ABSTRACT
Cupriavidus necator H16 is an ideal strain for polyhydroxybutyrate (PHB) production from CO2. Low-oxygen stress can induce PHB synthesis in C. necator H16 while reducing bacterial growth under chemoautotrophic culture. The optimum growth and PHB synthesis of C. necator H16 cannot be achieved simultaneously, which restricts PHB production. The present study was initiated to address the issue through comparative transcriptome and gene function analysis. First, the comparative transcriptome of C. necator H16 chemoautotrophically cultured under low-oxygen stress and nonstress conditions was studied. Three types of genes were discovered to have differential levels of transcription: those involving PHB enzymatic synthesis, PHB granulation, and regulators. Under low-oxygen stress conditions, acetoacetyl-coenzyme A (CoA) reductase gene phaB2, PHB synthase gene phaC2, phasins genes phaP1 and phaP2, and regulator genes uspA and rpoN were upregulated 3.0-, 2.5-, 1.8-, 2.7-, 3.5-, and 1.6-fold, respectively. Second, the functions of upregulated genes and their applications in PHB synthesis were further studied. It was found that the overexpression of phaP1, phaP2, uspA, and rpoN can induce PHB synthesis under nonstress conditions, while phaB2 and phaC2 have no significant effect. Under the optimum conditions, the PHB percentage content in C. necator H16 was increased by 37.2%, 28.4%, 15.8%, and 41.0%, respectively, with overexpression of phaP1, phaP2, uspA, and rpoN, and the corresponding PHB production increased by 49.8%, 42.9%, 47.0%, and 77.5%, respectively, under nonstress chemoautotrophic conditions. Similar promotion by phaP1, phaP2, uspA, and rpoN was observed in heterotrophically cultured C. necator H16. The PHB percentage content and PHB production were increased by 54.4% and 103.1%, respectively, with the overexpression of rpoN under nonstress heterotrophic conditions.
IMPORTANCE Microbial fixation of CO2 is an effective way to reduce greenhouse gases. Some microbes, such as C. necator H16, usually accumulate PHB when they grow under stress. Low-oxygen stress can induce PHB synthesis when C. necator H16 is autotrophically cultured with CO2, H2, and O2, while under stress, growth is restricted, and total PHB yield is reduced. Achieving the optimal bacterial growth and PHB synthesis at the same time is an ideal condition for transforming CO2 into PHB by C. necator H16. The present study was initiated to clarify the molecular basis of low-oxygen stress promoting PHB accumulation and to realize the optimal PHB production by C. necator H16. Genes upregulated under nonstress conditions were identified through comparative transcriptome analysis and overexpression of phasin, and regulator genes were demonstrated to promote PHB synthesis in C. necator H16.
KEYWORDS: Cupriavidus necator H16, CO2 fixation, PHB granulation, regulators, transcriptomics
INTRODUCTION
Plastic, one of the most widely used materials in the world, is mainly made from petroleum, coal, or natural gas. With the shortage of petrochemical resources and the intensification of plastic pollution, the development and utilization of bioplastics have become a focus of current research and industry. Polyhydroxyalkanoate (PHA), a biopolymer with excellent material properties, is considered to be an alternative to conventional plastics due to its biodegradability (1). Polyhydroxybutyrate (PHB) is the most common polymer of PHA, usually accumulated by bacteria under stress (2). At present, PHB is one of the most studied biopolymers and is widely used in many fields. As medical material, PHB can be used to regenerate bone tissue and manufacture biodegradable heart stents or heart valve prostheses, drug carrier materials, etc. (3–5). PHB is mainly synthesized through biological fermentation, while its high cost restricts its wide application.
Cupriavidus necator H16 is one of the highly efficient strains for PHB synthesis, which is a soil-dwelling, Gram-negative, rod-shaped, facultative chemoautotrophic and hydrogen-oxidizing bacterium. The strain is capable to grow rapidly on a wide range of substrates and to thereby produce PHB (6, 7). C. necator can utilize CO2 as the only carbon source and H2 as an energy source for cell growth and PHB production. Therefore, the physiological characteristics of C. necator H16 make it possible to convert the greenhouse gas CO2 into the degradable plastic PHB.
As a storage compound for carbon and energy, PHB in C. necator H16 can accumulate up to 90% of dry cell weight (DCW) under certain conditions (8). PHB can be accumulated in large quantities when C. necator H16 is cultured under stress, such as the limiting supply of specific nutrients, while the stress will reduce the growth rate of bacteria, resulting in lesser bacterial biomass (9). Since PHB is an intracellular polymer, the biomass of bacterial fermentation is critical to PHB production (10). This makes it impossible to achieve PHB synthesis during the optimal growth of C. necator H16 and also reduces its production efficiency.
To solve this issue and realize the efficient synthesis of PHB, two methods were used in previous studies (11–14). One method is two-stage culture, i.e., bacterial biomass was accumulated in the first stage, and PHB was synthesized in the second stage (11, 12). The other method was to promote bacterial growth by optimizing fermentation parameters such as increasing the stirring speed, while the energy consumption was increased, and the growth rate of C. necator H16 still could not reach that of nonstress conditions (13, 14). Therefore, it is necessary to develop a method to accumulate a large amount of PHB under the optimum growth of C. necator H16 and realize the efficient synthesis of PHB. Understanding of the molecular mechanism that induces PHB synthesis under stress will help to develop strains capable of synthesizing PHB efficiently. Transcription of genes involved in PHB synthesis in C. necator H16 under nitrogen stress had been studied previously (14, 15), while the results have not been applied in PHB synthesis. It has been found that PHB accumulation in C. necator H16 induced by oxygen stress was stronger than that of nitrogen stress (2), while transcription of genes under oxygen stress has not been studied yet.
Low-oxygen stress can promote the synthesis of PHB in C. necator H16, while bacterial growth will also be restricted under this condition. The present work was initiated to study the molecular basis of low-oxygen stress inducing PHB synthesis in C. necator H16 under chemoautotrophic conditions and to explore the application in PHB production. Here, we performed comparative transcriptomic analysis between C. necator H16 chemoautotrophically cultured under low-oxygen stress and nonstress conditions and verified the function of upregulated genes in PHB synthesis. Based on the comparative transcriptome and speculated molecular basis, the metabolically engineered C. necator strain was constructed to achieve efficient PHB synthesis under nonstress conditions. This study not only deepened our understanding of the molecular basis of low-oxygen stress promoting PHB synthesis but also provided a new strategy for the efficient synthesis of PHB by C. necator H16.
RESULTS
Growth of C. necator H16 under low-oxygen stress and nonstress chemoautotrophic conditions and PHB accumulation.
To study the effect of O2 concentration on PHB production, C. necator H16 was chemoautotrophically cultured under O2 concentration of 15% (vol/vol) and 3% (vol/vol), respectively. Figure 1 shows the growth and PHB accumulation of C. necator H16 under different conditions after culture for 72 h. More bacterial biomass was obtained under nonstress conditions, while the PHB percentage content in cells was lower than that under low-oxygen stress. Similar results have been reported in previous studies (2, 16–18). A significant difference in PHB percentage content of C. necator H16 was observed between the low-oxygen stress (41.3% PHB) and nonstress conditions (20.6% PHB). The comparative transcriptome was further applied to study the molecular basis that low-oxygen stress promotes the PHB accumulation in C. necator H16.
FIG 1.
Performance of C. necator H16 chemoautotrophically cultured with different O2 concentrations. The wild-type C. necator H16 was chemoautotrophically cultured under low-oxygen stress (3% O2) and nonstress (15% O2) conditions at 30°C for 72 h. The growth curve (a), dry cell weight (DCW), PHB production, and PHB percentage content (b) were determined. Error bars indicate the standard deviation of three independent biological replicates in each group.
Analysis of genes related to PHB production in C. necator H16 under chemoautotrophic conditions through comparative transcriptome.
PHB production in C. necator H16 mainly includes two steps, the synthesis of PHB polymer and the following PHB granulation (6, 19–21). The enzymes and regulators related to PHB synthesis have been reported previously (22–24). The comparative transcription of genes involved in PHB synthesis under low-oxygen stress and nonstress conditions is shown in Fig. 2 and Table 1. Transcription differences were observed for three kinds of genes, i.e., genes involving enzymatic synthesis of PHB, PHB granulation, and regulators.
FIG 2.
Comparative transcriptome of C. necator H16 chemoautotrophically cultured with different O2 concentrations. (a) Schematic of PHB synthetic pathway and partial transcriptional regulators in C. necator H16. (b) Heatmap of the comparative transcriptome of genes for PHB enzymatic synthesis, PHB granulation, and regulators in C. necator H16 cultured with different O2 concentrations. Transcriptome results were determined in wild-type C. necator H16, which were chemoautotrophic cultured under low-oxygen stress (3% O2) and nonstress (15% O2) conditions at 30°C for 72 h. Acetyl-CoA acetyltransferase was encoded by phaA, bktB, and H16_A1070. Acetoacetyl-CoA reductase was encoded by phaB1, phaB2, and phaB3. PHB synthase was encoded by phaC1 and phaC2. Phasins were encoded by phaP1-P7, phaR, and phaM. Universal stress protein A, sigma 54 (RpoN) modulation protein, (p)ppGpp synthase/hydrolase, and (p)ppGpp synthase were encoded by uspA, rpoN, spoT1, and spoT2, respectively. The RPKM value of each gene was logarithm base e to make a heat map.
TABLE 1.
Transcriptional levels for genes of enzymes (protein) involved in PHB synthesis under low-oxygen stress (3% O2) and nonstress (15% O2) conditionsa
| Enzyme type | Gene name | Gene ID | 3% O2 RPKM | 15% O2 RPKM | Fold |
|---|---|---|---|---|---|
| Acetyl-CoA acetyltransferase | phaA | H16_A1438 | 1,723.0 | 2,129.3 | −0.3 |
| bktB | H16_A1445 | 337.0 | 603.5 | −0.8 | |
| H16_A1070 | 65.8 | 116.9 | −0.8 | ||
| Acetoacetyl-CoA reductase | phaB1 | H16_A1439 | 2,239.4 | 2,544.9 | −0.2 |
| phaB2 | H16_A2002 | 266.3 | 32.7 | 3.0 | |
| phaB3 | H16_A2171 | 9.0 | 25.2 | −1.5 | |
| Poly(3-hydroxybutyrate) polymerase | phaC1 | H16_A1437 | 1,575.4 | 1,342.1 | 0.2 |
| phaC2 | H16_A2003 | 124.0 | 21.8 | 2.5 | |
| Transcriptional regulator of phasin expression | phaR | H16_A1440 | 362.3 | 268.3 | 0.4 |
| Phasin (PHB-granule associated protein) | phaP1 | H16_A1381 | 19,829.2 | 5,550.1 | 1.8 |
| phaP2 | PHG202 | 3,199.6 | 487.9 | 2.7 | |
| phaP3 | H16_A2172 | 12.3 | 23.6 | −0.9 | |
| phaP4 | H16_A2021 | 58.8 | 143.9 | −1.3 | |
| phaP5 | H16_B1934 | 181.1 | 377.6 | −1.1 | |
| phaP6 | H16_B1988 | 8.6 | 11.5 | −0.4 | |
| phaP7 | H16_B2326 | 64.2 | 88.7 | −0.5 | |
| phaM | H16_A0141 | 85.6 | 225.3 | −1.4 | |
| Sigma 54 (RpoN) modulation protein | rpoN | H16_A0386 | 14,666.4 | 5,359.8 | 1.6 |
| Universal stress protein A | uspA | H16_A2220 | 19,428.4 | 1,708.9 | 3.5 |
| (p)ppGpp synthase/hydrolase | spoT1 | H16_A0955 | 255.6 | 561.6 | −1.1 |
| (p)ppGpp synthase | spoT2 | H16_A1337 | 28.5 | 164.3 | −2.5 |
In the comparative transcriptome analysis, the cells grown under low-oxygen stress (3% O2) were taken as the experimental group and nonstress (15% O2) conditions as the control group. Negative numbers represent downregulation and positive numbers represent upregulation. The differentially expressed genes (DEGs) were identified when false-discovery rate (FDR) was ≤0.001 and RPKM log2 ratio was ≥|1|.
In C. necator H16, acetyl-CoA is converted into a PHB polymer by the sequential catalysis of acetyl-CoA acetyltransferase, acetoacetyl-CoA reductase, and PHB synthase (6, 20). The genes phaA, bktB, and H16_A1070 encode acetyl-CoA acetyltransferase, phaB1 encodes acetoacetyl-CoA reductase, and phaC1 encodes PHB synthase, while there was no significant difference in the transcription of the above genes under the two conditions. The phaC1AB1 operon containing phaA, phaB1, and phaC1 is mainly responsible for catalyzing PHB synthesis in C. necator H16 (6, 20). In addition to the phaC1AB1 operon, other genes encoding PHB synthase were also found in the genome, such as the putative acetoacetyl-CoA reductase-encoding genes phaB2 and phaB3 and the putative PHB synthase gene phaC2. The transcription of phaB2 and phaC2 upregulated 3.0- and 2.5-fold, respectively, when C. necator H16 was cultured under low-oxygen stress. While the transcription of phaB3 downregulated 1.5-fold under low-oxygen stress, the reads per kilobase per million (RPKM) values were 9.0 and 25.2 under low-oxygen stress and nonstress conditions, respectively. The results suggested that the non-phaC1AB1-encoded enzymes of acetoacetyl-CoA reductase and PHB synthase might contribute to the PHB accumulation under low-oxygen stress.
PHB exists in the form of granules in C. necator H16, and the surface of the polymer is usually coated with phasins (PhaP) (25). To date, seven kinds of PhaPs (PhaP1 to PhaP7) and a PhaM protein on the surface of PHB polymer have been discovered, while their specific functions are different (6, 26–28). In addition, PhaR, a protein regulating the expression of PhaP, was also identified to bind to the surface of PHB granule (25, 29). In this study, the transcription of genes phaP1 and phaP2 was upregulated 1.8- and 2.7-fold, respectively, under low-oxygen stress. Under low-oxygen stress, the RPKM values of phaP1 were the third highest among all genes. Moreover, phaP4, phaP5, and phaM were downregulated 1.3-, 1.1-, and 1.4-fold, respectively, under low-oxygen stress. However, these genes exhibited low expression (RPKM value) under both low-oxygen stress and nonstress conditions. The transcription differences of the phasin genes and other coating proteins might be related to PHB formation difference under the two conditions.
Besides the enzymes of PHB synthesis and coating proteins for PHB granule, regulatory factors also play a key role in the formation of PHB. In C. necator H16, both regulators and enzymes have been identified to affect the intracellular PHB accumulation under stress (22–24). Under low-oxygen stress, the two regulators uspA and rpoN showed the highest transcription level and were upregulated 3.5- and 1.6-fold, respectively. In contrast, spoT1-encoding (p)ppGpp synthase/hydrolase and spoT2-encoding (p)ppGpp synthase downregulated 1.1- and 2.5-fold, respectively. However, previous studies have found that the two enzymes can affect the growth of C. necator H16 and PHB synthesis under nitrogen stress by regulating the concentration of intracellular alarmones (22, 23).
The comparative transcriptome results suggested that the expression of enzymes/proteins for PHB enzymatic synthesis, granulation, and regulatory factors in C. necator H16 has changed under low-oxygen stress. The transcription of phaB2, phaC2, phaP1, phaP2, uspA, and rpoN has upregulated significantly, which revealed the molecular basis of low-oxygen stress promoting PHB synthesis to a certain extent. Low-oxygen stress promoting PHB accumulation and its molecular basis provide references for constructing metabolically engineered C. necator H16 and realizing the efficient synthesis of PHB under nonstress conditions.
Functional analysis and verification of the upregulated genes in C. necator H16 under low-oxygen stress.
According to the comparative transcriptome, of the genes of phaB2, phaC2, phaP1, phaP2, uspA, and rpoN were significantly upregulated under low-oxygen stress. These six genes belong to three steps of PHB synthesis, phaB2 and phaC2 are related to the synthesis of PHB polymers, phaP1 and phaP2 are related to the granulation of PHB, and uspA and rpoN are related to the regulation of PHB production. Therefore, the six genes were first overexpressed separately to study the effects of these enzymes, proteins, and regulators on PHB synthesis in C. necator H16.
The schematic of strategy for the functional verification and potential applications of the six proteins is shown in Fig. 3. The arabinose-inducible promoter PBAD was selected in overexpression, the expression intensity and period of which can be controlled by induction. In this study, 0.4% (wt/vol) arabinose was first used to induce the expression of these six genes in C. necator H16 under chemoautotrophic culture (CO2, O2, H2). The DCW and PHB percentage content of the recombinant strains are shown in Fig. 4. The results showed that there was no significant difference in DCW between the arabinose-induced and uninduced strains under nonstress conditions (O2, 15% [vol/vol]), while PHB percentage content was decreased significantly in the arabinose-induced expression of Reh(phaP1), Reh(phaP2), Reh(uspA), and Reh(rpoN), which was ∼6.6% to 9.4% lower than that of the uninduced strains. This suggests that, under nonstress conditions, PHB production was inhibited when large amounts of phaP1, phaP2, uspA, and rpoN were overexpressed. Moreover, PHB percentage content has not changed significantly with or without the induction of Reh(B2-C2) and Reh(BAD), which indicated that PHB production was not affected by the overexpression of phaB2-phaC2. In C. necator H16, it has been reported that the excessive concentration of phasins has a negative effect on PHB production (25, 30, 31). It suggests that the concentration of 0.4% arabinose was not suitable for inducing PHB production in C. necator H16. Therefore, reducing the expression intensity of PhaP by decreasing the induction concentration of arabinose might be able to promote the synthesis of PHB. On the other hand, the reason for these performances might be because of a competition between PHB and protein synthesis. Previous studies had also shown that inappropriate overexpression of genes had negative effects on bacterial growth and product synthesis (32–34). In this case, it is necessary to adjust the overexpression intensity of genes to maintain the balance between bacterial growth and PHB synthesis. Therefore, the effect of these upregulated genes on strain growth and PHB production was further tested by adjusting the genes’ overexpression level.
FIG 3.
Functional analysis of upregulated genes, construction of overexpression plasmids, and fermentation process optimization of metabolically engineered C. necator H16. (a) Screening results of upregulated genes involved in PHB production under low-oxygen stress. (b) Plasmid map of p2BBAD as plasmid backbone for overexpression. (c) Schematic of recombinant plasmids for overexpression. (d) Fermentation performance of metabolically engineered strains under different induction intensity, induction time, and carbon source conditions. Gene phaB2 encoded acetoacetyl-CoA reductase. Gene phaC2 encoded PHB synthase. phaP1 and phaP2 encoded phasins. Gene uspA encoded universal stress protein A. Gene rpoN encoded sigma 54 (RpoN) modulation protein. All plasmids were constructed based on pBBR1MCS2. The 0.4%, 0.04%, and 0.004% arabinose concentrations represent 4,000 mg/liter, 400 mg/liter, and 40 mg/liter of arabinose, respectively. Induction time indicates the time when arabinose is added. All strains were cultured under nonstress (15% O2) conditions at 30°C for 72 h.
FIG 4.
Dry cell weight (DCW), PHB production, and PHB percentage content of metabolically engineered C. necator H16 induced by 0.4% arabinose. DCW, PHB production, and PHB percentage content were determined in recombinant strains Reh(B2-C2), Reh(phaP1), Reh(phaP2), Reh(uspA), Reh(rpoN), and Reh(BAD), which were chemoautotrophically cultured without and with 0.4% l-arabinose induction under nonstress (15% O2) conditions at 30°C for 72 h. Arabinose was added at the beginning of culture. Reh(B2-C2) is the wild-type C. necator H16 harboring the plasmid p2BBAD-phaB2-phaC2, Reh(phaP1) is the wild-type C. necator H16 harboring the plasmid p2BBAD-phaP1, Reh(phaP2) is the wild-type C. necator H16 with the plasmid p2BBAD-phaP2, Reh(uspA) is the wild-type C. necator H16 harboring the plasmid p2BBAD-uspA, Reh(rpoN) is the wild-type C. necator H16 harboring the plasmid p2BBAD-rpoN, and Reh(BAD) is the wild-type C. necator H16 harboring the plasmid p2BBAD. Error bars indicate the standard deviation of three independent biological replicates in each group.
Optimization of the inducible expression of upregulated genes in C. necator H16 under chemoautotrophic conditions.
To achieve the maximum promotion of the transcriptional upregulated genes on PHB synthesis, the arabinose induction for the recombinant expression of which was further optimized. Arabinose, with a concentration of 0.04% and 0.004%, was used to induce the overexpression of these six genes in C. necator H16 under chemoautotrophic conditions, and the results of DCW and PHB percentage content are shown in Fig. 5 and Table 2. Three kinds of results were observed for the metabolically engineered C. necator H16 chemoautotrophically cultured under nonstress conditions as follows. (i) The DCW and PHB percentage contents of Reh(B2-C2) and Reh(phaP2) were not promoted compared with the control strain under the two arabinose-inducing concentrations of 0.04% and 0.004%. (ii) The DCW and PHB percentage contents of Reh(phaP1) and Reh(uspA) were not promoted at the arabinose concentration of 0.04% but were promoted when arabinose was 0.004%. Compared with the uninduced strains, the DCW of Reh(PhaP1) and Reh(uspA) induced by 0.004% arabinose increased by 9.2% and 26.9%, the PHB percentage content increased by 37.3% and 15.8%, and the corresponding PHB production increased by 49.9% and 47.0%, respectively. (iii) Both DCW and PHB percentage contents of Reh(rpoN) were promoted, with arabinose concentrations of 0.04% and 0.004%, respectively. The DCW of Reh(rpoN), which was induced by 0.04% and 0.004% arabinose, increased by 3.5% and 25.9%, the PHB percentage content increased by 16.0% and 41.0%, and the corresponding PHB production increased by 20.1% and 77.5%, respectively. The DCW and PHB percentage content of the control strain Reh(BAD) remained unchanged under both conditions. These results indicated that a small amount of expression of phaP1, uspA, and rpoN promoted the PHB production of C. necator H16 under nonstress conditions, and 0.004% was the optimal arabinose induction concentration.
FIG 5.
Dry cell weight (DCW), PHB production, and PHB percentage content of metabolically engineered C. necator H16 induced by different arabinose concentrations. DCW, PHB production, and PHB percentage content were determined in recombinant strains Reh(B2-C2), Reh(phaP1), Reh(phaP2), Reh(uspA), Reh(rpoN), and Reh(BAD), which were chemoautotrophically cultured without and with 0.04% and 0.004% l-arabinose under nonstress (15% O2) conditions at 30°C for 72 h. Arabinose was added at the beginning of culture. Reh(B2-C2) is the wild-type C. necator H16 harboring the plasmid p2BBAD-phaB2-phaC2, Reh(phaP1) is the wild-type C. necator H16 harboring the plasmid p2BBAD-phaP1, Reh(phaP2) is the wild-type C. necator H16 harboring the plasmid p2BBAD-phaP2, Reh(uspA) is the wild-type C. necator H16 harboring the plasmid p2BBAD-uspA, Reh(rpoN) is the wild-type C. necator H16 harboring the plasmid p2BBAD-rpoN, and Reh(BAD) is the wild-type C. necator H16 harboring the plasmid p2BBAD. Error bars indicate the standard deviation of three independent biological replicates in each group.
TABLE 2.
DCW, PHB percentage content, and PHB production of recombinant strains induced by different arabinose concentrationsa
| Strain | DCW (g/liter) | PHB percentage content (%) | PHB production (g/liter) |
|---|---|---|---|
| Reh(B2-C2) | 0.72 ± 0.06 | 19.2 ± 0.8 | 0.14 ± 0.01 |
| Reh(B2-C2) + 0.04% Ara | 0.68 ± 0.07 | 18.1 ± 0.6 | 0.12 ± 0.01 |
| Reh(B2-C2) + 0.004% Ara | 0.73 ± 0.06 | 20.2 ± 1.4 | 0.15 ± 0.01 |
| Reh(phaP1) | 0.80 ± 0.03 | 23.6 ± 1.5 | 0.19 ± 0.02 |
| Reh(phaP1) + 0.04% Ara | 0.77 ± 0.05 | 24.7 ± 2.1 | 0.19 ± 0.00 |
| Reh(phaP1) + 0.004% Ara | 0.87 ± 0.09 | 32.4 ± 1.7 | 0.28 ± 0.04 |
| Reh(phaP2) | 1.00 ± 0.04 | 23.6 ± 2.0 | 0.24 ± 0.03 |
| Reh(phaP2) + 0.04% Ara | 0.92 ± 0.07 | 20.7 ± 1.5 | 0.19 ± 0.03 |
| Reh(phaP2) + 0.004% Ara | 1.06 ± 0.05 | 24.0 ± 1.2 | 0.26 ± 0.01 |
| Reh(uspA) | 0.75 ± 0.08 | 26.0 ± 1.7 | 0.20 ± 0.03 |
| Reh(uspA) + 0.04% Ara | 0.70 ± 0.06 | 23.3 ± 2.1 | 0.16 ± 0.00 |
| Reh(uspA) + 0.004% Ara | 0.95 ± 0.08 | 30.1 ± 2.0 | 0.29 ± 0.04 |
| Reh(rpoN) | 0.81 ± 0.03 | 19.4 ± 1.6 | 0.16 ± 0.02 |
| Reh(rpoN) + 0.04% Ara | 0.84 ± 0.08 | 22.5 ± 2.4 | 0.19 ± 0.04 |
| Reh(rpoN) + 0.004% Ara | 1.02 ± 0.07 | 27.3 ± 2.2 | 0.28 ± 0.04 |
| Reh(BAD) | 0.86 ± 0.05 | 23.1 ± 1.7 | 0.20 ± 0.00 |
| Reh(BAD) + 0.04% Ara | 0.77 ± 0.03 | 23.8 ± 1.7 | 0.18 ± 0.01 |
| Reh(BAD) + 0.004% Ara | 0.81 ± 0.09 | 22.8 ± 2.0 | 0.18 ± 0.04 |
The concentration 0.04% Ara represents the medium contained 400 mg/liter arabinose; 0.004% Ara represents the medium contained 40 mg/liter arabinose. Reh(B2-C2) is the wild-type C. necator H16 harboring the plasmid p2BBAD-phaB2-phaC2, Reh(phaP1) is the wild-type C. necator H16 harboring the plasmid p2BBAD-phaP1, Reh(phaP2) is the wild-type C. necator H16 harboring the plasmid p2BBAD-phaP2, Reh(uspA) is the wild-type C. necator H16 harboring the plasmid p2BBAD-uspA, Reh(rpoN) is the wild-type C. necator H16 harboring the plasmid p2BBAD-rpoN, and Reh(BAD) is the wild-type C. necator H16 harboring the plasmid p2BBAD. The error indicates the standard deviation of three independent biological replicates in each group.
In addition to expression intensity, the expression time may also affect PHB production in C. necator H16 under nonstress conditions. Figure 6 and Table 3 show the results of DCW and PHB percentage content of the strains, which were induced by 0.004% arabinose at 0 h, 24 h, and 48 h, respectively. Three kinds of results were observed for the metabolically engineered strains cultured under nonstress conditions as follows. (i) The DCW and PHB percentage contents of Reh(B2-C2) were unchanged no matter what time arabinose was added. This indicates that phaB2 and phaC2 cannot contribute to PHB synthesis in C. necator H16 under nonstress conditions. (ii) The DCW and PHB percentage content of Reh(phaP1), Reh(uspA), and Reh(rpoN) were the highest when induced at 0 h. Then, the DCW and PHB percentage content were decreased as the induction time shortened. This suggests that the genes phaP1, uspA, and rpoN have a continuous effect on PHB synthesis in C. necator H16. (iii) The DCW of Reh(phaP2), which was induced by 0.004% arabinose at 24 h and 48 h, increased by 11.3% and 3.2%, the PHB percentage content increased by 28.4% and 8.2%, and, correspondingly, the PHB production increased by 42.9% and 11.6%, respectively. The DCW and PHB percentage content of the control strain, Reh(BAD), almost remained the same under any conditions. This indicated that the overexpression of phaP2 could promote PHB synthesis in the C. necator H16 under nonstress conditions only when the strain grows to a specific stage. Adding 0.004% arabinose to the culture at 24 h was identified to be the optimal induction for PHB production of Reh(phaP2). The PHB production of C. necator H16 under nonstress conditions was significantly promoted by phaP1, phaP2, uspA, and rpoN under the optimum of expression intensity and period. To summarize, the overexpression of rpoN had the most significant promoting effect on PHB production in C. necator H16 under nonstress conditions.
FIG 6.
Dry cell weight (DCW), PHB production, and PHB percentage content of metabolically engineered C. necator H16 induced by arabinose at different time points. DCW, PHB production, and PHB percentage content were determined in recombinant strains Reh(B2-C2), Reh(phaP1), Reh(phaP2), Reh(uspA), Reh(rpoN), and Reh(BAD), which were chemoautotrophically cultured without and with 0.004% l-arabinose under nonstress (15% O2) conditions at 30°C for 72 h. Arabinose was added at 0 h, 24 h, and 48 h after culture. Reh(B2-C2) is the wild-type C. necator H16 harboring the plasmid p2BBAD-phaB2-phaC2, Reh(phaP1) is the wild-type C. necator H16 harboring the plasmid p2BBAD-phaP1, Reh(phaP2) is the wild-type C. necator H16 harboring the plasmid p2BBAD-phaP2, Reh(uspA) is the wild-type C. necator H16 harboring the plasmid p2BBAD-uspA, Reh(rpoN) is the wild-type C. necator H16 harboring the plasmid p2BBAD-rpoN, and Reh(BAD) is the wild-type C. necator H16 harboring the plasmid p2BBAD. Error bars indicate the standard deviation of three independent biological replicates in each group.
TABLE 3.
DCW, PHB percentage content, and PHB production of the recombinant strains induced with arabinose at different time pointsa
| Strain | Time of l-arabinose addition (h) | DCW (g/liter) | PHB percentage content (%) | PHB production (g/liter) |
|---|---|---|---|---|
| Reh(B2-C2) | None | 0.81 ± 0.06 | 17.4 ± 1.2 | 0.14 ± 0.02 |
| Reh(B2-C2) + 0.004% Ara | 0 | 0.76 ± 0.04 | 17.8 ± 0.9 | 0.13 ± 0.01 |
| Reh(B2-C2) + 0.004% Ara | 24 | 0.78 ± 0.05 | 17.0 ± 0.9 | 0.13 ± 0.01 |
| Reh(B2-C2) + 0.004% Ara | 48 | 0.77 ± 0.08 | 17.5 ± 1.4 | 0.13 ± 0.01 |
| Reh(phaP1) | None | 0.90 ± 0.06 | 20.9 ± 1.4 | 0.19 ± 0.02 |
| Reh(phaP1) + 0.004% Ara | 0 | 1.00 ± 0.04 | 27.3 ± 1.7 | 0.27 ± 0.02 |
| Reh(phaP1) + 0.004% Ara | 24 | 0.94 ± 0.08 | 24.8 ± 1.5 | 0.23 ± 0.03 |
| Reh(phaP1) + 0.004% Ara | 48 | 0.91 ± 0.08 | 22.0 ± 1.9 | 0.20 ± 0.03 |
| Reh(phaP2) | None | 0.82 ± 0.05 | 17.6 ± 1.8 | 0.14 ± 0.02 |
| Reh(phaP2) + 0.004% Ara | 0 | 0.81 ± 0.06 | 18.0 ± 1.4 | 0.15 ± 0.02 |
| Reh(phaP2) + 0.004% Ara | 24 | 0.92 ± 0.07 | 22.7 ± 1.2 | 0.21 ± 0.01 |
| Reh(phaP2) + 0.004% Ara | 48 | 0.85 ± 0.08 | 19.1 ± 1.7 | 0.16 ± 0.02 |
| Reh(uspA) | None | 0.89 ± 0.06 | 19.5 ± 1.4 | 0.17 ± 0.01 |
| Reh(uspA) + 0.004% Ara | 0 | 1.07 ± 0.09 | 22.7 ± 1.2 | 0.24 ± 0.03 |
| Reh(uspA) + 0.004% Ara | 24 | 1.01 ± 0.08 | 21.4 ± 1.9 | 0.22 ± 0.04 |
| Reh(uspA) + 0.004% Ara | 48 | 0.97 ± 0.04 | 20.7 ± 1.8 | 0.20 ± 0.02 |
| Reh(rpoN) | None | 0.73 ± 0.04 | 22.3 ± 1.1 | 0.16 ± 0.01 |
| Reh(rpoN) + 0.004% Ara | 0 | 0.89 ± 0.09 | 30.6 ± 1.2 | 0.27 ± 0.03 |
| Reh(rpoN) + 0.004% Ara | 24 | 0.82 ± 0.06 | 25.2 ± 1.9 | 0.21 ± 0.02 |
| Reh(rpoN) + 0.004% Ara | 48 | 0.81 ± 0.08 | 22.9 ± 1.5 | 0.18 ± 0.01 |
| Reh(BAD) | None | 0.74 ± 0.05 | 18.2 ± 1.3 | 0.14 ± 0.01 |
| Reh(BAD) + 0.004% Ara | 0 | 0.72 ± 0.06 | 17.5 ± 1.4 | 0.13 ± 0.02 |
| Reh(BAD) + 0.004% Ara | 24 | 0.76 ± 0.07 | 17.8 ± 1.6 | 0.14 ± 0.02 |
| Reh(BAD) + 0.004% Ara | 48 | 0.75 ± 0.03 | 18.2 ± 1.1 | 0.14 ± 0.01 |
The concentration 0.004% Ara indicates medium contained 40 mg/liter arabinose. Reh(B2-C2) is the wild-type C. necator H16 harboring the plasmid p2BBAD-phaB2-phaC2, Reh(phaP1) is the wild-type C. necator H16 harboring the plasmid p2BBAD-phaP1, Reh(phaP2) is the wild-type C. necator H16 harboring the plasmid p2BBAD-phaP2, Reh(uspA) is the wild-type C. necator H16 harboring the plasmid p2BBAD-uspA, Reh(rpoN) is the wild-type C. necator H16 harboring the plasmid p2BBAD-rpoN, and Reh(BAD) is the wild-type C. necator H16 harboring the plasmid p2BBAD. Error indicates the standard deviation of three independent biological replicates in each group.
The synergistic analysis of phaP1, uspA, and rpoN for PHB production in C. necator H16.
Through the above process optimization, it was found that PHB production in C. necator H16 was promoted by the overexpression of phaP1, uspA, and rpoN from the beginning of culture under nonstress conditions. The three upregulated genes of phaP1, uspA, and rpoN belong to the categories of PHB granulation and regulation. Therefore, it is speculated that these upregulated genes may synergistically promote PHB synthesis and are further coexpressed in C. necator H16. The genes of phaP1, uspA, and rpoN were ligated with the vector p2BBAD in tandem, and the constructed plasmid p2BBAD-phaP1-uspA-rpoN and strain Reh(PUR) were applied for protein expression. Figure 7 and Table 4 show the results of DCW and PHB percentage content of the Reh(PUR) under chemoautotrophic and heterotrophic nonstress conditions, and 0.004% arabinose was added to the culture at the beginning. Compared with the uninduced strains, the DCW of Reh(PUR) with 0.004% arabinose induction increased by 4.4% and 6.0% under chemoautotrophic and heterotrophic nonstress conditions, respectively. Under the same conditions for Reh(PUR) culture, PHB percentage content increased by 5.9% and 8.9%, and, correspondingly, the PHB production increased by 10.5% and 15.5%, respectively. For the control strain Reh(BAD), there was no significant difference in DCW and PHB percentage content between the arabinose induction and without induction (Table 3). The results suggested that the coexpression of the genes has no synergistic effect on PHB production in C. necator H16 under nonstress conditions. Since no obvious synergism among the genes was observed, a suitable single gene can be selected for overexpression to enhance PHB synthesis in C. necator H16 under nonstress conditions.
FIG 7.
Dry cell weight (DCW), PHB production, and PHB percentage content of metabolically engineered Reh(PUR) under chemoautotrophic and heterotrophic conditions. The DCW, PHB production, and PHB percentage content were determined in Reh(PUR), which was chemoautotrophically and heterotrophically cultured without and with 0.004% l-arabinose under nonstress (15% O2) conditions at 30°C for 72 h. Arabinose was added at the beginning of culture. Reh(PUR) is the wild-type C. necator H16 harboring the plasmid p2BBAD-phaP1-uspA-rpoN. The error bars indicate the standard deviation of three independent biological replicates in each group.
TABLE 4.
DCW, PHB percentage content, and PHB production of recombinant Reh(PUR) induced with arabinose under chemoautotrophic and heterotrophic conditionsa
| Strain | Carbon source | DCW (g/liter) | PHB percentage content (%) | PHB production (g/liter) |
|---|---|---|---|---|
| Reh(PUR) | CO2 | 0.91 ± 0.07 | 23.8 ± 1.8 | 0.22 ± 0.04 |
| Reh(PUR) + 0.004% Ara | CO2 | 0.95 ± 0.04 | 25.2 ± 2.3 | 0.24 ± 0.03 |
| Reh(PUR) | Fructose | 2.15 ± 0.21 | 30.4 ± 2.1 | 0.67 ± 0.09 |
| Reh(PUR) + 0.004% Ara | Fructose | 2.28 ± 0.17 | 33.1 ± 2.9 | 0.75 ± 0.09 |
The concentration 0.004% Ara indicates medium contained 40 mg/liter arabinose. Reh(PUR) is the wild-type C. necator H16 harboring the plasmid p2BBAD-phaP1-uspA-rpoN. Error indicates the standard deviation of three independent biological replicates in each group.
PHB production from metabolically engineered C. necator H16 under nonstress heterotrophic conditions.
Due to the special carbon metabolic pathway, fructose is an ideal carbon source for C. necator H16. PHB is mainly synthesized through heterotrophic fermentation of C. necator H16 with fructose as a carbon source since the overexpression of upregulated genes promotes PHB accumulation under chemoautotrophic conditions, which are further applied in heterotrophic fermentation of C. necator H16. Under nonstress conditions, the metabolically engineered strains were fermented with fructose as a caron source, and the DCW and PHB percentage content were calculated.
The DCW and PHB percentage content of the engineered strains, which were induced by 0.004% arabinose under heterotrophic nonstress conditions, are shown in Fig. 8 and Table 5. Compared with the strains without induction, when induced with 0.004% arabinose from the beginning of culture, the DCW of Reh(phaP1), Reh(uspA), and Reh(rpoN) increased by 5.5%, 27.6%, and 31.5%, the PHB percentage content increased by 31.8%, 15.0%, and 54.4%, and the PHB production increased by 39.1%, 46.7%, and 103.1%, respectively. The DCW, PHB percentage content, and PHB production of Reh(phaP2), which was induced by 0.004% arabinose from 24 h, increased by 14.6%, 21.3%, and 39.1%, respectively. No significant differences were observed in DCW, PHB percentage content, and PHB production of Reh(BAD) when induced by 0.004% arabinose. Similar to the chemoautotrophic culture, the overexpression of phaB2 and phaC2 did not promote the DCW and PHB percentage content of C. necator H16 under heterotrophic nonstress conditions. This suggests that the strategy of promoting PHB production by the overexpression of phaP1, phaP2, uspA, and rpoN applies to both chemoautotrophic and heterotrophic cultures of C. necator H16 under nonstress conditions.
FIG 8.
Dry cell weight (DCW), PHB production, and PHB percentage content of metabolically engineered C. necator H16 induced by l-arabinose under heterotrophic conditions. DCW, PHB production, and PHB percentage content were determined in recombinant strains Reh(B2-C2), Reh(phaP1), Reh(phaP2), Reh(uspA), Reh(rpoN), and Reh(BAD), which were heterotrophically cultured without and with 0.004% l-arabinose under nonstress (15% O2) conditions at 30°C for 72 h. The arabinose in Reh(phaP2) was added 24 h after culture, while the other strains were added at the beginning of culture. Reh(B2-C2) is the wild-type C. necator H16 harboring the plasmid p2BBAD-phaB2-phaC2, Reh(phaP1) is the wild-type C. necator H16 harboring the plasmid p2BBAD-phaP1, Reh(phaP2) is the wild-type C. necator H16 harboring the plasmid p2BBAD-phaP2, Reh(uspA) is the wild-type C. necator H16 harboring the plasmid p2BBAD-uspA, Reh(rpoN) is the wild-type C. necator H16 harboring the plasmid p2BBAD-rpoN, and Reh(BAD) is the wild-type C. necator H16 harboring the plasmid p2BBAD. Error bars indicate the standard deviation of three independent biological replicates in each group.
TABLE 5.
DCW, PHB percentage content, and PHB production of recombinant strains cultured under nonstress heterotrophic conditionsa
| Strain | DCW (g/liter) | PHB percentage content (%) | PHB production (g/liter) |
|---|---|---|---|
| Reh(B2-C2) | 2.24 ± 0.17 | 31.0 ± 1.8 | 0.69 ± 0.04 |
| Reh(B2-C2) + 0.004% Ara | 2.32 ± 0.24 | 30.2 ± 1.7 | 0.70 ± 0.10 |
| Reh(phaP1) | 2.36 ± 0.10 | 31.6 ± 2.3 | 0.74 ± 0.04 |
| Reh(phaP1) + 0.004% Ara | 2.49 ± 0.12 | 41.6 ± 1.9 | 1.04 ± 0.08 |
| Reh(phaP2) | 1.84 ± 0.15 | 37.6 ± 2.0 | 0.69 ± 0.03 |
| Reh(phaP2) + 0.004% Ara (24 h) | 2.11 ± 0.13 | 45.7 ± 2.2 | 0.96 ± 0.11 |
| Reh(uspA) | 1.52 ± 0.10 | 35.0 ± 1.6 | 0.53 ± 0.01 |
| Reh(uspA) + 0.004% Ara | 1.94 ± 0.17 | 40.2 ± 2.7 | 0.78 ± 0.10 |
| Reh(rpoN) | 2.03 ± 0.12 | 30.6 ± 2.8 | 0.62 ± 0.10 |
| Reh(rpoN) + 0.004% Ara | 2.67 ± 0.12 | 47.2 ± 2.0 | 1.26 ± 0.12 |
| Reh(BAD) | 2.08 ± 0.17 | 32.2 ± 1.7 | 0.67 ± 0.02 |
| Reh(BAD) + 0.004% Ara | 2.08 ± 0.12 | 28.3 ± 1.8 | 0.59 ± 0.07 |
The concentration 0.004% Ara represents the medium contained 40 mg/liter arabinose. Reh(B2-C2) is the wild-type C. necator H16 harboring the plasmid p2BBAD-phaB2-phaC2, Reh(phaP1) is the wild-type C. necator H16 harboring the plasmid p2BBAD-phaP1, Reh(phaP2) is the wild-type C. necator H16 harboring the plasmid p2BBAD-phaP2, Reh(uspA) is the wild-type C. necator H16 harboring the plasmid p2BBAD-uspA, Reh(rpoN) is the wild-type C. necator H16 harboring the plasmid p2BBAD-rpoN, and Reh(BAD) is the wild-type C. necator H16 harboring the plasmid p2BBAD. Error indicates the standard deviation of three independent biological replicates in each group.
DISCUSSION
Under environmental stress such as nutrient deficiency conditions, PHB in C. necator H16 can be synthesized in large amounts (8). In this study, we focused on PHB synthesis in C. necator H16 under chemoheterotrophic conditions with low oxygen supply. It was observed that a large amount of PHB was synthesized in C. necator H16 when cultured under low-oxygen stress. Understanding the gene transcription in the low-oxygen stress process will not only help reveal the mechanism of promoting PHB synthesis but also provide a theoretical basis for the construction of metabolically engineered C. necator H16 for efficient PHB production. Therefore, the comparative transcriptome was analyzed for C. necator H16 chemoheterotrophically cultured under low-oxygen stress and nonstress conditions. To achieve the accumulation of PHB under nonstress growth conditions, metabolic-engineering C. necator H16 was constructed based on the comparative transcriptome.
In C. necator H16, the enzymes for converting acetyl-CoA to PHB were mainly encoded by the phaC1AB1 operon, including PHB synthase (phaC1), acetyl-CoA acetyltransferase (phaA), and acetoacetyl-CoA reductase (phaB1) (6, 20). In this study, there was no significant difference in the expression of phaC1AB1 operon when C. necator H16 was cultured under low-oxygen stress and nonstress conditions separately. The RPKM of phaC1AB1 was greater than 1,300 when the bacterium was cultured under both conditions. This indicates that the phaC1AB1 operon was expressed in C. necator H16 under both low-oxygen stress and nonstress conditions, and the expression levels under both conditions were similar, while previous studies had shown the expression of phaC1 in C. necator H16 cultured under low-nitrogen stress conditions (PHB production phase) was significantly increased compared with strains cultured under nonstress conditions (growth phase) (15). These results indicated that the phaC1AB1 operon of C. necator H16 was not induced by low-oxygen stress. Similar to phaB1, PhaB3 also plays a major role in providing 3-hydroxybutyryl-coenzyme A (3-HB-CoA) monomers, while the regulatory mechanism of phaB3 was unclear (35). A previous study reported that a significant decrease in phaB3 expression was observed when C. necator H16 was cultured under low-nitrogen stress, and phaB3 was expressed in fructose culture, while it was not in trioleate culture (35). In this study, phaB3 has downregulated 1.5-fold under low-oxygen stress, which is similar to the results of previous studies (15). Interestingly, the low expression of phaB3 did not affect the PHB synthesis of C. necator H16 under both low-oxygen stress and nonstress conditions. Previous studies had shown that acetoacetyl-CoA reductase and PHB synthase (putative) were encoded by phaB2 and phaC2, while the two genes were not expressed in C. necator, whether cultured under abundant or limited nitrogen sources (35, 36). In this study, it is worth noting that both phaB2 and phaC2 were upregulated with RPKM values of 266.3 and 124.0 under low-oxygen stress, respectively, while the PHB production of C. necator H16 was not promoted by the overexpression of phaB2-phaC2, which was similar to previous research (36). To date, the specific physiological functions and induction mechanisms of phaB2 and phaC2 in C. necator H16 are still unclear.
PhaP1 and PhaP2 encoded by phaP1 and phaP2 are the most important phasins on the surface of PHB granules (37, 38). In this study, the expression of phaP1 and phaP2 was upregulated under low-oxygen stress, and the PHB production was improved in C. necator H16 by the overexpression of phaP1 and phaP2 under nonstress conditions. It has been reported that PHB production in C. necator H16 was promoted by suitable concentrations of phasins (36), while PHB production was negatively affected by the high concentration of PhaP in C. necator when PhaR, which regulates PhaP expression, was knocked out (30). This might explain why the intracellular PHB percentage content was not increased with the overexpression of phaP1 and phaP2 when the strains were induced by high concentration of arabinose. In addition, the PHB production of C. necator H16 was improved by the overexpression of phaP2 when induced at 24 h of culture. This might be attributed to the suitable level of expression of PhaP2, sufficient for granulation and its interaction with other phasins (38). In addition, the expression of phaP1 is regulated by phaR, whereas phaP2 is not regulated by any regulators (29). The differences in regulation between the two PhaPs may also contribute to this phenomenon.
In this work, the PHB production in C. necator H16 was increased by 49.4% and 42.9% under nonstress conditions through the overexpression of PHB granule-associated proteins PhaP1 and PhaP2, respectively. On the other hand, the transcription of both phaP4 and phaP5 was downregulated under low-oxygen conditions. However, previous studies had reported that neither phaP4 nor phaP5 is necessary for PHB production (38, 39). In C. necator H16, the main function of PhaM is to ensure that PHB granule could be evenly distributed in each cell during the division phase (40). The cell division rate under low-oxygen stress was much lower than that under nonstress conditions; therefore, the downregulation of phaM under low-oxygen stress was understandable. PHB production was affected by spoT1 and spoT2, which indirectly regulate PHB mobilization in C. necator H16 (23). The downregulation of spoT1 and spoT2 also indicated that PHB mobilization was inactive under low-oxygen stress.
In the present study, the transcription of uspA, which encodes a universal stress protein A (UspA), was upregulated 3.5-fold under low-oxygen stress, and the RPKM value reached 19,428.4. The UspA has a protective function related to the growth-arrested state, and it is almost universally responsive when cells are under diverse stresses (41–43). Previous studies had shown that the expression level of uspA was the highest when Escherichia coli was in the stationary phase (44), and UspA could regulate the carbon flux in the central carbon metabolism in E. coli during growth arrest (42). Therefore, in C. necator H16, the overexpression of uspA may introduce part of the carbon flux into the PHB synthesis pathway and eventually lead to an increase of PHB production under nonstress conditions.
Another upregulated gene is rpoN, the transcription level of which was the fourth highest under low-oxygen stress, and PHB production was also promoted by its overexpression under nonstress conditions. Previous studies had also shown that rpoN was upregulated under low-nitrogen stress in C. necator (15). In Pseudomonas aeruginosa, the synthesis of PHA was regulated by the sigma 54 factor, which was encoded by rpoN (24, 45), while the PHB production in Pseudomonas putida is RpoN independent (24). In this study, improvement of PHB production by the overexpression of rpoN was the most significant under nonstress conditions. Therefore, it can be speculated that PHB production in C. necator H16 is also RpoN dependent and similar to that in P. aeruginosa, and rpoN also plays an important role in the regulation of PHB synthesis in C. necator H16.
The coexpression of phaP1, uspA, and rpoN did not synergistically promote PHB production. Compared with the control strain, the PHB production in the metabolically engineered strain with phaP1-uspA-rpoN expression was increased by 15.5% under nonstress conditions, and the PHB production with the coexpression of phaP1-uspA-rpoN was lower than that of Reh(phaP1), Reh(phaP2), Reh(uspA), and Reh(rpoN). Both the granulation proteins and regulators promoted PHB production under low-oxygen conditions, while the synergetic effect was not observed under nonstress conditions. A high concentration of PhaP inhibited PHB production, the regulators of rpoN and uspA might stimulate PhaP production, and the PHB production was therefore affected (25, 30, 31). The specific mechanism of this phenomenon remains to be further studied. Compared to stress, most genes are transcribed in cells under nonstress conditions (15). Although Reh(PUR) did not significantly promote PHB production, the performance of Reh(phaP1), Reh(phaP2), Reh(uspA), and Reh(rpoN) was also competitive in PHB production compared with wild-type strains, and the PHB production of these strains was significantly increased under nonstress conditions.
In C. necator H16, PHB was accumulated in large quantities as a storage of carbon source and energy under stress (8). While high cell biomass could not be obtained when strains were cultured under stress, cell biomass plays a decisive role in PHB production (10, 46). In the present study, the PHB percentage content in C. necator H16 cultured under low-oxygen stress was higher than that of nonstress conditions. The PHB production of C. necator H16 cultured under low-oxygen stress was lower than nonstress conditions due to the difference in cell biomass (for PHB production, low-oxygen stress, 0.18 g/liter; nonstress, 0.21 g/liter) (Fig. 1b). This suggests that accumulation of PHB in C. necator H16 under non-oxygen stress conditions is an ideal method for PHB production. Therefore, achieving the highest bacterial biomass and PHB percentage content at the same time will help increase the production of PHB. In this study, compared with the control strain, PHB percentage content of Reh(phaP1), Reh(phaP2), Reh(uspA), and Reh(rpoN) increased by 37.2%, 28.4%, 15.8%, and 41.0%, and the corresponding PHB production increased by 49.8%, 42.9%, 47.0%, and 77.5% under nonstress chemoautotrophic conditions, respectively. Also, the PHB percentage content of Reh(rpoN) increased by 54.4%, and the corresponding PHB production increased by 103.1% under nonstress heterotrophic conditions. These results also proved that improving PHB production in C. necator H16 under both chemoautotrophic and heterotrophic conditions nonstress was feasible. In this study, the highest PHB percentage content of Reh(rpoN) reached 30.6% under nonstress conditions, which was lower than that of wild-type strain under low-oxygen stress (41.3%), while the DCW of Reh(rpoN) under nonstress conditions reached 0.90 g/liter, almost double that of wild-type strain under low-oxygen stress (0.43 g/liter). The PHB production of Reh(rpoN) under nonstress conditions (0.27 g/liter) was much higher than that of wild-type strains under low-oxygen stress (0.18 g/liter). This indicated that the strains constructed by the strategy in this study were competitive and has application potential in PHB production (Fig. 9).
FIG 9.
The strategy for metabolically engineering C. necator H16 based on comparative transcriptome to promote PHB production under nonstress conditions. CBB, Calvin-Benson-Bassham cycle; Ac-CoA, acetyl-CoA; AcAc-CoA, acetoacetyl-CoA; 3-HB-CoA, 3-hydroxybutyryl-CoA; PHB, polyhydroxybutyrate; TCA, tricarboxylic acid cycle; MH2ase, membrane-bound hydrogenase; SH2ase, soluble hydrogenase.
The PHB production in C. necator H16 cultured under low-oxygen conditions has been studied previously (2, 11–13, 47–49). In the single-stage autotrophic cultivation system, a maximum PHB concentration of 62 g/liter and a maximum PHB percentage content of 82% were obtained under low-oxygen conditions (13, 47). In the two-stage heterotrophic-autotrophic cultivation system, a maximum PHB concentration of 24 g/liter and a maximum PHB percentage content of 85% were obtained under low-oxygen conditions (11). In Lu et al.’s study, the PHB percentage content in C. necator H16 was about 10% under low-oxygen stress autotrophic conditions (17), and in Shimizu et al.'s study, the PHB percentage content in C. necator H16 was 42% under low-nitrogen stress heterotrophic conditions (15). In this study, the molecular basis of low-oxygen stress promoting PHB accumulation was revealed, and the promotion of PHB production by overexpression of the upregulated genes under nonstress conditions was confirmed. In the present study, the fermentation of C. necator H16 was carried out in shake flasks, and the low supply of CO2, H2, and O2 limited the growth of bacteria and PHB production. In addition, the growth-promoting substances such as carboxymethylcellulose were not added to the culture system in the present work (47). With the optimization of bioreactor and substrate (CO2, H2, and O2) supply and fermentation process, the DCW, PHB percentage content, and PHB production should be further improved. Additionally, the PHB percentage content was less than 5% under nonstress conditions in the above published work. Notably, the PHB percentage content of Reh(rpoN) reached 30.6% and 47.2% under nonstress autotrophic and heterotrophic conditions, respectively, in this study. The PHB production of Reh(rpoN) under no-stress autotrophic conditions was significantly higher than that of the wild-type strain under low-oxygen stress autotrophic conditions in this study. The results demonstrated the potential of promoting PHB synthesis in C. necator H16 under nonstress conditions by the overexpression of phasin and regulator genes. The work also provides a reference strategy to realize the optimum bacterial growth and PHB synthesis simultaneously under nonstress conditions through metabolic engineering of C. necator H16.
Conclusion. The molecular basis for the low-oxygen stress promoting PHB synthesis in C. necator H16 was revealed through comparative transcriptome and gene function analysis. Comparative transcriptome sequencing revealed that the acceleration of PHB enzymatic synthesis by upregulated phaB2 and phaC2, PHB granulation by upregulated phasins phaP1 and phaP2, along with the global regulation of uspA and rpoN, were the main reasons for the increase of PHB production under low-oxygen stress. The overexpression of phaP1, phaP2, uspA, and rpoN, respectively, promoted the PHB production in C. necator H16 under nonstress conditions. Under the optimum fermentation process, the PHB production of the metabolically engineered Reh(rpoN) increased by 77.5% and 103.1% under autotrophic and heterotrophic nonstress conditions, respectively. The work provides a new insight to understand the induction of PHB accumulation by low-oxygen stress and a new idea to construct the metabolically engineered C. necator H16 to synthesize PHB efficiently under nonstress conditions.
MATERIALS AND METHODS
Strains, plasmids, and culture conditions.
The bacterial strains and plasmids used in this study are listed in Table 6. E. coli strains were cultivated in a 50-ml flask with 25 ml lysogeny broth (LB) medium at 37°C and 200 rpm. C. necator H16 (DSM428) strains were cultivated in a 100-ml serum bottle with 50 ml mineral salts medium (MSM) at 30°C and 80 or 200 rpm. The medium was composed of 2.3 g/liter KH2PO4, 7.3 g/liter Na2HPO4·12 H2O, 1 g/liter NH4Cl, 0.5 g/liter MgSO4, 0.1 g/liter CaCl2, 0.05 g/liter Fe(NH4) citrate, and 1 ml/liter trace element solution (0.10 g/liter ZnSO4·7H2O, 0.03 g/liter MnCl2·4H2O, 0.30 g/liter H3BO3, 0.20 g/liter CoCl2·6H2O, 0.01 g/liter CuCl2·2H2O, 0.02 g/liter NiCl2·6H2O, and 0.03 g/liter NaMoO4·2H2O) in deionized water (50). Kanamycin (50 mg/liter for E. coli and 200 mg/liter for C. necator strains), streptomycin (100 mg/liter for E. coli S17-1 strains), gentamicin (20 mg/liter for C. necator strains), and l-arabinose (4 g/liter, 0.4 g/liter, and 0.04 g/liter for C. necator strains) were added to the medium if necessary.
TABLE 6.
Strains and plasmids used in this study
| Strains or plasmid | Characteristics | Source or reference |
|---|---|---|
| E. coli strains | ||
| Trans1-T1 | F− φ80 lacZΔM15 ΔlacX74 hsdR (rK− mK+) ΔrecA1398 endA1 tonA | Transgen Biotech |
| S17-1 | E. coli conjugation donor, Tpr Smr | 57 |
| Cupriavidus necator strains | ||
| H16 | Wild type, autotrophic, prototrophic, PHA+ | DSMZ 428 |
| Reh(B2-C2) | C. necator H16 harboring the plasmid p2BBAD-phaB2-phaC2 | This study |
| Reh(phaP1) | C. necator H16 harboring the plasmid p2BBAD-phaP1 | This study |
| Reh(phaP2) | C. necator H16 harboring the plasmid p2BBAD-phaP2 | This study |
| Reh(uspA) | C. necator H16 harboring the plasmid p2BBAD-uspA | This study |
| Reh(rpoN) | C. necator H16 harboring the plasmid p2BBAD-rpoN | This study |
| Reh(PUR) | C. necator H16 harboring the plasmid p2BBAD-phaP1-uspA-rpoN | This study |
| Reh(BAD) | C. necator H16 harboring the plasmid p2BBAD | This study |
| Plasmids | ||
| pBBR1MCS2 | Broad host range plasmid; Plac, PT7, PT3, lacZα, Kanr | (58) |
| p2BBAD | pBBR1MCS2 contains PBAD, RBS, T1 terminator | This study |
| p2BBAD-phaB2-phaC2 | Plasmid for overexpression of phaB2-phaC2 with promoter PBAD | This study |
| p2BBAD-phaP1 | Plasmid for overexpression of phaP1 with promoter PBAD | This study |
| p2BBAD-phaP2 | Plasmid for overexpression of phaP2 with promoter PBAD | This study |
| p2BBAD-uspA | Plasmid for overexpression of uspA with promoter PBAD | This study |
| p2BBAD-rpoN | Plasmid for overexpression of rpoN with promoter PBAD | This study |
| p2BBAD-phaP1-uspA-rpoN | Plasmid for overexpression of phaP1, uspA, and rpoN in tandem with promoter PBAD | This study |
C. necator H16 was first cultured for 36 h with fructose as a carbon source and then inoculated in experimental group serum bottles with a 2% inoculum and cultured under autotrophic conditions (CO2, H2, and O2). Under the autotrophic culture of C. necator H16, the substrate with CO2:H2:O2 equal to 1:7:0.25 (vol/vol/vol) with 3% O2 and CO2:H2:O2 equal to 1:7:1.4 (vol/vol/vol) with 15% O2 were considered low-oxygen stress and nonstress conditions, respectively. Before inoculation of C. necator H16, the air in the serum bottle was removed by a vacuum pump. Then, each serum bottle was connected to a 5-liter gas sampling bag containing the mixture of CO2, H2, and O2 and was replaced every 12 h during the chemoautotrophic culture. Each gas sampling bag contains the same amount of CO2 and H2, just with a variable amount of O2. C. necator strains were cultured at 30°C and 80 rpm under the chemoautotrophic conditions and at 30°C and 200 rpm in the heterotrophic conditions, respectively (8 g/liter fructose as a carbon source).
Sample preparation, sequencing, and RNA-Seq data analysis.
The C. necator H16 cells were collected by centrifugation after growing for 72 h with different oxygen concentrations. Subsequently, the bacteria were divided into two equal parts; one part was used to determine the dry cell weight (DCW) and PHB percentage content, the other was part sent to igeneCode (Beijing, China) for transcriptome sequencing (RNA-Seq) analysis.
In the RNA-Seq data analysis, the following three types of reads were removed to get clean reads: (i) reads containing adapter, (ii) reads with N ratio greater than 10%, and (iii) low-quality reads (the base number of Q20 represents more than 40% of the reads). Then, the genome sequences of C. necator H16 (Ralstonia eutropha H16), which contain GenBank accession nos. NC_008313 (chromosome 1), NC_008314 (chromosome 2), and NC_005241 (megaplasmid pHG1), were selected as the reference sequences of clean reads. The short-read alignment software SOAPaligner/SOAP2 was used to map the clean reads, and a maximum of 5 base mismatches was allowed (51).The reads per kilobase per million (RPKM) method was used to represent the amount of gene expression (52), and the differentially expressed genes (DEGs) were identified when false-discovery rate (FDR) was ≤0.001 and RPKM log2 ratio was ≥|1|. Finally, the DEGs were mapped onto the PHB synthesis pathway and related regulators based on the Kyoto Encyclopedia of Genes and Genomes (KEGG) database to dig out the genes which could be modified (53).
Construction of overexpression plasmids and transformation.
DNA manipulations were conducted according to standard procedures. The genes of phaB2, phaC2, phaP1, phaP2, uspA, and rpoN were amplified from the genome of C. necator H16. The PBAD promoter was amplified from the plasmid pKD46 (54). The ribosome binding site (RBS) suitable for C. necator H16 and T1 terminator were synthesized by Genewiz (Suzhou, China). In this study, the pBBR1MCS2 was linearized by digestion enzymes XbaI and SalI. The expression plasmid p2BBAD was obtained by ligating linearized pBBR1MCS2, Pbad, RBS, and T1 terminator by Gibson assembly, and the restriction site HindIII (AAGCTT) was inserted between RBS and T1 terminator (55). All of the overexpression plasmids were constructed with p2BBAD as the plasmid backbone. The overexpression plasmids were introduced into C. necator H16 by the conjugation method (14). E. coli S17-1 with overexpression plasmid and C. necator H16 were cultured in LB medium for 12 h and 24 h, respectively, as donor and recipient. Then, 10 ml C. necator H16 was mixed with 5 ml E. coli S17-1 and centrifuged at 4,000 rpm for 10 min. After washing with distilled water once, the mixed cells were resuspended with 200 μl LB and dripped onto the fiber filtration film placed on LB plate and then cultured at 30°C for 24 h. Subsequently, the bacterial lawns were washed into 1 ml sterile water, and 100 μl bacteria solution was coated onto the LB plate containing 200 μg/ml kanamycin and 20 μg/ml gentamicin and then cultured at 30°C for 48 h. The single clone picked from the LB plates was cultured in MSM with 8 g/liter fructose, 200 μg/ml kanamycin, and 20 μg/ml gentamicin. Finally, the expression strain was verified through PCR amplification with primers P2Y F (GTGCTGCAAGGCGATTAAGTTGGG) and P2Y R (GCACGAACGGTTTCCCGACTG). The chemoautotrophic cultivation of C. necator H16 and its genetically engineered derivatives are described in “Strain, plasmids, and culture conditions.”
Analytical methods.
Forty milliliters of bacterial culture were collected by centrifugation at 10,000 × g and washed twice with distilled water. The collected bacteria were dried at 75°C for 10 h and then used for DCW calculation. The PHB content in the bacteria was determined by hydrolysis and trans-esterification methods (56). The dried collection was mixed with 2 ml of methanol solution (3% sulfuric acid and 0.4% benzoic acid) and 2 ml of chloroform and then incubated at 100°C for 4 h to depolymerize the polymer to monomers. One milliliter of distilled water was added to the cooled sample and shaken for 1 min. When the resulting solution was stratified, 1 μl of the heavier phase was injected into a gas chromatograph (Shimadzu; GC-2014) for analysis. The Analytical Technology SE-54 capillary column was used for gas chromatography (GC) analysis. The amount of PHB was determined by using benzoic acid as an internal standard.
Data availability.
Plasmid sequences have been deposited in GenBank under accession numbers OL331253 (p2BBAD), OL331254 (p2BBAD-phaB2-phaC2), OL331255 (p2BBAD-phaP1), OL331256 (p2BBAD-phaP2), OL331257 (p2BBAD-uspA), OL331258 (p2BBAD-rpoN), and OL331259 (p2BBAD-phaP1-uspA-rpoN).
ACKNOWLEDGMENTS
We thank the supports from the National Key Research and Development Program of China (2021YFC2101603), the National Natural Science Foundation of China (No.21676279), and the Key Research Program of Nanjing IPE Institute of Green Manufacturing Industry (E0010716).
We declare that there is no conflict of interest.
Contributor Information
Yejun Han, Email: yejunhan09@gmail.com.
Nicole R. Buan, University of Nebraska-Lincoln
REFERENCES
- 1.Philip S, Keshavarz T, Roy I. 2007. Polyhydroxyalkanoates: biodegradable polymers with a range of applications. J Chem Technol Biotechnol 82:233–247. 10.1002/jctb.1667. [DOI] [Google Scholar]
- 2.Ishizaki A, Tanaka K. 1991. Production of poly-β-hydroxybutyric acid from carbon dioxide by Alcaligenes eutrophus ATCC 17697T. J Ferment Bioeng 71:254–257. 10.1016/0922-338X(91)90277-N. [DOI] [Google Scholar]
- 3.Porter MM, Lee S, Tanadchangsaeng N, Jaremko MJ, Yu J, Meyers M, McKittrick J. 2013. Porous hydroxyapatite-polyhydroxybutyrate composites fabricated by a novel method via centrifugation, p 63–71. In Mechanics of biological systems and materials, vol 5. Springer, New York, NY. [Google Scholar]
- 4.Hong H, Dong NG, Shi JW, Chen S, Guo C, Hu P, Qi HX. 2009. Fabrication of a novel hybrid heart valve leaflet for tissue engineering: an in vitro study. Artif Organs 33:554–557. 10.1111/j.1525-1594.2009.00742.x. [DOI] [PubMed] [Google Scholar]
- 5.Pouton CW, Akhtar S. 1996. Biosynthetic polyhydroxyalkanoates and their potential in drug delivery. Adv Drug Del Rev 18:133–162. 10.1016/0169-409X(95)00092-L. [DOI] [Google Scholar]
- 6.Pohlmann A, Fricke WF, Reinecke F, Kusian B, Liesegang H, Cramm R, Eitinger T, Ewering C, Potter M, Schwartz E, Strittmatter A, Voss I, Gottschalk G, Steinbuchel A, Friedrich B, Bowien B. 2006. Genome sequence of the bioplastic-producing “Knallgas” bacterium Ralstonia eutropha H16. Nat Biotechnol 24:1257–1262. 10.1038/nbt1244. [DOI] [PubMed] [Google Scholar]
- 7.Schwartz E, Henne A, Cramm R, Eitinger T, Friedrich B, Gottschalk G. 2003. Complete nucleotide sequence of pHG1: a Ralstonia eutropha H16 megaplasmid encoding key enzymes of H2-based lithoautotrophy and anaerobiosis. J Mol Biol 332:369–383. 10.1016/S0022-2836(03)00894-5. [DOI] [PubMed] [Google Scholar]
- 8.Law JH, Slepecky RA. 1961. Assay of poly-beta-hydroxybutyric acid. J Bacteriol 82:33–37. 10.1128/jb.82.1.33-36.1961. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Mozumder MSI, Garcia-Gonzalez L, De Wever H, Volcke EIP. 2015. Poly(3-hydroxybutyrate) (PHB) production from CO2: model development and process optimization. Biochem Eng J 98:107–116. 10.1016/j.bej.2015.02.031. [DOI] [Google Scholar]
- 10.Wang X, Lin L, Dong J, Ling J, Wang W, Wang H, Zhang Z, Yu X. 2018. Simultaneous improvements of Pseudomonas cell growth and polyhydroxyalkanoate production from a lignin derivative for lignin-consolidated bioprocessing. Appl Environ Microbiol 84:e01469-18. 10.1128/AEM.01469-18. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Kenji T, Ayaaki I. 1994. Production of poly-D-3-hydroxybutyric acid from carbon dioxide by a two-stage culture method employing Alcaligenes eutrophus ATCC 17697T. J Ferment Bioeng 77:425–427. [Google Scholar]
- 12.Garcia-Gonzalez L, Mozumder MSI, Dubreuil M, Volcke EIP, De Wever H. 2015. Sustainable autotrophic production of polyhydroxybutyrate (PHB) from CO2 using a two-stage cultivation system. Catal Today 257:237–245. 10.1016/j.cattod.2014.05.025. [DOI] [Google Scholar]
- 13.Tanaka K, Ishizaki A, Kanamaru T, Kawano T. 1995. Production of poly(D-3-hydroxybutyrate) from CO2, H2, and O2 by high cell density autotrophic cultivation of Alcaligenes eutrophus. Biotechnol Bioeng 45:268–275. 10.1002/bit.260450312. [DOI] [PubMed] [Google Scholar]
- 14.Tang R, Weng C, Peng X, Han Y. 2020. Metabolic engineering of Cupriavidus necator H16 for improved chemoautotrophic growth and PHB production under oxygen-limiting conditions. Metab Eng 61:11–23. 10.1016/j.ymben.2020.04.009. [DOI] [PubMed] [Google Scholar]
- 15.Shimizu R, Chou K, Orita I, Suzuki Y, Nakamura S, Fukui T. 2013. Detection of phase-dependent transcriptomic changes and Rubisco-mediated CO2 fixation into poly (3-hydroxybutyrate) under heterotrophic condition in Ralstonia eutropha H16 based on RNA-seq and gene deletion analyses. BMC Microbiol 13:169. 10.1186/1471-2180-13-169. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Du G-C, Chen J, Gao H-J, Chen Y-G, Lun S-Y. 2000. Effects of environmental conditions on cell growth and poly-β-hydroxybutyrate accumulation in Alcaligenes eutrophus. World J Microbiol Biotechnol 16:9–13. 10.1023/A:1008922113483. [DOI] [Google Scholar]
- 17.Lu Y, Yu J. 2017. Comparison analysis on the energy efficiencies and biomass yields in microbial CO2 fixation. Process Biochem 62:151–160. 10.1016/j.procbio.2017.07.007. [DOI] [Google Scholar]
- 18.Ishizaki A, Tanaka K, Taga N. 2001. Microbial production of poly-D-3-hydroxybutyrate from CO2. Appl Microbiol Biotechnol 57:6–12. 10.1007/s002530100775. [DOI] [PubMed] [Google Scholar]
- 19.Kutralam-Muniasamy G, Peréz-Guevara F. 2018. Genome characteristics dictate poly-R-(3)-hydroxyalkanoate production in Cupriavidus necator H16. World J Microbiol Biotechnol 34:79. 10.1007/s11274-018-2460-5. [DOI] [PubMed] [Google Scholar]
- 20.Peoples OP, Sinskey AJ. 1989. Poly-beta-hydroxybutyrate biosynthesis in Alcaligenes eutrophus H16. Characterization of the genes encoding beta-ketothiolase and acetoacetyl-CoA reductase. J Biol Chem 264:15293–15297. 10.1016/S0021-9258(19)84824-X. [DOI] [PubMed] [Google Scholar]
- 21.Pötter M, Müller H, Reinecke F, Wieczorek R, Fricke F, Bowien B, Friedrich B, Steinbüchel A. 2004. The complex structure of polyhydroxybutyrate (PHB) granules: four orthologous and paralogous phasins occur in Ralstonia eutropha. Microbiology (Reading) 150:2301–2311. 10.1099/mic.0.26970-0. [DOI] [PubMed] [Google Scholar]
- 22.Brigham CJ, Speth DR, Rha C, Sinskey AJ. 2012. Whole-genome microarray and gene deletion studies reveal regulation of the polyhydroxyalkanoate production cycle by the stringent response in Ralstonia eutropha H16. Appl Environ Microbiol 78:8033–8044. 10.1128/AEM.01693-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Juengert JR, Borisova M, Mayer C, Wolz C, Brigham CJ, Sinskey AJ, Jendrossek D. 2017. Absence of ppGpp leads to increased mobilization of intermediately accumulated poly(3-hydroxybutyrate) in Ralstonia eutropha H16. Appl Environ Microbiol 83:e00755-17. 10.1128/AEM.00755-17. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Hoffmann N, Rehm BHA. 2004. Regulation of polyhydroxyalkanoate biosynthesis in Pseudomonas putida and Pseudomonas aeruginosa. FEMS Microbiol Lett 237:1–7. 10.1111/j.1574-6968.2004.tb09671.x. [DOI] [PubMed] [Google Scholar]
- 25.Potter M, Madkour MH, Mayer F, Steinbuchel A. 2002. Regulation of phasin expression and polyhydroxyalkanoate (PHA) granule formation in Ralstonia eutropha H16. Microbiology (Reading) 148:2413–2426. 10.1099/00221287-148-8-2413. [DOI] [PubMed] [Google Scholar]
- 26.Pfeiffer D, Jendrossek D. 2012. Localization of poly(3-hydroxybutyrate) (PHB) granule-associated proteins during PHB granule formation and identification of two new phasins, PhaP6 and PhaP7, in Ralstonia eutropha H16. J Bacteriol 194:5909–5921. 10.1128/JB.00779-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.York GM, Stubbe J, Sinskey AJ. 2001. New insight into the role of the PhaP phasin of Ralstonia eutropha in promoting synthesis of polyhydroxybutyrate. J Bacteriol 183:2394–2397. 10.1128/JB.183.7.2394-2397.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Pfeiffer D, Wahl A, Jendrossek D. 2011. Identification of a multifunctional protein, PhaM, that determines number, surface to volume ratio, subcellular localization and distribution to daughter cells of poly(3-hydroxybutyrate), PHB, granules in Ralstonia eutropha H16. Mol Microbiol 82:936–951. 10.1111/j.1365-2958.2011.07869.x. [DOI] [PubMed] [Google Scholar]
- 29.Pötter M, Müller H, Steinbüchel A. 2005. Influence of homologous phasins (PhaP) on PHA accumulation and regulation of their expression by the transcriptional repressor PhaR in Ralstonia eutropha H16. Microbiology (Reading) 151:825–833. 10.1099/mic.0.27613-0. [DOI] [PubMed] [Google Scholar]
- 30.York GM, Stubbe J, Sinskey AJ. 2002. The Ralstonia eutropha PhaR protein couples synthesis of the PhaP phasin to the presence of polyhydroxybutyrate in cells and promotes polyhydroxybutyrate production. J Bacteriol 184:59–66. 10.1128/JB.184.1.59-66.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Wieczorek R, Pries A, Steinbüchel A, Mayer F. 1995. Analysis of a 24-kilodalton protein associated with the polyhydroxyalkanoic acid granules in Alcaligenes eutrophus. J Bacteriol 177:2425–2435. 10.1128/jb.177.9.2425-2435.1995. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Wang J, Jiang W, Liang C, Zhu L, Li Y, Mo Q, Xu S, Chu A, Zhang L, Ding Z, Shi G. 2021. Overproduction of alpha-farnesene in Saccharomyces cerevisiae by farnesene synthase screening and metabolic engineering. J Agric Food Chem 69:3103–3113. 10.1021/acs.jafc.1c00008. [DOI] [PubMed] [Google Scholar]
- 33.Lin Y, Guan Y, Dong X, Ma Y, Wang X, Leng Y, Wu F, Ye J-W, Chen G-Q. 2021. Engineering Halomonas bluephagenesis as a chassis for bioproduction from starch. Metab Eng 64:134–145. 10.1016/j.ymben.2021.01.014. [DOI] [PubMed] [Google Scholar]
- 34.Yang X, Liu J, Zhang J, Shen Y, Qi Q, Bao X, Hou J. 2021. Quorum sensing-mediated protein degradation for dynamic metabolic pathway control in Saccharomyces cerevisiae. Metab Eng 64:85–94. 10.1016/j.ymben.2021.01.010. [DOI] [PubMed] [Google Scholar]
- 35.Budde CF, Mahan AE, Lu J, Rha C, Sinskey AJ. 2010. Roles of multiple acetoacetyl coenzyme A reductases in polyhydroxybutyrate biosynthesis in Ralstonia eutropha H16. J Bacteriol 192:5319–5328. 10.1128/JB.00207-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Peplinski K, Ehrenreich A, Döring C, Bömeke M, Reinecke F, Hutmacher C, Steinbüchel A. 2010. Genome-wide transcriptome analyses of the 'Knallgas' bacterium Ralstonia eutropha H16 with regard to polyhydroxyalkanoate metabolism. Microbiology (Reading) 156:2136–2152. 10.1099/mic.0.038380-0. [DOI] [PubMed] [Google Scholar]
- 37.Neumann L, Spinozzi F, Sinibaldi R, Rustichelli F, Pötter M, Steinbüchel A. 2008. Binding of the major phasin, PhaP1, from Ralstonia eutropha H16 to poly(3-hydroxybutyrate) granules. J Bacteriol 190:2911–2919. 10.1128/JB.01486-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Pfeiffer D, Jendrossek D. 2011. Interaction between poly(3-hydroxybutyrate) granule-associated proteins as revealed by two-hybrid analysis and identification of a new phasin in Ralstonia eutropha H16. Microbiology (Reading) 157:2795–2807. 10.1099/mic.0.051508-0. [DOI] [PubMed] [Google Scholar]
- 39.Kuchta K, Chi L, Fuchs H, Potter M, Steinbuchel A. 2007. Studies on the influence of phasins on accumulation and degradation of PHB and nanostructure of PHB granules in Ralstonia eutropha H16. Biomacromolecules 8:657–662. 10.1021/bm060912e. [DOI] [PubMed] [Google Scholar]
- 40.Jendrossek D, Pfeiffer D. 2014. New insights in the formation of polyhydroxyalkanoate granules (carbonosomes) and novel functions of poly(3-hydroxybutyrate). Environ Microbiol 16:2357–2373. 10.1111/1462-2920.12356. [DOI] [PubMed] [Google Scholar]
- 41.Nyström T, Neidhardt FC. 1992. Cloning, mapping and nucleotide sequencing of a gene encoding a universal stress protein in Escherichia coli. Mol Microbiol 6:3187–3198. 10.1111/j.1365-2958.1992.tb01774.x. [DOI] [PubMed] [Google Scholar]
- 42.Nyström T, Neidhardt FC. 1993. Isolation and properties of a mutant of Escherichia coli with an insertional inactivation of the uspA gene, which encodes a universal stress protein. J Bacteriol 175:3949–3956. 10.1128/jb.175.13.3949-3956.1993. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Nyström T, Neidhardt FC. 1994. Expression and role of the universal stress protein, UspA, of Escherichia coli during growth arrest. Mol Microbiol 11:537–544. 10.1111/j.1365-2958.1994.tb00334.x. [DOI] [PubMed] [Google Scholar]
- 44.Liu W-T, Karavolos MH, Bulmer DM, Allaoui A, Hormaeche RDCE, Lee JJ, Khan CMA. 2007. Role of the universal stress protein UspA of Salmonella in growth arrest, stress and virulence. Microb Pathog 42:2–10. 10.1016/j.micpath.2006.09.002. [DOI] [PubMed] [Google Scholar]
- 45.Rehm BHA. 2006. Genetics and biochemistry of polyhydroxyalkanoate granule self-assembly: the key role of polyester synthases. Biotechnol Lett 28:207–213. 10.1007/s10529-005-5521-4. [DOI] [PubMed] [Google Scholar]
- 46.Zhuang Q, Wang Q, Liang Q, Qi Q. 2014. Synthesis of polyhydroxyalkanoates from glucose that contain medium-chain-length monomers via the reversed fatty acid β-oxidation cycle in Escherichia coli. Metab Eng 24:78–86. 10.1016/j.ymben.2014.05.004. [DOI] [PubMed] [Google Scholar]
- 47.Taga N, Tanaka K, Ishizaki A. 1997. Effects of rheological change by addition of carboxymethylcellulose in culture media of an air-lift fermentor on poly-D-3-hydroxybutyric acid productivity in autotrophic culture of hydrogen-oxidizing bacterium, Alcaligenes eutrophus. Biotechnol Bioeng 53:529–533. 10.1002/(SICI)1097-0290(19970305)53:5<529::AID-BIT11>3.0.CO;2-B. [DOI] [PubMed] [Google Scholar]
- 48.Darani KK, Vasheghani- Fa Rahani E, Tanaka K. 2006. Hydrogen oxidizing bacteria as poly(hydroxybutyrate) producers. Iran J Biotechnol 4:193–196. [Google Scholar]
- 49.Sugimoto T, Tsuge T, Tanaka K, Ishizaki A. 1999. Control of acetic acid concentration by pH-stat continuous substrate feeding in heterotrophic culture phase of two-stage cultivation of Alcaligenes eutrophus for production of P(3HB) from CO2, H2, and O2 under non-explosive conditions. Biotechnol Bioeng 62:625–631. 10.1002/(SICI)1097-0290(19990320)62:6<625::AID-BIT1>3.0.CO;2-D. [DOI] [PubMed] [Google Scholar]
- 50.Franz A, Song H-S, Ramkrishna D, Kienle A. 2011. Experimental and theoretical analysis of poly(β-hydroxybutyrate) formation and consumption in Ralstonia eutropha. Biochem Eng J 55:49–58. 10.1016/j.bej.2011.03.006. [DOI] [Google Scholar]
- 51.Li R, Li Y, Fang X, Yang H, Wang J, Kristiansen K, Wang J. 2009. SNP detection for massively parallel whole-genome resequencing. Genome Res 19:1124–1132. 10.1101/gr.088013.108. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 52.Mortazavi A, Williams BA, McCue K, Schaeffer L, Wold B. 2008. Mapping and quantifying mammalian transcriptomes by RNA-Seq. Nat Methods 5:621–628. 10.1038/nmeth.1226. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 53.Kanehisa M, Goto S. 2000. KEGG: Kyoto Encyclopedia of Genes and Genomes. Nucleic Acids Res 28:27–30. 10.1093/nar/28.1.27. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 54.Zhao D, Yuan S, Xiong B, Sun H, Ye L, Li J, Zhang X, Bi C. 2016. Development of a fast and easy method for Escherichia coli genome editing with CRISPR/Cas9. Microb Cell Fact 15:205. 10.1186/s12934-016-0605-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 55.Gibson DG, Young L, Chuang RY, Venter JC, Hutchison CA, Smith HO. 2009. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nat Methods 6:343–345. 10.1038/nmeth.1318. [DOI] [PubMed] [Google Scholar]
- 56.Peng X, Kelly RM, Han Y. 2018. Sequential processing with fermentative Caldicellulosiruptor kronotskyensis and chemolithoautotrophic Cupriavidus necator for converting rice straw and CO2 to polyhydroxybutyrate. Biotechnol Bioeng 115:1624–1629. 10.1002/bit.26578. [DOI] [PubMed] [Google Scholar]
- 57.Simon R, Priefer U, Pühler A. 1983. A broad host range mobilization system for in vivo genetic engineering: transposon mutagenesis in Gram negative bacteria. Nat Biotechnol 1:784–791. 10.1038/nbt1183-784. [DOI] [Google Scholar]
- 58.Kovach ME, Elzer PH, Steven Hill D, Robertson GT, Farris MA, Roop RM, Peterson KM, II.. 1995. Four new derivatives of the broad-host-range cloning vector pBBR1MCS, carrying different antibiotic-resistance cassettes. Gene 166:175–176. 10.1016/0378-1119(95)00584-1. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
Plasmid sequences have been deposited in GenBank under accession numbers OL331253 (p2BBAD), OL331254 (p2BBAD-phaB2-phaC2), OL331255 (p2BBAD-phaP1), OL331256 (p2BBAD-phaP2), OL331257 (p2BBAD-uspA), OL331258 (p2BBAD-rpoN), and OL331259 (p2BBAD-phaP1-uspA-rpoN).









