multiple stress of ethanol and heat, and the final ethanol concentrations produced by them were increased by about 30% compared with that of E-158 (Fig. 6C, Table 2).
When VHG fermentation was conducted under 280.72 g/L glucose concentration, significant (P < 0.05) difference in the fermentation performance among the strains was not observed (Fig. 6D). However, under the fermentation condition of 1.25 mol/L NaCl, E-158-CRZ1 and E-158-ENA5 consumed all the glucose at 72 h, which was 24 h earlier than E-158 (Fig. 6E). When the concentration of NaCl was increased to 1.5 mol/L, the final ethanol concentrations of E-158-CRZ1 and E-158-ENA5 were 46.90 ± 2.10 g/L and 56.73 ± 1.05 g/L, respectively, which were 66.73% and 101.67% higher than that of E-158 (28.13 ± 1.58 g/L) (Fig. 6F, Table 2). In conclusion, overexpression of ENA5 improved all kinds of stress tolerance of resistant strain E-158.
Fermentation abilities of engineered strains when fermenting pretreated straw, molasses and cassava under stress conditions
To evaluate the potential of the strains engineered in this study for industrial applications, the fermentation abilities of strains KF-7, KF-7-ENA5, E-158, and E-158-ENA5 were assessed using pretreated straw, molasses, and cassava, which are feedstocks commonly used in industrial ethanol production (Additional file 1: Tables S2, S3, S4). By SSF of pretreated straw at 42 °C, the ethanol concentrations of KF-7-ENA5, E-158, and E-158-ENA5 were 63.35 ± 2.50 g/L, 65.50 ± 3.71 g/L, and 68.40 ± 1.59 g/L, respectively, which were increased by 13.35%, 17.19%, and 22.38% individually, compared with that of the original strain KF-7 (55.89 ± 2.68 g/L) (Fig. 7A, Additional file 1: Fig. S1A, B). The engineered strains also showed much higher ethanol yields (Additional file 1: Table S5). These results indicated that the overexpression of ENA5 improved the fermentation capacity of the strains under high temperatures.
Fig. 7.
Fermentation results of engineered strains when pretreated straw, molasses, and cassava were fermented under stress conditions. A High-temperature SSF of pretreated straw; B VHG fermentation of molasses; C SSF of cassava with high solid content
When the molasses with 270.91 g/L total sugar was fermented, the final ethanol concentrations of KF-7-ENA5, E-158, and E-158-ENA5 were 22.32%-27.31% higher than that of KF-7, and the strain E-158-ENA5 had the highest ethanol concentration of 98.28 g/L (Fig. 7B, Additional file 1: Fig. S1C). When cassavas with a solid content of 35% were used for SSF at 33 °C, the ethanol concentrations of strains KF-7-ENA5, E-158, and E-158-ENA5 were 6.50%, 11.01%, 14.08% respectively after 96-h fermentation, higher than that of KF-7, and the ethanol concentration produced by strain E-158-ENA5 was 138.43 g/L (Fig. 7C, Additional file 1: Fig. S1D). These results suggested that the overexpression of ENA5 simultaneously enhanced tolerance of the strains to the heat, ethanol, and osmosis when different industrial feedstocks were fermented.
Discussion
To find target genes that can increase the multiple stress-tolerant ability of S. cerevisiae suitable for various industrial feedstocks is still challenging because of the molecular regulation complexity of multiple stress-tolerant phenotypes. Presently, researchers have reported that single tolerance to ethanol or high temperature of S. cerevisiae can be significantly improved by over expressing or knocking out some genes or TFs [23, 24], however, researches on screening key genes responsible for enhancing the multiple stress-tolerance of industrial S. cerevisiae are absent. In our previous study, a multiple stress-tolerant strain E-158 was obtained by mutagenesis and hybridization using KF-7 as the starting strain [18]. In the present study, by comparing the transcriptomes of E-158 and KF-7, 28 DEGs were found shared under five stress conditions (Fig. 2). Six of them were mined and all of them were found to be associated with multiple stress-tolerant phenotypes of S. cerevisiae.
Among the six DEGs, ENA5 was the most prominent in the multiple stress-tolerance improvement. To date, no report has revealed the relationship between ENA5 and the stress tolerance phenotypes of S. cerevisiae. Our study revealed for the first time that the overexpression of ENA5 could significantly improve the tolerance of S. cerevisiae to all kinds of stresses studied. Especially, after overexpression of ENA5, the ethanol concentrations of engineered strains were increased to about twofold under the conditions of 1.5 mol/L NaCl (Figs. 4F, Fig. 6F). ENA5 is previously reported as encoding P-type ATPase that may assist the efflux of sodium ions [26, 29]. Therefore, the overexpression of ENA5 may reduce cytotoxicity and enhance the salt tolerance of S. cerevisiae through assisting in the efflux of sodium ions. Genes ENA1、ENA2、ENA5 are the members of a gene cluster encoding proteins with very similar function [30]. These genes highly expressed under high sucrose tolerance [31], which indicating ion transport is possibly important for S. cerevisiae to resist high osmotic stress. Nevertheless, the specific regulatory mechanism of gene ENA5 on the multiple stress-tolerant phenotypes of S. cerevisiae needs to be investigated in detail in the future study.
In addition to gene ENA5, for the first time, gene ASP3 was found having an important effect on high ethanol and high temperature stress tolerance phenotypes of S. cerevisiae. ASP3 is a gene cluster composed of four identical genes, i.e., ASP3-1, ASP3-2, ASP3-3, and ASP3-4, which encode L-asparaginase II [32]. Asparaginase II is a periplasmic enzyme in yeast, hydrolyzing both D- and L-asparagine to aspartate and ammonium cation [32]. ASP3 was upregulated during nitrogen starvation to facilitate the utilization of extracellular asparagine as a source of nitrogen [33]. Nitrogen starvation could promote the synthesis of lipid and/or polyhydroxybutyrate (PHB) [34, 35]. However, the molecular regulation mechanism of the deletion of ASP3 on stress tolerance and the possible relationship between the nitrogen starvation response and the stress tolerance are still unknown, which need further investigations.
Genes of unknown function were often found expressed [36], however, no studies showed the relationship between genes of unknown function and stress-tolerant phenotypes of S. cerevisiae. Knocking out gene YOR012W of unknown function had a limited effect on the multiple stress-tolerant phenotypes of KF-7. However, knocking out YOL162W significantly improved the high salt tolerance while significantly reduced the high temperature resistance of the strain KF-7. Although the function of the protein encoded by YOL162W is unclear, YOL162W had a vital relationship with the high temperature and high salt tolerance phenotypes (Table 1), the underly mechanism is worthy for further investigation.
Several studies reported that TFs are important to regulate the tolerance phenotype of S. cerevisiae [24, 37]. However, the relationship of the two TFs, Tos8p and Crz1p, with the multiple stress tolerances was not reported to date. Tos8p was reported to be associated with chromatin and highly expressed under meiosis and cell damage [38]. In the present study, knocking out TOS8 in original strain KF-7 increased the osmosis and high temperature tolerance phenotypes of the strain (Table 1). YEASTRACT database shows that the TF Tos8p regulates 8.0% of the genes in the genome of S. cerevisiae. The genes regulated by Tos8p are significantly enriched in pathways of fungal-type cell wall organization or biogenesis (GO: 0071852), cation transport (GO: 0006812), and siderophore transport (GO: 0015891). However, the molecular mechanism of the deletion of TOS8 on the improvement of multiple stress-tolerance needs further investigations. The overexpression of CRZ1 significantly improved the high temperature tolerance as well as the high osmosis tolerance of the strains (Figs. 4, 6). Crz1p is a zinc finger TF, which regulates 14.6% of the genes in the genome of S. cerevisiae based on YEASTRACT database. The genes regulated by Crz1p are significantly enriched in pathways of carbohydrate metabolic process (GO: 0005975), cell wall organization or biogenesis (GO: 0071554), and transmembrane transport (GO: 0055085). CRZ1 has been reported able to enhance the resistance of S. cerevisiae to high concentrations of cations including Ca2+, Mn2+, Na+, and Li+ by regulating the genes of calcium signaling pathway [39]. Interestingly, in the present study, overexpression of CRZ1 increased not only high salt tolerance, but also high temperature and high glucose tolerance of the strains (Tables 1, 2). Though there are reports that regulation the genes involved in carbohydrate metabolic and cell wall synthesis could effectively improve the high temperature, high ethanol, or high osmosis stress tolerance of S. cerevisiae [23, 24, 40], the specific molecular regulation mechanism of Crz1p on multiple stress-tolerance should be clarified in the future.
Those strains over-expressing ENA5 showed much better ethanol production than the original strains when fermenting different raw materials. When high-temperature SSF and VHG fermentation were carried out with pretreated straw, molasses and cassava, the concentrations of ethanol produced by the engineered strains were significantly higher than those produced by the original strains and strains reported by most researchers (Fig. 7, Table 3) [13, 14, 41–47]. Considering the costs of materials, equipment, energy consumption and labor, the costs of ethanol production with straw, molasses and cassava are calculated to be about 0.60 US$, 0.62 US$, and 0.98 US$ per liter (average price of ethanol in the market is about 0.75 US$ per liter) [48–51]. Though the systematic assessments of changes of parameters including fermentation temperature, mash concentration, and ethanol concentration on the ethanol production cost when different feedstocks are used is needed. Several studies reported that if the fermentation temperature is increased by 1 °C and if the ethanol yield is increased by 10%, the cost of ethanol can be reduced by about 0.04 US$ per liter and 0.03 US$ per liter, respectively [51, 52]. This suggested that the strains engineered in the present study have good prospects for reducing ethanol production cost and hence have wide industrial applications.
Table 3.
Comparisons of ethanol concentrations of strains when different raw materials were fermented under stress conditions
Strains | Process (Solid content) | Temperature (℃) | Substrates | Ethanol concentration (g/L) | References |
---|---|---|---|---|---|
Cellulose materials | |||||
S. cerevisiae Angel Yeast | P-SSF (20%) | 39.0 | Corn stover | 59.80 | [41] |
S. cerevisiae TJ14 | P-SSF (/) | 39.0 | Microcrystalline cellulose | 45.00 | [42] |
K. marxianus NRRL Y-6860 | SSF (24%) | 41.5 | Rice straw | 52.30 | [43] |
KF-7 | P-SSF (20%) | 42.0 | Rice straw | 55.89 | This study |
KF-7-ENA5 | P-SSF (20%) | 42.0 | Rice straw | 63.35 | This study |
E-158 | P-SSF (20%) | 42.0 | Rice straw | 65.50 | This study |
E-158-ENA5 | P-SSF (20%) | 42.0 | Rice straw | 68.40 | This study |
Molasses | |||||
S. cerevisiae NCYC3233-27c | VHG (/) | 35.0 | Unpretreated molasses | 78.90 | [14] |
S. cerevisiae UAF-1 | VHG (270.0 g/L) | 32.0 | Acid pretreated molasses | 96.00 | [44] |
S. cerevisiae SFO6 | VHG (250.0 g/L) | 30.0 | Unpretreated molasses | 55.20 | [13] |
KF-7 | VHG (270.9 g/L) | 33.0 | Unpretreated molasses | 77.20 | This study |
KF-7-ENA5 | VHG (270.9 g/L) | 33.0 | Unpretreated molasses | 94.43 | This study |
E-158 | VHG (270.9 g/L) | 33.0 | Unpretreated molasses | 95.71 | This study |
E-158-ENA5 | VHG (270.9 g/L) | 33.0 | Unpretreated molasses | 98.28 | This study |
Cassava | |||||
S. cerevisiae CHY1011 | SSF (18%) | 32.0 | Cassava | 89.10 | [45] |
S. cerevisiae dry yeast | SSF (20%) | 30.0 | Cassava | 71.84 | [46] |
S. cerevisiae G2-3-2 | SSF (23%) | 30.0 | Cassava | 115.77 | [47] |
KF-7 | SSF (35%) | 33.0 | Cassava | 121.34 | This study |
KF-7-ENA5 | SSF (35%) | 33.0 | Cassava | 129.23 | This study |
E-158 | SSF (35%) | 33.0 | Cassava | 134.70 | This study |
E-158-ENA5 | SSF (35%) | 33.0 | Cassava | 138.43 | This study |
In the previous study, we obtained strain E-158 using KF-7 as the original strain by combined techniques including ARTP mutagenesis, genome shuffling and hybridization, which took a lot of time and labor [18]. However, in the present study, the key gene ENA5 mined by a comprehensive strategy was identified to successfully enhance multiple stresses. The engineered strain obtained by overexpression of ENA5 in KF-7 had similar fermentation results to E-158 under all five stress conditions (Tables 1, 2), suggesting the very high effectiveness of reverse metabolic engineering employed in the present study. Directly engineering the identified key target genes significantly reduced the time and labor. Therefore, such strategy is powerful to accumulate target gene information, which can be further adopted to support the construction of excellent industrial strains.
In addition to ENA5, other genes investigated in the present study that contributed to stress tolerance phenotype can be applied to obtain strains with specific stress tolerance or multiple stress-tolerant strains by simultaneously regulating the expression of more than one of them. The effect of ENA5 and other genes on the stress tolerance phenotypes can also be explored using S. cerevisiae strains with different genetic backgrounds, including xylose-fermenting S. cerevisiae strains, and even other microorganisms having industrial application potentials.
Conclusion
In this study, six novel genes including functional genes, genes of unknown function and genes encoding TFs, were found for the first time to be related to the multiple stress-tolerant phenotypes of industrial S. cerevisiae. Overexpression of gene ENA5 significantly improved the high ethanol, high temperature, high sugar, and high salt tolerance phenotypes of the original strain KF-7 and the resistant strain E-158. The fermentation performance of the engineered strains under stress conditions was much better than strains reported by most researchers. These findings provide new insights guiding the engineering of S. cerevisiae strains towards higher ethanol production in the presence of diverse environmental stresses.
Materials and methods
Strains, plasmids, primers, and media
All the strains and plasmids used and constructed in this study were listed in Table 4 [53, 54]. A flocculating industrial S. cerevisiae strain KF-7, which has good ethanol fermentation capacity and stress tolerance, was used as the original strain [55, 56]. The multiple stress-tolerant strain E-158 was obtained by mutagenesis and hybridization using KF-7 as the starting strain in our previous study [18]. Escherichia coli DH5α was used for gene cloning and manipulation. Primers and other DNA fragments used in this study were presented in Table 5 and Additional file 1: Table S6.
Table 4.
Plasmids and strains
Plasmids and strains | Description | References |
---|---|---|
Plasmids | ||
Cas9-NAT | Ampr; Cas9; NAT1 | [53] |
pMEL13 | Ampr; 2 μm origin, KanMX, gRNA-CAN1.Y | [54] |
pMEL13-CRZ1 | Ampr; 2 μm origin, KanMX, gRNA-CRZ1 | This study |
pMEL13-ENA5 | Ampr; 2 μm origin, KanMX, gRNA-ENA5 | This study |
pMEL13-ASP3 | Ampr; 2 μm origin, KanMX, gRNA-ASP3 | This study |
pMEL13-TOS8 | Ampr; 2 μm origin, KanMX, gRNA-TOS8 | This study |
pMEL13-YOL162W | Ampr; 2 μm origin, KanMX, gRNA-YOL162W | This study |
pMEL13-YOR012W | Ampr; 2 μm origin, KanMX, gRNA-YOR012W | This study |
Strains | ||
KF-7 | Flocculating diploid industrial Saccharomyces cerevisiae strain | [55] |
E-158 | KF-7; Random mutagenesis and hybridization | [18] |
KF-7-CRZ1 | KF-7; Replacement of promoter PCRZ1 to PTEF1 | This study |
KF-7-ENA5 | KF-7; Replacement of promoter PENA5 to PTEF1 | This study |
KF-7ΔASP3 | KF-7; Knockout ASP3 | This study |
KF-7ΔTOS8 | KF-7; Knockout TOS8 | This study |
KF-7ΔYOL162W | KF-7; Knockout YOL162W | This study |
KF-7ΔYOR012W | KF-7; Knockout YOR012W | This study |
E-158-CRZ1 | E-158; Replacement of promoter PCRZ1 to PTEF1 | This study |
E-158-ENA5 | E-158; Replacement of promoter PENA5 to PTEF1 | This study |
Table 5.
Target sequences used in yeast transformation
Target | Sequence | |
---|---|---|
gRNA insert | ||
tgR-F |
TGCGCATGTTTCGGCGTTCGAAACTTCTCCGCAGTGAAAGA TAAATGATC |
|
tgR-R |
GTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGC TCTAAAAC |
|
ENA5 | CS | GATAACGTATGTACTCACTGAGG |
CRZ1 | CS | GCAGAATGTCTACTACGTCGAGG |
ASP3 | CS | GCTACGGCATGGATCAGATTAGG |
TOS8 | CS | AGAAATTACATAATAACTGTAGG |
YOL162W | CS | AAGGTACAATGTTTAATAAATGG |
YOR012W | CS | TTGAAACTTTTTCAGTGATTGGG |
Repair fragment | ||
TEF1 | F | CACACACCATAGCTTCAAAATG |
R | TTTGTAATTAAAACT | |
ENA5 | RF F | CCTTCATCCTTTACATCGAGAATACGTTAACCAAATCAACCACACACCATAGCTTCAAAATG |
RF R | ATTCTTCATTATTGTTTTCTTTGACAGTTCCCTCGCTCATTTTGTAATTAAAACT | |
VP F | TTGTGAGGCTGATGTTTTCTTC | |
VP R | GCTTCTTCTGTAGTCAATGTGTGAT | |
CRZ1 | RF F | GGGCTGAAAAGTACATCCGCGCATTTAACAATTGCTAAGCCACACACCATAGCTTCAAAATG |
RF R | TAGTCATGTAGGAAGCCATATTTCCGTTGCTGAATGACATTTTGTAATTAAAACT | |
VP F | GCTTTGACTGCACTTTAGCTTAG | |
VP R | TTTCCGTTGCTGAATGACAT | |
ASP3 | RF F | AGAGCAAATGTTGGCTCGCTATTCTTTTGTAAGCAATCTGGTACTCACCAACCTCCAACTAGCCTGATCAGTGACTTTTCATCACACTGTGTTTTTATATAGTTCTTAGTAGTAAATATA |
RF R | TATATTTACTACTAAGAACTATATAAAAACACAGTGTGATGAAAAGTCACTGATCAGGCTAGTTGGAGGTTGGTGAGTACCAGATTGCTTACAAAAGAATAGCGAGCCAACATTTGCTCT | |
VP F | TATCAGACCCTTCAGCACGT | |
VP R | TGACACTGCTCAAGGGATAA | |
TOS8 | RF F | TTTTTCAGTATAGGAAGTAATCACTGTAGAAATAAGTCAACAATAATTGCATAGAAAAAATTTTACTTTTTTCGGAATTACCTAAAATGGGTTTACGGCATAGAAGATAGATAGATTAAG |
RF R | CTTAATCTATCTATCTTCTATGCCGTAAACCCATTTTAGGTAATTCCGAAAAAAGTAAAATTTTTTCTATGCAATTATTGTTGACTTATTTCTACAGTGATTACTTCCTATACTGAAAAA | |
VP F | GTTCCCTTGTTTTGAAGCAC | |
VP R | CGAAGATTCTCACCAAAGTT | |
YOL162W | RF F | ATGTCACTTAAAATGTTATGGCAGGGGATAACAGATTACTATATATAGCCTATCTACTTGACTATGTAGAAATATGGATACAATCTCCATGTTATGTATTTTTTAAGTTTGTGAATCATT |
RF R | AATGATTCACAAACTTAAAAAATACATAACATGGAGATTGTATCCATATTTCTACATAGTCAAGTAGATAGGCTATATATAGTAATCTGTTATCCCCTGCCATAACATTTTAAGTGACAT | |
VP F | CTAAGCAATCACCTAAACAT | |
VP R | GATGTCGTACTTCTACAGCT | |
YOR012W | RF F | GAAAAAGGCAGTGACAAAAATACTAATCAGAACGTTGAAAACAAATCAATAGTTTTGATACCATCCCGAAATTAGAGGTTCAGTCAGAAAAATACTCGAAAAATATAAAACCAAAGCAGA |
RF R | TCTGCTTTGGTTTTATATTTTTCGAGTATTTTTCTGACTGAACCTCTAATTTCGGGATGGTATCAAAACTATTGATTTGTTTTCAACGTTCTGATTAGTATTTTTGTCACTGCCTTTTTC | |
VP F | TGCCTCATAACGTCTTGGGG | |
VP R | GTAGGCCGTGAATCCCTTCC |
tgR-F: upstream homologous of gRNA; tgR-R: downstream homologous of gRNA; CS: complementary sequence; RF: repair fragment; Vp: verification primer; F: forward primer; R: reverse primer, “double underline” represent the PAM (NGG) site, “underline” represent homologous arm
YP medium (10 g/L yeast extract, 20 g/L peptone) containing 20 g/L glucose (YPD20) was used for cell growth. YP medium containing 150 g/L glucose (YPD150) and 8.0% (v/v) ethanol was used for ethanol-stress fermentation. YP medium containing 100 g/L glucose (YPD100) was used for heat-stress fermentation. YP medium containing 100 g/L glucose (YPD100) and 2.6% (v/v) ethanol was used for multiple-stress (ethanol and heat) fermentation. YP medium containing 270/280 g/L glucose (YPD270/280) was used for VHG-stress fermentation. YP medium containing 150 g/L glucose (YPD150) and 1.25/1.5 mol/L NaCl was used for salt-stress fermentation. YP medium containing 20 g/L glucose (YPD20), 20 g/L agar, 50 ng/mL nourseothricin (NAT), and 100 ng/mL geneticin (G418) was used for yeast transformation. LB medium (5 g/L yeast extract, 10 g/L peptone, and 10 g/L NaCl) supplemented with ampicillin (100 ng/mL) or kanamycin (100 ng/mL) was used for E. coli DH5α transformation.
Batch fermentations and RNA extraction
The media and methods of batch fermentations under five stress conditions: (1) 8.0% initial ethanol; (2) 44 °C; (3) 43 °C with 2.6% initial ethanol; (4) YPD270; (5) 1.25 M NaCl were described in our previous study [18]. Strains were pre-cultivated in 100 mL YPD50 for 16 h (500 mL flasks). The cells were then collected, washed, and inoculated into fermentation media (100 mL in 300 mL flasks) with an initial cell density of OD660 1.45–1.50. The flasks were incubated in thermostatic water bath, and the media was stirred (200 rpm/min) using magnetic stirrers. Broth samples were collected during fermentation and used for the analysis of the concentrations of glucose and ethanol. For each group, three replicated fermentation experiments were independently performed for the measurements.
To prepare RNA samples for transcriptomic sequencing, cells of E-158 and KF-7 were allowed to grow till logarithmic growth under five stress conditions: (1) 8.0% initial ethanol (48 h), (2) 44 °C (16 h), (3) 43 °C with 2.6% initial ethanol (12 h), (4) YPD270 (30 h), (5) 1.25 M NaCl (48 h). Then the cells were collected by centrifugation at 8000×g for 2 min. Total RNA was extracted from using Yeast RNA Kit (Omega Bio-Tek, USA). For each group, three replicated fermentation experiments were independently performed.
Transcriptomic data analysis
A total of 30 mRNA samples (KF-7 and E-158 each had three parallel samples under each stress condition) were sequenced using an Illumina Novaseq 6000 platform (Shanghai Majorbio Biopharm Technology Co. Ltd. (Shanghai, China)). Library construction was conducted using the Illumina Truseq™ RNA sample prep kit. The mRNA was separated from total RNA by A-T base pairing, and then was broken into small fragments of about 300 bp by the addition of fragmentation buffer. The cDNA was synthesized using mRNA as the template. The sticky ends of the double-stranded cDNA were blunt-ended with End Repair Mix, then an A-base was added to the 3′ end for the linker to the Y-line. The resulting fragments were subjected to Illumina Novaseq sequencing. The Clean Data of each sample reached more than 6.32 Gb.
Difference in gene expression levels of one gene between KF-7 and E-158 was quantified by an index, log2FC, representing the logarithm to base 2 of the ratio of the RNA reads number of the gene in E158 to that in KF7. If∣log2FC∣ ≥ 1 and P < 0.05, the expression of the related gene was defined to significantly change. These analyses were performed on the online platform called Majorbio Cloud Platform (www.majorbio.com). The shared DEGs under five stress conditions were visualized by Venn-diagram (http://jvenn.toulouse.inra.fr/app/example.html). Gene Ontology (GO) enrichment of the shared DEGs was carried out with online tools developed by Princeton University (http://go.princeton.edu/cgi-bin/GOTermMapper), in which P ≤ 0.001 and enrichment ratio ≥ 0.1 was set as the threshold. Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analysis of the shared DEGs was performed using the KEGG database (http://www.genome.jp/kegg/). The threshold was set to P ≤ 0.05 and enrichment ratio ≥ 0.1. The shared DEGs were searched in the YEASTRACT database (http://www.yeastract.com/formfindregulators.php) to find the potential TFs. The protein–protein interaction network of shared DEGs was analyzed and constructed using Cytoscape 3.7.2 software. The original sequencing data are accessed in the National Center for Biotechnology Information platform under accession number PRJNA642097.
Strains construction
CRISPR/Case9 gene-editing technology was used to over express or knock out the genes, and the experiments were performed according to Li et al. [37]. For gRNA plasmid construction, the linearized plasmid backbone and gRNA insertion fragments were assembled to form the guideRNA (gRNA) plasmid. The linearized plasmid backbone was PCR amplified from pMEL13 plasmid using primer 6005/6006 [54]. The gRNA insert (120 bp) was composed of upstream homologous arm (tgR-F, 50 bp), downstream homologous arm (tgR-R, 50 bp), and complementary sequence (20 bp). The sequences were synthesized in GENEWIZ (Suzhou, China). The complementary sequence of gRNA was located in the promoter region for overexpression of gene CRZ1 or ENA5 (Additional file 1: Fig. S2A), and the complementary sequences of gRNA were located in the coding sequence (CDS) region for knocking out genes ASP3, TOS8, YOL162W, or YOR012W (Additional file 1: Fig. S2B). The gRNA sequences were designed using the E-CRISP tool at http://www.e-crisp.org/E-CRISP/ (Table 5). The gRNA was integrated into the linearized backbone using Gibson assembly according to the manufacture’s manual of Gibson Assembly® Master Mix (New England Biolabs, Beverly, MA, USA). Each plasmid was transformed into E. coli DH5α. After sequencing, the plasmids containing correct inserts were subsequently used for transformation.
The strength of the promoter TEF1 (PTEF1, 420 bp) was high and relatively stable under five stress conditions (Additional file 1: Table S7). PTEF1 was used to replace the promoters of CRZ1 and ENA5. The repair fragment was amplified using KF-7 genome as template, and it contained upstream homologous arm, downstream homologous arm, and TEF1 sequence (Additional file 1: Fig. S2A). The repair fragments of ASP3, TOS8, YOL162W, and YOR012W were composed of upstream arm (60 bp) and downstream arm (60 bp) of the target gene CDS, which were synthesized in GENEWIZ (Suzhou, China) (Table 5, Additional file 1: Fig. S2B).
For yeast transformation, the lithium acetate method was used according to the protocol proposed by Finlayson et al. [57]. Cas9 plasmid was first transformed into KF-7 and E-158. The gRNA plasmid and repair fragment (PTEF1) were then transformed into the strains harboring Cas9 plasmid. Transformants grown on 2% YPD plate containing 0.005% NAT and 0.01% G418 were confirmed by PCR and Sanger sequencing. The removement of Cas9 and gRNA plasmids from the transformants were conducted according to Mans’ method [54]. The transformants were subjected to the following fermentation evaluation.
Evaluation of growth and fermentation performance of engineered strains
The growth of engineered strains under different stress conditions was evaluated using YPD20 agar medium. The engineered strains were pre-cultivated in YPD50 medium for 16 h to logarithmic growth phase, and the cells were harvested by centrifugation at 8000×g for 2 min at 4 °C. The cells were washed twice using sterilized water and re-suspended in sterilized 0.5 mol/L ethylenediaminetetraacetic acid disodium salt (EDTA-2Na) solution with a final OD660 of 1.0. The solution was then serially tenfold diluted. Aliquots of 2 μL were spotted on YPD20 agar medium containing 13% (v/v) ethanol, 400 g/L glucose, 3 mol/L sorbitol, and 2 mol/L NaCl. The plates were incubated at 30 °C for 72–120 h. To examine the growth at high temperature, the plates were incubated at 44 °C for 72 h.
The fermentation capacity under different stress conditions was evaluated using both YPD medium and three different raw materials. The method of fermentation using YPD medium was the same as described in Batch fermentation and RNA extraction. The compositions of the pretreated straw, molasses, and cassava used in fermentation were shown in Additional file 1: Tables S2, S3 and S4. The fermentation using the pretreated straw was performed by pre-saccharification and SSF at 42 °C. The solid content of pretreated straw was adjusted to 20% with PBS buffer solution (pH 5). CTec3 was added at a dosage of 20 FPU/g cellulose. The slurry was pre-saccharified for 8 h at 50 °C. The pre-saccharified slurry was inoculated with pre-cultivated fresh cells (0.5 g dry weight/kg slurry), and the SSF was conducted in a thermostat water bath for 96 h at 42 °C. The VHG fermentation using molasses was conducted at 33 °C. Diluted molasses (total sugar concentration of 270.91 g/L) was inoculated with pre-cultivated fresh cells (0.5 g dry weight/L), and the VHG fermentation was conducted in a thermostat water bath for 96 h at 33 °C. High solid SSF of cassava was performed at 33 °C. Cassava slurry with 35% solid content was gelatinized at 105 °C for 15 min. The resultant gelatinized slurry was liquefied at 95 °C for 2 h by α-amylase (10 U/g starch). After cooling to room temperature, glucoamylase (160 U/g starch), pectinase (20 U/g raw materials), cellulase (10 U/g raw materials), 1 g/L KH2PO4, 0.5 g/L CaCl2H2O, 0.5 g/L MgSO4.7H2O, and 1 g/L (NH2)2CO were added. Pre-cultivated fresh cells (0.5 g dry weight/kg slurry) were inoculated. SSF was conducted in a thermostat water bath for 96 h at 33 °C. All fermentation experiments were performed three times independently.
Analytical methods
Broth samples were diluted and filtered through 0.22 μm filters before analysis. The concentration of glucose was determined by HPLC (LC-10 ADVP, Shimadzu, Kyoto, Japan) at 25 °C, with a mobile phase of 5 mmol/L sulfuric acid at a flow rate of 0.6 mL/min. Ethanol concentration was determined using gas chromatography (GC 353B, GL Sciences, Kyoto, Japan) with an FID detector, and isopropanol was used as the internal standard. The data were expressed as the means with standard deviations. Variance analysis was conducted using Tukey-test with SPSS statistical package (SPSS Inc., Chicago, IL, USA). The level of statistical significance was set at P < 0.05.
Supplementary Information
Additional file 1. Additional Figures and Tables.
Acknowledgements
Not applicable.
Authors' contributions
LW: conceptualization, methodology, investigation, validation, and writing-original draft. BL: formal analysis and methodology. RS: formal analysis. SW: investigation and methodology. ZX: writing–review and editing. CX: supervision and software. YT: conceptualization, writing–review & editing, data curation, supervision and funding acquisition. All authors read and approved the final manuscript.
Funding
This work was supported by National Key R&D Program of China (2018YFA0902100 and 2018YFA0902102).
Availability of data and materials
The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request. The original RNA sequencing data can be accessed through the National Center for Biotechnology Information (https://www.ncbi.nlm.nih.gov/) under project accession no. PRJNA642097.
Declarations
Ethics approval and consent to participate
Not applicable.
Consent for publication
All the authors agreed for publication.
Competing interests
The authors declare that they have no competing interests.
Footnotes
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Contributor Information
Cai-Yun Xie, Email: xiecy@scu.edu.cn.
Yue-Qin Tang, Email: tangyq@scu.edu.cn.
References
- 1.Favaro L, Jansen T, van Zyl WH. Exploring industrial and natural Saccharomyces cerevisiae strains for the bio-based economy from biomass: the case of bioethanol. Crit Rev Biotechnol. 2019;39(6):800–816. doi: 10.1080/07388551.2019.1619157. [DOI] [PubMed] [Google Scholar]
- 2.Mat Aron NS, Khoo KS, Chew KW, Show PL, Chen WH, Nguyen THP. Sustainability of the four generations of biofuels—a review. Int J Energy Res. 2020;44(12):9266–9282. doi: 10.1002/er.5557. [DOI] [Google Scholar]
- 3.Ha-Tran DM, Nguyen TTM, Huang CC. Kluyveromyces marxianus: current state of omics studies, strain improvement strategy and potential industrial implementation. Fermentation. 2020;6:124. doi: 10.3390/fermentation6040124. [DOI] [Google Scholar]
- 4.Xia J, Yang YF, Liu CG, Yang SH, Bai FW. Engineering Zymomonas mobilis for robust cellulosic ethanol production. Trends Biotechnol. 2019;37(9):960–972. doi: 10.1016/j.tibtech.2019.02.002. [DOI] [PubMed] [Google Scholar]
- 5.Nosrati-Ghods N, Harrison STL, Isafiade AJ, Taia SL. Analysis of ethanol production from xylose using Pichia stipitis in microaerobic conditions through experimental observations and kinetic modelling. Biochem Eng J. 2020;164:107754. doi: 10.1016/j.bej.2020.107754. [DOI] [Google Scholar]
- 6.Benjamin B, Bakare DV, Effiong TE. Saccharomyces cerevisiae bio-ethanol production as an alternative source of sustainable energy ethanol production using Saccharomyces cerevisiae. Int J Res Appl Sci Biotechnol. 2020;7(6):190–194. doi: 10.31033/ijrasb.7.6.27. [DOI] [Google Scholar]
- 7.Akhtar N, Karnwal A, Upadhyay AK, Paul S, Mannan MA. Saccharomyces cerevisiae bio-ethanol production, a sustainable energy alternative. Asian J Microbiol Biotechnol Environ. Sci. 2018;20:S202–S206. [Google Scholar]
- 8.Jhariya U, Dafale NA, Srivastava S, Bhende RS, Kapley A, Purohit HJ. Understanding ethanol tolerance mechanism in Saccharomyces cerevisiae to enhance the bioethanol production: current and future prospects. BioEnergy Res. 2021;14:670–688. doi: 10.1007/s12155-020-10228-2. [DOI] [Google Scholar]
- 9.Khatun MM, Yu XS, Kondo A, Bai FW, Zhao XQ. Improved ethanol production at high temperature by consolidated bioprocessing using Saccharomyces cerevisiae strain engineered with artificial zinc finger protein. Bioresour Technol. 2017;245:1447–1454. doi: 10.1016/j.biortech.2017.05.088. [DOI] [PubMed] [Google Scholar]
- 10.Nogueira CD, Padilha CED, dos Santos ES. Enzymatic hydrolysis and simultaneous saccharification and fermentation of green coconut fiber under high concentrations of ethylene oxide-based polymers. Renew Energ. 2021;163:1536–1547. doi: 10.1016/j.renene.2020.10.050. [DOI] [Google Scholar]
- 11.Wu YD, Wang ZZ, Ma X, Xue C. High temperature simultaneous saccharification and fermentation of corn stover for efficient butanol production by a thermotolerant Clostridium acetobutylicum. Process Biochem. 2021;100:20–25. doi: 10.1016/j.procbio.2020.09.026. [DOI] [Google Scholar]
- 12.Liu JJ, Ding WT, Zhang GC, Wang JY. Improving ethanol fermentation performance of Saccharomyces cerevisiae in very high-gravity fermentation through chemical mutagenesis and meiotic recombination. Appl Microbiol Biotechnol. 2011;91(4):1239–1246. doi: 10.1007/s00253-011-3404-2. [DOI] [PubMed] [Google Scholar]
- 13.Faramarzi S, Anzabi Y, Jafarizadeh-Malmiri H. Selenium supplementation during fermentation with sugar beet molasses and Saccharomyces cerevisiae to increase bioethanol production. Green Process Synth. 2019;8(1):622–628. doi: 10.1515/gps-2019-0032. [DOI] [Google Scholar]
- 14.Inai T, Watanabe D, Zhou Y, Fukada R, Akao T, Shima J, Takagi H, Shimoi H. Rim15p-mediated regulation of sucrose utilization during molasses fermentation using Saccharomyces cerevisiae strain PE-2. J Biosci Bioeng. 2013;116(5):591–594. doi: 10.1016/j.jbiosc.2013.05.015. [DOI] [PubMed] [Google Scholar]
- 15.Chen YH, Zhang X, Zhang M, Zhu JY, Wu ZF, Zheng XJ. A transcriptome analysis of the ameliorate effect of Cyclocarya paliurus triterpenoids on ethanol stress in Saccharomyces cerevisiae. World J Microbiol Biotechnol. 2018;34(12):182. doi: 10.1007/s11274-018-2561-1. [DOI] [PubMed] [Google Scholar]
- 16.Xu K, Yu LP, Bai WX, Xiao B, Liu YQ, Lv B, Li J, Li C. Construction of thermo-tolerant yeast based on an artificial protein quality control system (APQC) to improve the production of bio-ethanol. Chem Eng Sci. 2018;177:410–416. doi: 10.1016/j.ces.2017.12.009. [DOI] [Google Scholar]
- 17.Qin L, Dong SX, Yu J, Ning XY, Xu K, Zhang SJ, Xu L, Li BZ, Li J, Yuan YJ, Li C. Stress-driven dynamic regulation of multiple tolerance genes improves robustness and productive capacity of Saccharomyces cerevisiae in industrial lignocellulose fermentation. Metab Eng. 2020;61:160–170. doi: 10.1016/j.ymben.2020.06.003. [DOI] [PubMed] [Google Scholar]
- 18.Wang L, Li B, Wang SP, Xia ZY, Gou M, Tang YQ. Improving multiple stress-tolerance of a flocculating industrial Saccharomyces cerevisiae strain by random mutagenesis and hybridization. Process Biochem. 2021;102:275–285. doi: 10.1016/j.procbio.2020.12.022. [DOI] [Google Scholar]
- 19.Zheng DQ, Wu XC, Tao XL, Wang PM, Li P, Chi XQ, Li YD, Yan QF, Zhao YH. Screening and construction of Saccharomyces cerevisiae strains with improved multi-tolerance and bioethanol fermentation performance. Bioresour Technol. 2011;102(3):3020–3027. doi: 10.1016/j.biortech.2010.09.122. [DOI] [PubMed] [Google Scholar]
- 20.Takagi H. Molecular mechanisms and highly functional development for stress tolerance of the yeast Saccharomyces cerevisiae. Biosci Biotech Bioch. 2021;85(5):1017–1037. doi: 10.1093/bbb/zbab022. [DOI] [PubMed] [Google Scholar]
- 21.Diniz RHS, Villada JC, Alvim MCT, Vidigal PMP, Vieira NM, Lamas-Maceiras M, Cerdan ME, Gonzalez-Siso MI, Lahtvee PJ, da Silveira WB. Transcriptome analysis of the thermotolerant yeast Kluyveromyces marxianus CCT 7735 under ethanol stress. Appl Microbiol Biotechnol. 2017;101(18):6969–6980. doi: 10.1007/s00253-017-8432-0. [DOI] [PubMed] [Google Scholar]
- 22.Saini P, Beniwal A, Kokkiligadda A, Vij S. Response and tolerance of yeast to changing environmental stress during ethanol fermentation. Process Biochem. 2018;72:1–12. doi: 10.1016/j.procbio.2018.07.001. [DOI] [Google Scholar]
- 23.Martinez-Alcántar L, Madrigal A, Sanchez-Briones L, Diaz-Perez AL, Lopez-Bucio JS, Campos-Garcia J. Over-expression of Isu1p and Jac1p increases the ethanol tolerance and yield by superoxide and iron homeostasis mechanism in an engineered Saccharomyces cerevisiae yeast. J Ind Microbiol Biotechnol. 2019;46(7):925–936. doi: 10.1007/s10295-019-02175-5. [DOI] [PubMed] [Google Scholar]
- 24.Li PS, Fu XF, Zhang L, Zhang ZY, Li JH, Li SZ. The transcription factors Hsf1 and Msn2 of thermotolerant Kluyveromyces marxianus promote cell growth and ethanol fermentation of Saccharomyces cerevisiae at high temperatures. Biotechnol Biofuels. 2017;10:289. doi: 10.1186/s13068-017-0984-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Yin NN, Zhu GX, Luo QL, Liu J, Chen XL, Liu LM. Engineering of membrane phospholipid component enhances salt stress tolerance in Saccharomyces cerevisiae. Biotechnol Bioeng. 2020;117(3):710–720. doi: 10.1002/bit.27244. [DOI] [PubMed] [Google Scholar]
- 26.Benito B, Garciadeblas B, Rodri G-N. Potassium- or sodium-efflux ATPase, a key enzyme in the evolution of fungi. Microbiology. 2002;148:933–941. doi: 10.1099/00221287-148-4-933. [DOI] [PubMed] [Google Scholar]
- 27.Hasunuma T, Sakamoto T, Kondo A. Inverse metabolic engineering based on transient acclimation of yeast improves acid-containing xylose fermentation and tolerance to formic and acetic acids. Appl Microbiol Biotechnol. 2016;100(2):1027–1038. doi: 10.1007/s00253-015-7094-z. [DOI] [PubMed] [Google Scholar]
- 28.Holt S, Kankipati H, De Graeve S, Van Zeebroeck G, Foulquie-Moreno MR, Lindgreen S, Thevelein JM. Major sulfonate transporter Soa1 in Saccharomyces cerevisiae and considerable substrate diversity in its fungal family. Nat Commun. 2017;8:14247. doi: 10.1038/ncomms14247. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Son H, Park AR, Lim JY, Lee YW. Fss1 is involved in the regulation of an ENA5 homologue for sodium and lithium tolerance in Fusarium graminearum. Environ Microbiol. 2015;17(6):2048–2063. doi: 10.1111/1462-2920.12757. [DOI] [PubMed] [Google Scholar]
- 30.Platara M, Ruiz A, Serrano R, Palomino A, Moreno F, Arino J. The transcriptional response of the yeast Na+-ATPase ENA1 gene to alkaline stress involves three main signaling pathways. J Biol Chem. 2006;281(48):36632–36642. doi: 10.1074/jbc.M606483200. [DOI] [PubMed] [Google Scholar]
- 31.Oba T, Suenaga H, Muta S, Tashiro K, Kuhara S. Properties of a sucrose-tolerant mutant of Saccharomyces cerevisiae. World J Microbiol Biotechnol. 2008;24:1233–1238. doi: 10.1007/s11274-007-9576-3. [DOI] [Google Scholar]
- 32.League GP, Slot JC, Rokas A. The ASP3 locus in Saccharomyces cerevisiae originated by horizontal gene transfer from Wickerhamomyces. FEMS Yeast Res. 2012;12(7):859–863. doi: 10.1111/j.1567-1364.2012.00828.x. [DOI] [PubMed] [Google Scholar]
- 33.Oliveira EMM, Martins AS, Carvajal E, Bon EPS. The role of the GATA factors Gln3p, Nil1p, Dal80p and the Ure2p on ASP3 regulation in Saccharomyces cerevisiae. Yeast. 2003;20(1):31–37. doi: 10.1002/yea.930. [DOI] [PubMed] [Google Scholar]
- 34.Liu H, Marsafari M, Deng L, Xu P. Understanding lipogenesis by dynamically profiling transcriptional activity of lipogenic promoters in Yarrowia lipolytica. Appl Microbiol Biotechnol. 2019;103(7):3167–3179. doi: 10.1007/s00253-019-09664-8. [DOI] [PubMed] [Google Scholar]
- 35.Koch M, Doello S, Gutekunst K, Forchhammer K. PHB is produced from glycogen turn-over during nitrogen starvation in Synechocystis sp. PCC 6803. Int J Mol Sci. 2019;20(8):1942. doi: 10.3390/ijms20081942. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Li B, Xie CY, Yang BX, Gou M, Xia ZY, Sun ZY, Tang YQ. The response mechanisms of industrial Saccharomyces cerevisiae to acetic acid and formic acid during mixed glucose and xylose fermentation. Process Biochem. 2020;91:319–329. doi: 10.1016/j.procbio.2020.01.002. [DOI] [Google Scholar]
- 37.Li B, Wang L, Wu YJ, Xia ZY, Yang BX, Tang YQ. Improving acetic acid and furfural resistance of xylose-fermenting Saccharomyces cerevisiae strains by regulating novel transcription factors revealed via comparative transcriptomic analysis. Appl Environ Microbiol. 2021;87(10):e00158–e1121. doi: 10.1128/AEM.00158-21. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Byrne KP, Wolfe KH. The yeast gene order browser: combining curated homology and syntenic context reveals gene fate in polyploid species. Genome Res. 2005;15(10):1456–1461. doi: 10.1101/gr.3672305. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Panadero J, Hernandez-Lopez MJ, Prieto JA, Randez-Gil F. Overexpression of the calcineurin target CRZ1 provides freeze tolerance and enhances the fermentative capacity of baker's yeast. Appl Environ Microbiol. 2007;73(15):4824–4831. doi: 10.1128/AEM.02651-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Chen Y, Lu ZL, Chen D, Wei YT, Chen XL, Huang J, Guan N, Lu Q, Wu RZ, Huang R. Transcriptomic analysis and driver mutant prioritization for differentially expressed genes from a Saccharomyces cerevisiae strain with high glucose tolerance generated by UV irradiation. RSC Adv. 2017;7:38784–38797. doi: 10.1039/c7ra06146c. [DOI] [Google Scholar]
- 41.Liu ZH, Qin L, Zhu JQ, Li BZ, Yuan YJ. Simultaneous saccharification and fermentation of steam-exploded corn stover at high glucan loading and high temperature. Biotechnol Biofuels. 2014;7:167–183. doi: 10.1186/s13068-014-0167-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Shahsavarani H, Hasegawa D, Yokota D, Sugiyama M, Kaneko Y, Boonchird C, Harashima S. Enhanced bio-ethanol production from cellulosic materials by semi-simultaneous saccharification and fermentation using high temperature resistant Saccharomyces cerevisiae TJ14. J Biosci Bioeng. 2013;115(1):20–23. doi: 10.1016/j.jbiosc.2012.07.018. [DOI] [PubMed] [Google Scholar]
- 43.Roberto IC, Castro RCA, Silva JPA, Mussatto SI. Ethanol production from high solid loading of rice straw by simultaneous saccharification and fermentation in a non-conventional reactor. Energies. 2020;13(8):1–17. doi: 10.3390/en13082090. [DOI] [Google Scholar]
- 44.Arshad M, Hussain T, Iqbal M, Abbas M. Enhanced ethanol production at commercial scale from molasses using high gravity technology by mutant S. cerevisiae. Braz J Microbiol. 2017;48(3):403–409. doi: 10.1016/j.bjm.2017.02.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Choi G-W, Um H-J, Kim Y, Kang HW, Kim M, Chung BW, Kim YH. Isolation and characterization of two soil derived yeasts for bioethanol production on cassava starch. Biomass Bioenergy. 2010;34(8):1223–1231. doi: 10.1016/j.biombioe.2010.03.019. [DOI] [Google Scholar]
- 46.Jos B, Kumoro AC. Production of bioethanol from sweet and bitter cassava starches by simultaneous saccharification and fermentation using Saccharomyces cerevisiae. Adv Sci Lett. 2017;23(3):2427–2431. doi: 10.1166/asl.2017.8682. [DOI] [Google Scholar]
- 47.Palasak T, Sooksai S, Savarajara A. Comparison of yeast extract prepared by autolysis or steam explosion as a cheap nutrient supplement for very high gravity ethanol fermentation of cassava starch. ScienceAsia. 2019;45(1):3–9. doi: 10.2306/scienceasia1513-1874.2019.45.003. [DOI] [Google Scholar]
- 48.Ranganathan P. Preliminary techno-economic evaluation of 2G ethanol production with co-products from rice straw. Biomass Convers Biorefin. 2020 doi: 10.1007/s13399-020-01144-8. [DOI] [Google Scholar]
- 49.Aui A, Wang Y, Mba-Wright M. Evaluating the economic feasibility of cellulosic ethanol: a meta-analysis of techno-economic analysis studies. Renew Sustain Energy Rev. 2021;145:111098. doi: 10.1016/j.rser.2021.111098. [DOI] [Google Scholar]
- 50.Arshad M, Abbas M, Iqbal M. Ethanol production from molasses: environmental and socioeconomic prospects in Pakistan: feasibility and economic analysis. Environ Technol Innovation. 2019;14:100317. doi: 10.1016/j.eti.2019.100317. [DOI] [Google Scholar]
- 51.Quintero JA, Cardona CA, Felix E, Moncada J, Higuita JC. Techno-economic analysis of fuel ethanol production from cassava in Africa: the case of Tanzania. Afr J Biotechnol. 2015;14(45):3082–3092. doi: 10.5897/AJB2013.13239. [DOI] [Google Scholar]
- 52.Tao L, Schell D, Davis R, Tan E, Elander R, Bratis A. NREL 2012 achievement of ethanol cost targets: biochemical ethanol fermentation via dilute-acid pretreatment and enzymatic hydrolysis of corn stover. Inorganic organic physical & analytical chemistry. 2014; NREL/TP-5100–61563. 10.2172/1129271.
- 53.Zhang GC, Kong II, Kim H, Liu JJ, Cate JHD, Jin YS. Construction of a quadruple auxotrophic mutant of an industrial polyploid Saccharomyces cerevisiae strain by using RNA-Guided Cas9 nuclease. Appl Environ Microbiol. 2014;80:7694–7701. doi: 10.1128/AEM.02310-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 54.Mans R, van Rossum HM, Wijsman M, Backx A, Kuijpers NG, van den Broek M, Daran-Lapujade P, Pronk JT, van Maris AJ, Daran JM. CRISPR/Cas9: a molecular Swiss army knife for simultaneous introduction of multiple genetic modifications in Saccharomyces cerevisiae. FEMS Yeast Res. 2015;15:1–15. doi: 10.1093/femsyr/fov004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 55.Kida K, Kume K, Morimura S, Sonoda Y. Repeated-batch fermentation process using a thermotolerant flocculating yeast constructed by protoplast fusion. J Ferment Bioeng. 1992;74(3):169–173. doi: 10.1016/0922-338X(92)90078-9. [DOI] [Google Scholar]
- 56.Tang YQ, An MZ, Zhong YL, Shigeru M, Wu XL, Kida K. Continuous ethanol fermentation from non-sulfuric acid-washed molasses using traditional stirred tank reactors and the flocculating yeast strain KF-7. J Biosci Bioeng. 2010;109(1):41–46. doi: 10.1016/j.jbiosc.2009.07.002. [DOI] [PubMed] [Google Scholar]
- 57.Finlayson SD, Fleming C, Berry DR, Johnston JR. An improved lithium-acetate method for yeast transformation. Biotechnol Tech. 1991;5(1):13–18. doi: 10.1007/BF00152747. [DOI] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Additional file 1. Additional Figures and Tables.
Data Availability Statement
The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request. The original RNA sequencing data can be accessed through the National Center for Biotechnology Information (https://www.ncbi.nlm.nih.gov/) under project accession no. PRJNA642097.