Skip to main content
Archives of Razi Institute logoLink to Archives of Razi Institute
. 2021 Oct 31;76(4):829–840. doi: 10.22092/ari.2021.355465.1689

Molecular Analysis of fimA Operon Genes among UPEC Local Isolates in Baghdad City

Abdul Raheem Hasan S 1*, Sajid Al-Jubori S 2, Abdul Sattar Salman J 2
PMCID: PMC8790995  PMID: 35096318

Abstract

Specialized Escherichia coli (E. coli) isolates, called uropathogenic E. coli (UPEC), cause most of urinary tract infections (UITs). Once bacteria reached the urinary tract of the host, they have to adhere to the host cell for the colonization. For this purpose, bacteria have different structures including fimbrial adhesins. Most of the UPECs contain type 1 fimbriae encoded by fim operon (fimB, E, A, I, C, D, F, G, H) which is responsible for the adhesive ability in these isolates. Ninety-four isolates of UPEC were obtained from UTI patients in Baghdad hospitals and their diagnosis were confirmed by the PCR method using 16srDNA as a housekeeping gene. The UPEC isolates were tested for their ability of adherence to the urothelial cells obtained from the mid-stream urine from healthy women. Fifty isolates were subjected to detect type1 fimbriae genes (fimA operon) using specific primers followed by sequencing the amplified fragment which they were analyzed by Geneious software. The results confirm that all the isolates were E. coli according to the genetic analysis by the PCR test, and also, the ability of attachment for all isolates were approved (100%). For type 1 fimbriae, the findings figured out that 100% of the isolates harbored fimA,fimI, fimC, fimD, fimG and fimH genes; while 96% of them were positive for fimB, fimF,and 82% of the isolates were positive for fimE. This result exhibited a higher prevalence of fim genes, as the attachment ability was 100%. Approximately, all UPEC have type 1fimbrial genes, so it could be used as a genetic marker in the investigation of E. coli adhesion ability.

Keywords: fimA operon, Uropathogenic Escherichia coli, attachment ability

1. Introduction

Escherichia coli (E. coli) is a genus within the Enterobacteriaceae family that consist of a large number of species ( 1 ). It considered the most common causative agent for both the uncomplicated and complicated urinary tract infection (UTI) ( 2 ). Its rapid growing on chemically defined media and well-studied bacteria, make it an essential model organism, so it also called workhorse of molecular biology. E. coli is considered one of most essential pathogen within human body and about 70-95% of the community acquired UTI, beside 50% of nosocomial UTI were caused by the uropathogenic Escherichia coli (UPEC) infections ( 3 ). UPEC have many virulence factors (VFs), which prefer the adaptation in urinary tracts and allow them to disrupt the barriers of the immune system. Once bacteria reached surface of the host, for colonization, they have to adhere to host cell. The adherence ability of E. coli to host cells play an essential role in the process of colonization ( 4 ). In general, adhesins usually are exposed to the bacterial surface or they carried by filamentous structures fimbriae or pili and most of UPECs contain type 1 fimbriae encoded by fim operon (fimB, E, A, I, C, D, F, G, H) which are existed in the chromosome of most UPEC isolates ( 5 ). Therefore, current study was designed to investigate the genetic marker and the potential of different isolates of E. coli adhesion ability.

2. Material and Methods

2.1. Collection and Diagnostic of UPEC Isolates

UPEC isolates were obtained from Hospital laboratories in Baghdad Iraq from UTI patients within the period from January 2019 to April 2019.

2.2. Attachment Ability to Pathogenic E. coli

Urine samples were taken from the healthy women (the midstream urine) as the main source for the uroepithelial cells. Due to the change in pH during the menstrual cycle, the sampling was done during the luteal phase of menstrual cycle. The samples were centrifuged for 5 min at 3000 rpm; the sediment that contained epithelial cells was washed with the phosphate buffer saline four times. The cells solution was considered a source for the uroepithelial cells for later use in adhesion assay ( 6 ). The concentration of bacterial cells was adjusted to 1.5 × 108 CFU/ml compared to McFarland (0.5), the epithelial cells were added. After the 60min of incubation time at 37°C, the disparate bacteria were eliminated by washing for several times with the phosphate buffer saline. The cells then were fixed and stained with the gram stain. Theadhered bacterial cells were counted directly under the light microscope ( 7 ).

2.3. Bacterial DNA Extraction

Broth of the bacterial isolates were cultured overnight in LB, then they were subjected for DNA extraction, by using ABIO pure TM kit. The concentration and purity of the extracted DNA were measured using Nanodrop.

2.4. Molecular Study

The housekeeping gene (HKG) 16S rDNA was used for the molecular diagnosis via PCR test( 8 , 9 ); fim operon specific primers were specially designed in current study, and they were used. Their sequence, and accession number beside the amplified molecular size, were itemized in table 1. The PCR mixture of the mentioned gene was composed of 12.5 µl of GoTaq®Green Master Mix (1x), 5µl DNA template; 1.5 µl for each of the forward and reverse primers (final concentration was 0.6 pmol/µl), and 4.5µl of deionized nuclease free water to reach the final volume of 25 µl. Then, the Eppendorf tubes were mixed shortly with vortex before being placed in PCR apparatus. For negative control, the mixture of the PCR without the template of DNA was used; the conditions whichwere used for the amplification process for all genes aredescribed in table 2. The final products subjected directly to the electrophoresis.

Table 1.

Primers, sequence, accession number beside amplified molecular size; used in this study

Primer Name Forward Primer (5'.…. 3') Reverse Primer (5'.…. 3') Siz (bp) Accession number
16Sr DNA GGAAGAAGCTTGCTTCTTTGCTGAC AGCCCGGGGATTTCACATCTGACTTA 544 LC278376
fimH AATTGCCGTGCTTATTTTGCG AGGTTTTGGCTTTTCGCACAA 204 LR134208
fimD TCATCTGCCGAACTCTATTTT TTTTGCTACCTGATGATCTGT 595 CP034595
fimE AAACGTCGTTATCTTACCGG TTTCTTTCCCATAATCCGGC 550 AP022362
fimC GGGTAGAAAATGCCGATGGTG CGTCATTTTGGGGGTAAGTGC 477 CP054371
fimA AAATTAAAACTCTGGCAATCGT TCCGTTATTCAGGGTTGTTT 446 LR883000
fimB CGAATCACTCCTTAAAGCA GGCGTAACATGT GCGGA 379 MK301554
fimG GCGATCTTTATTCTTTCAGTCT TGTAGGTATAGGTGATGCTAAT 348 CP061337
fimI GGTGCCTTTTGTTATTCATTTAC GATATTTGGCGATGAAATGTAG 251 CP059137
fimF CTGAATCAACCAATTTTACTGTT CATTAAGGGGTATCTGATTTTG 261 CP018252

Table 2.

PCR programs used for amplification E. coli type 1 fimbrial genes

Amplified genes Initial denaturation Cycles No. Denaturation Annealing Elongating extension
16Sr DNA 95 ºC for 5 min 30 94 ºC for 30 sec 55 ºC for 30 sec 72 ºC for 1 min 72ºC for 7 min
fimH 94 ºC for 5 min 40 94 ºC for 30 sec 58 ºC for 30 sec 72 ºC for 1 min 72ºC for 7 min
fimE 94 ºC for 5 min 35 94 ºC for 30 sec 55 ºC for 30 sec 72 ºC for 1 min 72ºC for 5 min
fimB 94 ºC for 5 min 35 94 ºC for 30 sec 60 ºC for 30 sec 72 ºC for 1 min 72ºC for 5 min
fimD 94 ºC for 5 min 40 94 ºC for 30 sec 55 ºC for 1min 72 ºC for 1 min 72ºC for 7 min
fimI 94 ºC for 5 min 35 94 ºC for 30 sec 55 ºC for 1min 72 ºC for 1 min 72ºC for 5 min
fimG 95 ºC for 5 min 40 94 ºC for 30 sec 54 ºC for 30 sec 72 ºC for 1 min 72ºC for 7 min
fimF 95 ºC for 5 min 40 94 ºC for 30 sec 54 ºC for 30 sec 72 ºC for 1 min 72ºC for 7 min
fimC 95 ºC for 5 min 35 94 ºC for 30 sec 60 ºC for 30 sec 72 ºC for 1 min 72ºC for 7 min
fim A 94 ºC for 5 min 35 94 ºC for 30 sec 60 ºC for 30 sec 72 ºC for 1 min 72ºC for 7 min

The PCR product for the amplified genes (stored at -20ºc) was sequenced by sending 25µl of the amplified product to Macrogen, Korea. Data were analyzed using Geneious software and the results were read by comparing them with the NCBI control standard strains. Query, pairwise alignment and identity, were anatomized with same software.

3. Results

3.1. E. coli Identification

16s rRNA was used as HKG for genotypic identification for UPEC isolates which were exposed, and all the isolates (100%) showed a positive result with expected amplicon size reached 544 bp as were matched with 100 bp DNA ladder; The pairwise identity was 96.6%, which represent exemplify residues percentage that were identical in alignment with gaps versus non-gap residue (Figure 1A and 1B). Some of the differences appeared between local isolate and recorded NCBI strain; as with a gap appeared within the nucleotides which it may be due to the sequencing process. The pairwise identity and the DNA sequencing for 16s rRNA gene matched with the standard strain E. coli taxon: 562, LC278376 (NCBI) (Figure 1B).

Figure 1.

Figure 1

A: Genotypic identification for UPEC isolates, B: Pairwise identity and the DNA sequencing for 16s rRNA gene matched with the standard strain E.

3.2. Attachment Ability of UPEC

All the tested isolates were able to attach to the epithelial cells. The fim operon (Adhesive factor genes) can be used as a genetic marker in the investigations of UPEC that cause UTI.

3.3. fimA Operon Genes Result (Genotypic Detection and Data Analysis)

The results showed that all the isolates (100%) were positive for fimA, fimI, fimC, fimD, fimG and fimH; While 96% of them were positive for fimB and fimF, and 82% for fimE.

The sequences of fimB gene for E. coli isolates were displayed in Figure 2A. Sequence comparison was done between DNA segment of the current study and the standard strain (MK301554) in which pairwise identity reached 98.3% that represented the percentage of the residues identical in alignments including gap verses non-gap residues (Figure 2B). Few gaps were noticed between the local isolates and the standard strain.

Figure 2.

Figure 2

A: Gel electrophoresis of DNA segment of the fimB and the standard strain (MK301554) B: Pairwise identity and nucleotide sequence for fimB as compared with the standard NCBI E. coli strain MK301554

fimE gene percentage reached 82% in the current study, and some of the positive results are pointed in Figure 3A, the expected size in the agarose gel was 550 bp amplicon as compared with DNA ladder; Pairwise identity was 95% with few differences documented between local isolate and NCBI strain (AP022362) (Figure 3B).

Figure 3.

Figure 3

A: Amplified PCR amplicon of fimE gene with molecular size reached 550 bp, B: Pairwise identity and nucleotide sequence for fimE as compared with the standard NCBI E. coli strain AP022362.

fimA gene is another fim gene from this operon that was studied; It is encoding a major subunit. Results demonstrated that 100% of E. coli isolates harbored this gene with probable size of 446 bp amplicon (Figure 4A); Besides, the sequence of the amplified fimA gene was analyzed and compared with standard strain (LR883000) (Figure 4B). Pairwise identity was 100%, which represented the percentage of the residues identical in alignments.

Figure 4.

Figure 4

A: Amplified PCR amplicon of fimA gene with molecular size reached 446 bp, B: Pairwise identity and nucleotide sequence for fimA as compared with the standard NCBI E. coli strain LR883000.

fimI, which encodes the structural components, was the next amplified gene. Amplification of fimI gene showed that 100% of UPEC isolates comprised of this gene. Figure 5A displays positive shine band for fimI with probable amplified size of 251 bp; fimI sequence of UPEC was presented in Figure 5B. The comparison was performed between this DNA segment and standard strain CP059137. The Pairwise identity was 100% for precise size of 329 bp with indifferences between the local isolate and the recorded NCBI strain as no gaps appeared in the Query identity line.

Figure 5.

Figure 5

A: Amplified PCR amplicon of fimI gene with molecular size reached 251 bp, B: Pairwise identity and nucleotide sequence for fimI as compared with the standard NCBI E. coli strain CP057888.

Results of fimC exhibited that 100% of the isolates were harboring this gene. Figure 6A shows an amplified PCR amplicon of fimC gene with molecular size reached 477 bp. fimC gene sequence of E. coli was analyzed and is shown in Figure 6B. The comparison was done between DNA segment and standard strain (CP054371).

Figure 6.

Figure 6

A: Amplified PCR amplicon of fimC gene with molecular size reached 477 bp, B: Pairwise identity and nucleotide sequence for fimC as compared with the standard NCBI E. coli strain CP054371.

fimD results revealed that it was appeared in 100% of the isolates as with fimC. Figure 7A demonstrates the PCR product for fimD gene with its amplified size 595 bp as compared with 100 bp DNA ladder. Pairwise identity and nucleotide sequence for fimD as compared with the standard NCBI E. coli strain CP034595 (Figure 7B).

Figure 7.

Figure 7

A: Amplified PCR amplicon of fimD gene with molecular size reached 595 bp, B: Pairwise identity and nucleotide sequence for fimD as compared with the standard NCBI E. coli strain CP034595.

fimF was expressed in most of the local isolates (96%,) and the product size was about 261 bp fimF sequence was analyzed and showed visually in figure 8A. The pairwise identity was 98% (Figure 8B). The occurrence rate for fimG gene was 100% in all UPEC isolates.

Figure 8.

Figure 8

A: Amplified PCR amplicon of fimF gene with molecular size reached 261 bp, B: Pairwise identity and nucleotide sequence fimF as compared with the standard NCBI E. coli strain CP018252.

Figure 9A demonstrates PCR product for the amplified fimG fragment and it was approximately equivalent to 348 bp comparing to 100bp DNA ladder. For the alignment, the comparison was done between the amplified DNA segment in the current study and standard strain (CP061337) (Figure 9B). No much distinct changes were observed between local and NCBI strain, while pairwise identity reached 98.5% that represents the percentage of residues identical in their alignments.

Figure 9.

Figure 9

A: amplified PCR amplicon of fimG gene with molecular size reached 348 bp, B: Pairwise identity for fimG as compared with standard NCBI E. coli strain CP061337.

fimH was the last gene in type 1 operon genes coding fimbriae; Results indicated that all isolates harboring fimH gene (100%). Figure 10A epitomizes positive result for fimH gene with an amplified size of 204 bp, and its sequence was analyzed. Pairwise identity was 99.09%. Two gaps have been detected in DNA sequence in green lines as matched with the standard strain LR134208; First gap was at 73 bp and next one at 157bp ( Figure 10B).

Figure 10.

Figure 10

A: amplified PCR amplicon of fimH gene with molecular size reached 204 bp, B: Pairwise identity for fimH as compared with standard NCBI E. coli strain LR134208.

4. Discussion

Type 1 fimbria is a very essential in biofilm formation, principally fimH gene ( 10 ). As with current study, Al-Marjani ( 11 ) studied the adherence of E. coli that were isolated from the children suffered from diarrhea within hospitals in Iraq. The results of a study conducted by Al-Marjani ( 11 ) indicated that all tested isolates (100%) exposed an adhesion ability to epithelial cells. The results of Al-Musawi and Al-Jubori ( 12 ) presented the adhesion ability of E. coli isolates to the epithelial cells that have been occurred in all isolates and the rate was 100%. Bacterial adhesion to the cells of the host is the essential VFs and is considered the first step in colonization process ( 1 ).

The study of Al-Musawi and Al-Jubori ( 12 ) showed that 93% of the isolates contain fimB; Their PCR result explained that 85% of UPEC were harboring fimE gene. Their study revealed high frequency of type 1 fimbriae genes in isolates from Baghdad hospitals. These results are highly related to this study. Consequently, none of isolates in the current study was negative for both fimB and fimE genes, besides any UPEC isolate which did not harbored one of the two genes, should be absolutely contained the other one. In many cases, fimE exposed the switching of initiation phase from OFF to ON or might be when exact amino acid substitutions were make fimS orientation in phase OFF position which can lead to antisense transcripts production from fimA promoter ( 13 ). fimE and fimB might be act independently for switching fimS element from ON to OFF phase by9bp invertible repeated elements, thus, those genes percentage were relatively different in current study ( 14 ). Site-specific recombination allows the occurrence of phase variation which involves two transacting factors positioned nearly upstream fimS invertible element that are encoded by fimB, and fimE ( 15 ). Lower than the expression of fimB might mean the ratio of fimB to fimE will change to favor fimE and subsequent phase OFF orientation of fimS region., with fimS region being switched to phase OFF orientation combined with direct regulation of fimA transcription that losing type 1 fimbria over times in UPEC isolates from infected kidneys would be occur ( 16 ). Although some experiments showed that change in phase from OFF to ON switching increased at lower temperatures, some researchers revealed that fimA promoter element is biased in its switching from ON to OFF phase orientation in broth cultures that were grown at 20°C, however the switches favors fimB recombination at 37°C ( 17 ).

fimA is a pilin structural gene which encodes 158-159 amino acid polypeptides about 17 kD in molecular weight ( 14 ). Directly upstream of fimA, 314bp invertible elements (fimS), which it contained promoter of fimA with 9bp inverted repeats (IRs), flanking this segment of DNA ( 18 ). The increasing fimA transcript levels have been attributed to the transcriptional attenuation between fimA and fimI ( 19 ). fimA promotor sequence undergo site specific recombination positioning invertible elements in piliated (Phase ON) or non-piliated (Phase OFF) orientations ( 20 ).

Amplification of fimI gene showed that 100% of UPEC isolates comprised this gene, fimI products are necessary for E. coli during type 1 fimbriae biosynthesis. Graffeuil et al. ( 21 ) reported that the reduction of up to 43 fold in the expression of the fim machinery was related to the measurement of the expression of fimI. It is a pilus anchor termination subunit ( 22 ).

fimC and fimD genes are involved in transportation and the assembly of type 1 fimbriae within the cluster of fim gene, fimC gene was presented in all isolates. This result is very similar to Al-Musawi and Al-Jubori study ( 12 ) who reported that their results showed 100% of isolates were harboring fimC. While Li et al. ( 23 ) detected the fimC gene in 46.4% of E. coli tested isolates. This gene is considered as member of the periplasmic chaperone family. Besides, it works in chaperone usher pathway; it is indispensable in biogenesis of type 1 pilus of E. coli. It binds to individual pilus subunits and then form stable complex in donor strand complementation process ( 24 ). Mutations in fimC, apparently affected the translocation of structural fimbrial components; fimC deficient in host cells periplasm contained the similar amount of fimA protein as in periplasm ( 25 ). Superficial cells had problem with coping with fimA presence, when fimC was unavailable, that it means the transcription of fimB in the infected bladders showed a trend similar to the fimA expression results. Unlike the fimA and fimB transcription results in UPEC infected bladders, fimE transcription was much lower than either fimA or fimB ( 16 ). fimD results revealed that it appeared in 100% of the isolates; Al-Musawi and Al-Jubori ( 12 ) subjected a percentage of 100% for the same gene, which agreed with this result. fimD gene encodes the integral outer membrane protein that serves as usher ( 26 ). The sequence of fimD demonstrated a high degree of homology to papC chaperone associated to the pilus system in UPEC ( 27 ).

fimF involved in regulation of length and mediation of adhesion of type 1 fimbriae (but not necessary for the production of fimbriae); It is involved in the integration of fimH ( 28 ). E. coli isolates lacking fimF and fimG, will produce an adhesive fimbria on their surface; although, fimF mutation in bacteria will give fewer fimbriae, as well as isolates missing fimG produce longer fimbriae. The fimbriae that were produced In both mutants, were functional and adhesive ( 29 ). Jadhav et al. ( 30 ) reported that (45%) E.coli isolated from UTIs were expressed fimH,but their percentage was much lower than in current study, while the percentage of it inthis study is identical with Salih ( 9 ) who established that 100% of E. coli isolates were harbored fimH gene. fimF, fimG and fimH are notnecessary for fimbriae production, but they were involved in adhesive property and the longitudinalregulation of this structure ( 28 ). The existence of fimG, while either fimF or fimH were not existed, is sufficient for type 1 fimbriae assembly. However, the detection of surface-assembled fimbriae in fimF, fimG double mutant E. coli isolates indicated that these isolates need fimA and fimH only for the fimbriae assembly ( 31 ). One of the main and most important strategies for UPEC infection reduction was the targeting of bacterial adhesion via inhibition of fimH gene ( 32 ). Another researchers have been detected the changes in fimH gene expression and they have found that fimH suppression was leading to the loss of fimbriae ( 33 ).

This highest percentage in current study may prove the reason that it can contain the attachment of E.coli to mucosal surfaces and initiates the UTI infection. Bacterial ability of transition from reversible to irreversible adhesion is very critical for initiating microcolony formation. Irreversible attachment will lead to alteration in compositions of E.coli outer membrane proteins ( 34 ). Staerk et al.( 5 ) found that the lack of type 1 fimbriae for the duration of planktonic growth in mouse and human urine specimens was a universal phenomenon for UPEC, which strongly reduced its adhesion to the bladder cell and the invasive potential. Many human commensals isolates that were positive for fimH, exposed lacking in type 1 fimbriae because of either deletion or lack expression of at least one of fim operon genes ( 4 ).

Approximately, all UPEC have type 1fimbrial genes thus it could be used as a genetic marker in the investigation of E.coli adhesion ability. The isolates harbored at least five to six of fimA operon genes that increase the efficiency for attachment ability to epithelial cells.

Authors' Contribution

Study concept and design: S. A. R. H.

Acquisition of data: S. A. R. H.

Analysis and interpretation of data: S. S. A.

Drafting of the manuscript: J. A. S. S.

Critical revision of the manuscript for important intellectual content: S. A. R. H.

Statistical analysis: S. S. A.

Administrative, technical, and material support: S. A. R. H.

Ethics

All procedures performed in this study involving human participants were in accordance with the ethical standards of the Baghdad University, Baghdad, Iraq.

Conflict of Interest

The authors declare that they have no conflict of interest.

Grant Support

The work was not funded.

Acknowledgement

The authors would like to thank the Department of Biology/College of Science, Mustansiriyah University/ Iraq (https://uomustansiriyah.edu.iq/) for their support to complete this work.

References

  • 1.Weiss G, Schaible UE. Macrophage defense mechanisms against intracellular bacteria. Immunol Rev. 2015;264(1):182–203. doi: 10.1111/imr.12266. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Flores-Mireles AL, Walker JN, Caparon M, Hultgren SJ. Urinary tract infections: epidemiology, mechanisms of infection and treatment options. Nat Rev Microbiol. 2015;13(5):269–84. doi: 10.1038/nrmicro3432. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Bader MS, Loeb M, Brooks AA. An update on the management of urinary tract infections in the era of antimicrobial resistance. Postgrad Med. 2017;129(2):242–58. doi: 10.1080/00325481.2017.1246055. [DOI] [PubMed] [Google Scholar]
  • 4.Pusz P, Bok E, Mazurek J, Stosik M, Baldy-Chudzik K. Type 1 fimbriae in commensal Escherichia coli derived from healthy humans. Acta Biochim Pol. 2014;61(2) [PubMed] [Google Scholar]
  • 5.Stærk K, Khandige S, Kolmos HJ, Møller-Jensen J, Andersen TE. Uropathogenic Escherichia coli express type 1 fimbriae only in surface adherent populations under physiological growth conditions. J Infect Dis. 2016;213(3):386–94. doi: 10.1093/infdis/jiv422. [DOI] [PubMed] [Google Scholar]
  • 6.Lomberg H, Cedergren B, Leffler H, Nilsson B, Carlström A, Svanborg-Eden C. Influence of blood group on the availability of receptors for attachment of uropathogenic Escherichia coli. Infect Immun. 1986;51(3):919–26. doi: 10.1128/iai.51.3.919-926.1986. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Andersson B, Aniansson G, Jodal U, Lomberg H, Linder H, de Man P. Bacterial adherence in urinary and respiratory tract infection. J Japn Assoc Infect Dis. 1988;62:136–48. [PubMed] [Google Scholar]
  • 8.Garallah ET, Al-Jubori SS. Surveillance of murA and the plasmid-mediated fosfomycin resistance fosA gene in uropathogenic E. coli isolates from UTI patients. Gene Rep. 2020;21:100872. [Google Scholar]
  • 9.Salih EG. Prevalence Genotyping of Escherichia coli Fimbriae Isolated From Iraqi Patients With Urinary Tract Infections. Iraq: University of Baghdad; 2015. [Google Scholar]
  • 10.Tewawong N, Kowaboot S, Pimainog Y, Watanagul N, Thongmee T, Poovorawan Y. Distribution of phylogenetic groups, adhesin genes, biofilm formation, and antimicrobial resistance of uropathogenic Escherichia coli isolated from hospitalized patients in Thailand. Peer J. 2020;8:e10453. doi: 10.7717/peerj.10453. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Al-Marjani MF. A genetic and bacteriological study on Serratia marcescens isolated from clinical sources and the possibility of transferring some virulence traits from Escherichia coli O157:H7 to it. Iraq: Al-Mustansiriya University; 2005. [Google Scholar]
  • 12.Al-Musawi D, Al-Jubori SS. Molecular Analysis of Type 1 Fimbriae Operon in E. coli Isolated from UTI. J Glob Pharm Technol. 2019;11(4):472–83. [Google Scholar]
  • 13.Nepper JF. Roles of bacterial physiology in inter-and intra-species ecology of microbes: The University of Wisconsin-Madison. 2017. [Google Scholar]
  • 14.Schwan WR. Regulation of fim genes in uropathogenic Escherichia coli. World J Clin Infect Dis. 2011;1(1):17. doi: 10.5495/wjcid.v1.i1.17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Schwan WR, Beck MT, Hung CS, Hultgren SJ. Differential regulation of Escherichia coli fim genes following binding to mannose receptors. J Pathog. 2018;2018 doi: 10.1155/2018/2897581. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Schwan WR, Ding H. Temporal regulation of fim genes in uropathogenic Escherichia coli during infection of the murine urinary tract. J Pathog. 2017;2017 doi: 10.1155/2017/8694356. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Olsen PB, Schembri MA, Gally DL, Klemm P. Differential temperature modulation by H-NS of the fimB and fimE recombinase genes which control the orientation of the type 1 fimbrial phase switch. Microbiol Lett. 1998;162(1):17–23. doi: 10.1111/j.1574-6968.1998.tb12973.x. [DOI] [PubMed] [Google Scholar]
  • 18.Wu I. Determining the effect of the loss of small RNAs OmrA and OmrB on type 1 pili expression in Escherichia coli. USA: Wisconsin; 2017. [Google Scholar]
  • 19.Schembri M, Ussery D, Workman C, Hasman H, Klemm P. DNA microarray analysis of fim mutations in Escherichia coli. Mol Genet Genom. 2002;267(6):721–9. doi: 10.1007/s00438-002-0705-2. [DOI] [PubMed] [Google Scholar]
  • 20.Li Y, Zhang M, Luo J, Chen J, Wang Q, Lu S, et al. Antimicrobial resistance of Escherichia coli isolated from retail foods in northern Xinjiang, China. Food Sci Nutr. 2020;8(4):2035–51. doi: 10.1002/fsn3.1491. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Graffeuil A, Uhlin BE, Cisneros DA. Polar mutagenesis of bacterial transcriptional units using Cas12a. bioRxiv. 2020 doi: 10.1186/s12934-022-01844-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Z B. Mechanism of FimI, the assembly termination subunit of the type 1 pili from uropathogenic Escherichia coli. (Doctoral dissertation. Glockshuber: Rudolf University; 2015. [Google Scholar]
  • 23.Marinello W, Feng L, Allen TK. Progestins Inhibit Interleukin-1β-Induced Matrix Metalloproteinase 1 and Interleukin 8 Expression via the Glucocorticoid Receptor in Primary Human Amnion Mesenchymal Cells. Front Physiol. 2020;11:900. doi: 10.3389/fphys.2020.00900. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Costa TR, Felisberto-Rodrigues C, Meir A, Prevost MS, Redzej A, Trokter M, et al. Secretion systems in Gram-negative bacteria: structural and mechanistic insights. Nat Rev Microbiol. 2015;13(6):343–59. doi: 10.1038/nrmicro3456. [DOI] [PubMed] [Google Scholar]
  • 25.Klemm P. FimC, a chaperone-like periplasmic protein of Escherichia coli involved in biogenesis of type 1 fimbriae. Res Microbiol. 1992;143(9):831–8. doi: 10.1016/0923-2508(92)90070-5. [DOI] [PubMed] [Google Scholar]
  • 26.Werneburg GT, Henderson NS, Portnoy EB, Sarowar S, Hultgren SJ, Li H, et al. The pilus usher controls protein interactions via domain masking and is functional as an oligomer. Nat Struct Biol. 2015;22(7):540–6. doi: 10.1038/nsmb.3044. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Chahales P, Thanassi DG. Structure, function, and assembly of adhesive organelles by uropathogenic bacteria. Microbiol Spectr. 2015;3(5) doi: 10.1128/microbiolspec.UTI-0018-2013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Klemm P, Christiansen G. Three fim genes required for the regulation of length and mediation of adhesion of Escherichia coli type 1 fimbriae. Molecular and General Genetics MGG. 1987;208(3):439–45. doi: 10.1007/BF00328136. [DOI] [PubMed] [Google Scholar]
  • 29.Russell PW, Orndorff PE. Lesions in two Escherichia coli type 1 pilus genes alter pilus number and length without affecting receptor binding. J Bacteriol. 1992;174(18):5923–35. doi: 10.1128/jb.174.18.5923-5935.1992. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Jadhav S, Hussain A, Devi S, Kumar A, Parveen S, Gandham N, et al. Virulence characteristics and genetic affinities of multiple drug resistant uropathogenic Escherichia coli from a semi urban locality in India. PloS one. 2011;6(3):e18063. doi: 10.1371/journal.pone.0018063. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Zeiner SA, Dwyer BE, Clegg S. FimA, FimF, and FimH are necessary for assembly of type 1 fimbriae on Salmonella enterica serovar Typhimurium. Infect Immun. 2012;80(9):3289–96. doi: 10.1128/IAI.00331-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Terlizzi ME, Gribaudo G, Maffei ME. UroPathogenic Escherichia coli (UPEC) infections: virulence factors, bladder responses, antibiotic, and non-antibiotic antimicrobial strategies. Front Microbiol. 2017;8:1566. doi: 10.3389/fmicb.2017.01566. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Azam MW, Zuberi A, Khan AU. bolA gene involved in curli amyloids and fimbriae production in E. coli: exploring pathways to inhibit biofilm and amyloid formation. J Biolog Res. 2020;27(1):1–12. doi: 10.1186/s40709-020-00120-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Otto K, Norbeck J, Larsson T, Karlsson K-A, Hermansson M. Adhesion of type 1-fimbriated Escherichia coli to abiotic surfaces leads to altered composition of outer membrane proteins. J Bacteriol. 2001;183(8):2445–53. doi: 10.1128/JB.183.8.2445-2453.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Archives of Razi Institute are provided here courtesy of Razi Vaccine and Serum Research Institute

RESOURCES