ABSTRACT
Rabies is an old zoonotic disease caused by rabies virus (RABV), but the pathogenic mechanism of RABV is still not completely understood. Lipid droplets (LDs) have been reported to play a role in pathogenesis of several viruses. However, their role in RABV infection remains unclear. Here, we initially found that RABV infection upregulated LD production in multiple cells and mouse brains. After treatment with atorvastatin, a specific inhibitor of LDs, RABV replication in N2a cells decreased. Then we found that RABV infection could upregulate N-myc downstream regulated gene-1 (NDRG1), which in turn enhanced the expression of diacylglycerol acyltransferase 1/2 (DGAT1/2). DGAT1/2 could elevate cellular triglyceride synthesis and ultimately promote intracellular LD formation. Furthermore, we found that RABV-M and RABV-G, which were mainly involved in the viral budding process, could colocalize with LDs, indicating that RABV might utilize LDs as a carrier to facilitate viral budding and eventually increase virus production. Taken together, our study reveals that lipid droplets are beneficial for RABV replication, and their biogenesis is regulated via the NDRG1-DGAT1/2 pathway, which provides novel potential targets for developing anti-RABV drugs.
IMPORTANCE Lipid droplets have been proven to play an important role in viral infections, but their role in RABV infection has not yet been elaborated. Here, we find that RABV infection upregulates the generation of LDs by enhancing the expression of N-myc downstream regulated gene-1 (NDRG1). Then NDRG1 elevated cellular triglycerides synthesis by increasing the activity of diacylglycerol acyltransferase 1/2 (DGAT1/2), which promotes the biogenesis of LDs. RABV-M and RABV-G, which are the major proteins involved in viral budding, could utilize LDs as a carrier for transport to cell membrane, resulting in enhanced virus budding. Our findings will extend the knowledge of lipid metabolism in RABV infection and help to explore potential therapeutic targets for RABV.
KEYWORDS: rabies virus, lipid droplets, biogenesis, N-Myc downstream-regulated gene 1, diacylglycerol acyltransferase, viral budding
INTRODUCTION
Rabies, caused by rabies virus (RABV), is a well-known fatal neurological disease that has been recorded in human history for thousands of years. Although postexposure prophylaxis (PEP) can effectively prevent most cases of rabies (1), death is inevitable after the onset of clinical symptoms once PEP is failure. RABV is a member of the Lyssavirus genus in the Rhabdoviridae family and has a nonsegmented negative-sense RNA genome, which encodes five structural proteins: nucleoprotein (N), phosphoprotein (P), matrix protein (M), glycoprotein (G), and large polymerase (L) (2). RABV-N encapsulates the RNA genome to form an N-RNA complex known as ribonucleoprotein (RNP), which is condensed into a helical nucleocapsid along with RABV-L and RABV-P. RABV-M forms a bridge between the nucleocapsid and the viral envelope and is the main factor in the budding of virus particles (3, 4). RABV-G interacts with RABV-M and is the only protein exposed on the surface of the RABV envelope (5), which is the sole ligand for viral binding to the cellular receptor. Viral budding is a very complicated process, and it has been demonstrated that the RABV-M lattice promotes membrane bending to form budding sites, while RABV-G supports this process by promoting the formation of the RABV-M lattice to accelerate viral budding (6, 7). However, whether other cellular molecules participate in RABV assembly and budding remains elusive.
Lipid droplets (LDs) are the main place for storing neutral lipids in cells and are surrounded by a monolayer of phospholipids (8). The main components of LDs are triglycerides and cholesterol esters, and the former are the main component of LDs in the central nervous system (CNS) (9). LDs are generated from the endoplasmic reticulum (ER), which is initially synthesized by fatty acids (FAs) to sequentially form monoacylglycerol (MAG), diacylglycerol (DAG), and triacylglycerol (TAG), and the rate-limiting enzymes in this process are diacylglycerol acyltransferase 1 (DGAT1) and DGAT2 (10). There are several structural proteins consisting of five perilipins (PLIN1 to −5), which are differentially expressed on the surface of LDs in different tissues and cells (11). LDs can contact organelles such as the Golgi apparatus, mitochondria, and peroxisomes to participate in cell metabolism. It is reasonable for the virus to hijack the host's metabolism to benefit its replication, but not many studies on viruses and LDs have been performed. Recent studies have also shown that LDs can act as a platform to recruit viral proteins, accelerate virus assembly, and eventually increase virus production (12, 13). Nevertheless, whether LDs play a role in RABV replication remains unclear.
The N-myc downstream-regulated gene (NDRG) family consists of four members, including NDRG1 to −4 (14). They all play important functions in regulating cell proliferation, apoptosis, stress, and differentiation. As a member of the NDRG family, NDRG1 has been widely studied, especially in cancer fields (15). Acting as a tumor suppressor, NDRG1 can promote tumor cell apoptosis through the p53, transforming growth factor β (TGF-β), and Wnt signaling pathways, which also inhibit stress-induced autophagy in cancer cells (16). Additionally, NDRG1 has enhanced effects in viral infections (17, 18). Recently, NDRG1 has been shown to play an important role in the differentiation of hippocampal neurons and astrocytes in the central nervous system (19, 20). For hepatitis C virus (HCV) infection, NDRG1 has also been reported to regulate lipid droplet biogenesis (21). In breast cancer cells, it was linked to the elevated rates of metastasis and patient mortality by regulating lipid metabolism and lipid droplet formation (22). However, whether NDRG1 affects the related enzymes involved in fatty acid synthesis and lipid droplet formation is still unclear.
In the present study, we found that RABV infection can promote LD formation to facilitate virus budding, and LD biogenesis was regulated via the NDRG1-DGAT1/2 pathway. This finding will reveal the important role of LDs in RABV replication and extend our knowledge of lipid metabolism in viral infection.
RESULTS
RABV infection increases LD production both in vivo and in vitro.
To investigate whether RABV infection induces LD formation, C57BL/6 mice were infected with RABV at 6 × 104 focus-forming units (FFU) by intramuscular (i.m.) injection, and Dulbecco’s modified Eagle’s medium (DMEM) was used as the negative control. Mouse brains were collected at the moribund stage, and each brain was divided into two parts by cutting in a sagittal plane. One part was stained with Oil Red O, and significantly more LDs were observed in RABV-infected brains compared with mock-infected brains (Fig. 1A). Simultaneously, the other part was collected for viral RNA quantification by reverse transcription-quantitative PCR (RT-qPCR). As shown in Fig. 1B, significantly higher levels of viral RNA were observed in RABV-infected mouse brains than in mock-infected mouse brains, indicating that the upregulation of LD was correlated with RABV infection. Furthermore, to confirm whether this observation is consistent with the phenotype in cell lines, murine neuroblastoma N2a cells (N2a cells) were infected with RABV at a multiplicity of infection (MOI) of 1 for 24 h and stained with BODIPY 493/503 for LDs. Indeed, the number of cellular LDs (Fig. 1C) and the mean fluorescence intensity of LDs (Fig. 1D) were upregulated after RABV infection.
FIG 1.
RABV infection increases LD production both in vivo and in vitro. (A) C57BL/6 mice were infected i.m. with RABV at 6 × 104 FFU, and the same volume of DMEM was inoculated as the negative control. Mouse brains were collected at the moribund stage and stained with Oil Red O by cutting in a sagittal plane (n = 3). (B) Mouse brains were collected, and viral RNA was quantified by qPCR (n = 3). (C) N2a cells were infected with RABV at an MOI of 1 for 24 h, and cells were stained with BODIPY 493/503, DAPI, and an anti-RABV-P antibody for confocal microscopy. (D) Random fields of view were recorded to calculate the mean fluorescence intensity of LDs (n = 5). Mouse brains were collected for quantification of the mRNA levels of PLIN2 (E) and PLIN3 (F) by qPCR (n = 3). N2a cells were infected with RABV at an MOI of 1 for 24 h, and cells were harvested to assess PLIN2 (G) and PLIN3 (H) mRNA levels by qPCR (n = 3). SK-N-SH cells were infected with RABV at an MOI of 1 for 24 h, and cells were harvested to assess PLIN2 (I) and PLIN3 (J) mRNA levels by qPCR (n = 3). Error bars represent mean ± standard deviation (SD). Statistical significance was determined by Student's t test and is notated as follows: **, P < 0.01; ***, P < 0.001; and ****, P < 0.0001. Scale bar, 5 μm.
Surface structural proteins of the LDs, including PLIN1 to −5, were also measured by qPCR. Periplin 2 (PLIN2) and PLIN3 in the mouse brains upregulated significantly after RABV infection, as shown in Fig. 1E and F. N2a cells were then infected with RABV at an MOI of 1 for 24 h, and PLIN2 and PLIN3 expression was assessed by qPCR, as shown in Fig. 1G and H. Furthermore, to confirm this phenomenon is not specific in N2a cells, a human neuronal cell line, SK-N-SH, was also infected with RABV at an MOI of 1 for 24 h, and PLIN2 and PLIN3 expression was assessed by qPCR, as shown in Fig. 1I and J. Both PLIN2 and PLIN3 mRNA levels were upregulated in N2a cells and SK-N-SH cells, respectively, after RABV infection. Taken together, the above results indicate that RABV infection can enhance LD production.
Inhibition of LDs suppresses RABV infection.
To further confirm the role of LD accumulation in RABV infection, atorvastatin, an LD inhibitor, as reported previously (23), was used to reduce cellular LD abundance and to evaluate the effect of LDs on RABV infection. Initially, N2a cells were incubated with 5 or 10 μM atorvastatin, and no significant effect on cell viability was observed, as shown in Fig. 2A. A fluorescence assay was then used to verify the LD inhibition effect of atorvastatin. As shown in Fig. 2B, the fluorescence intensities of LDs were significantly decreased in cells treated with atorvastatin. Correspondingly, the fluorescence of RABV-P was also sharply reduced in cells treated with atorvastatin (Fig. 2C). Moreover, cell supernatants were collected for virus titration, and the mean viral titers in cells treated with 0, 5, and 10 μM atorvastatin were 105.92, 105.25, and 105.17 FFU/mL at 24 h postinfection (hpi) and 106.33, 105.67, and 105.58 FFU/mL at 48 hpi, respectively (Fig. 2D). In addition, viral RNA (vRNA) levels were also determined by qPCR assay, as shown in Fig. 2E, and were consistent with the results of virus titration. Together, the results demonstrate that inhibition of LD formation can suppress RABV infection.
FIG 2.
Inhibition of LDs suppresses RABV infection. (A) N2a cells were incubated with atorvastatin dissolved in DMSO at 5 and 10 μM for 48 h, and cell viability was assessed by a Cell Counting kit-8 (CCK-8) assay (n = 3). (B) N2a cells were treated with atorvastatin at 5 and 10 μM for 3 h and infected with RABV at an MOI of 0.1. LD inhibition was assessed by a fluorescence assay, and the mean fluorescence intensities of LDs were calculated (n = 3). (C) Fluorescence images to assess the viral titers. Incubated cells were stained with DAPI for nucleus detection, BODIPY 493/503 for LD detection, and anti-RABV-P antibody for RABV detection. (D) Incubated cells were infected with RABV at an MOI of 0.1 for 24 and 48 h, cell supernatants were harvested to quantify the viral titers (n = 3), and (E) cells were collected to assess the vRNA level by qPCR (n = 3). Error bars represent mean ± SD. Statistical significance was determined by one-way ANOVA and is notated as follows: *, P < 0.05; **, P < 0.01; ***, P < 0.001; ****, P < 0.0001; and ns, not significant. Scale bar, 100 μm.
RABV infection increases NDRG1 expression in neuronal cell lines and primary neurons.
NDRG1 has been reported to play an important role in regulating LD formation during viral infection (21, 24). Our previous transcriptome sequencing (RNA-seq) analysis of RABV-infected N2a cells showed that NDRG1 was upregulated after RABV infection in N2a cells (25). To verify this observation, N2a cells were infected with RABV (CVS-B2c strain) at an MOI of 1 for 24 and 48 h, after which they were harvested to measure the mRNA and protein expression levels of NDRG1 after RABV infection. As shown in Fig. 3A and B, significantly higher levels of NDRG1 mRNA were observed in RABV-infected N2a cells at 24 and 48 hpi than in mock-infected cells, and the corresponding gray value ratios of NDRG1 to β-actin bands confirmed by Western blotting were 0.99, 1.74, and 0.92, respectively. Similarly, the mRNA and protein levels of NDRG1 were also determined in RABV-infected SK-N-SH cells. As shown in Fig. 3C and D, both the mRNA and protein levels of NDRG1 in RABV-infected SK-N-SH cells were elevated at 24 and 48 hpi compared to those in mock-infected cells. Furthermore, primary neurons were also cultured and infected with RABV, and significantly higher levels of NDRG1 mRNA were detected in RABV-infected primary neurons than in mock-infected primary neurons, as expected (Fig. 3E). Consistently, the protein expression levels of NDRG1 after RABV infection were elevated (Fig. 3F). Together, the above data indicate that NDRG1 is upregulated after RABV infection in both neuronal cell lines and primary neurons.
FIG 3.
RABV infection increases NDRG1 expression in neuronal cell lines and primary neurons. (A) N2a cells were infected with RABV at an MOI of 1 for the indicated times, total RNA was extracted to assess the NDRG1 mRNA level by qPCR (n = 3), and cell lysates were harvested to assess NDRG1 protein levels by Western blotting (B). (C) SK-N-SH cells were infected with RABV at an MOI of 1 for the indicated times. Total RNA was extracted to assess the NDRG1 mRNA level by qPCR (n = 3), and protein samples were collected for Western blotting (D). (E) Murine primary neurons were infected with RABV at an MOI of 1 for the indicated times (n = 3). Total RNA was extracted to analyze the NDRG1 mRNA level by qPCR. (F) Murine primary neuron lysates were collected to assess the NDRG1 protein level by Western blotting after infection with RABV at an MOI of 1 for the indicated times. Western blotting data are the representative results of two independent experiments. Error bars represent mean ± SD. Statistical significance was determined by Student's t test and is notated as follows: *, P < 0.05; **, P < 0.01; and ***, P < 0.001.
NDRG1 promotes RABV production by facilitating viral replication.
NDRG1 was found to upregulate after RABV infection, but its role in RABV infection is still unclear. N2a cells were transfected with pCAGGS-NDRG1 or empty vector for 24 h and then infected with RABV and incubated on ice for 1 h. Viral RNA was detected by qPCR to assess the effect of NDRG1 on viral attachment. As shown in Fig. 4A, no significant differences in viral RNA were observed between cells transfected with empty vector and those transfected with pCAGGS-NDRG1. To further evaluate whether NDRG1 could accelerate viral entry, transfected N2a cells were infected with RABV and incubated at 37°C for 2 h, and viral entry was assessed by detecting viral RNA with qPCR. As shown in Fig. 4B, no significant differences were observed between the cells transfected with empty vector and those transfected with pCAGGS-NDRG1. Finally, we examined the role of NDRG1 in RABV replication. Transfected N2a cells were infected with RABV and incubated at 37°C for 24 h, and the cells were then fixed for RABV detection with a fluorescent antibody. As shown in Fig. 4C, a greater number of RABV-positive fluorescent signals were observed in cells transfected with pCAGGS-NDRG1 than in those transfected with empty vector. Additionally, the mean fluorescence intensities were also calculated, as shown in Fig. 4D, which were consistent with the results of Fig. 4C. The above results indicate that NDRG1 facilitates RABV infection by enhancing viral replication rather than viral attachment or entry.
FIG 4.
NDRG1 promotes RABV production by facilitating viral replication. N2a cells were transfected with pCAGGS-NDRG1 or empty vector for 24 h and infected with RABV at an MOI of 0.1 at 4°C for 1 h to assess viral attachment (n = 3) (A) or at 37°C for 2 h to assess viral internalization by qPCR (n = 3) (B). (C) N2a cells were transfected with pCAGGS-NDRG1 or empty vector and then infected with RABV for the indicated times to assess viral replication by a direct immunofluorescence assay. Cells were stained with an anti-RABV-P antibody and DAPI. Random fields of view were recorded with a fluorescence microscope. (D) The mean fluorescence intensities of RABV-P (n = 6) in cells infected with RABV were calculated. (E) N2a cells were transfected with pCAGGS-NDRG1 or empty vector for 24 h and infected with RABV at MOI of 0.1 and 1 for 24 h. The supernatants of transfected cells infected with RABV were harvested to measure the viral titers (n = 4), and cell lysates were collected to detect the RABV-N by Western blotting (F). RABV-N/β-actin ratios were calculated by ImageJ according to the gray values of Western blotting bands. (G) N2a cells were transfected with siRNA, and the silencing efficiency was assessed by Western blotting. (H) N2a cells were transfected with siRNA for 24 h and infected with RABV at an MOI of 0.1 for 24 h. Cell supernatants were harvested for quantification of viral titers (n = 4). Error bars represent mean ± SD. Statistical significance was determined by Student's t test and is notated as follows: *, P < 0.05; **, P < 0.01; ***, P < 0.001; and ns, not significant. Scale bar, 100 μm.
To measure viral load in the cell culture supernatants, transfected cells were infected with RABV at an MOI of 0.1 or 1 for 24 h, after which the supernatants were harvested to determine viral titers. As shown in Fig. 4E, the mean viral titers in empty vector- and NDRG1-expressing vector-transfected cells were 104.25 and 105.25 FFU/mL (MOI of 0.1), and 105.63 and 106.13 FFU/mL (MOI of 1), respectively. These data indicate that overexpression of NDRG1 significantly increased viral titers. Additionally, RABV-N protein levels were also determined by Western blotting, as shown in Fig. 4F, and the gray value ratios of RABV-N to β-actin bands were 0.35 and 0.72 in empty vector- and NDRG1-transfected cells infected with RABV at an MOI of 0.1, respectively, while the gray value ratios of RABV-N to β-actin bands were 1.04 and 1.10 in empty vector- and NDRG1-transfected cells infected with RABV at an MOI of 1, respectively.
To evaluate the effect of NDRG1 silencing on RABV infection, two small interfering RNAs (siRNAs), siNDRG1-1 and siNDRG1-2, were synthesized, and the silencing efficiency was assessed by Western blotting. As shown in Fig. 4G, both siNDRG1-1 and siNDRG1-2 could efficiently knock down endogenous NDRG1. N2a cells were transfected with each siRNA and then infected with RABV, and culture supernatants were collected for virus titration. As shown in Fig. 4H, the mean viral titers in siNC-, siNDRG1-1-, and siNDRG1-2-transfected cells were 104.56, 104.19, and 103.88 FFU/mL, respectively, indicating that silencing NDRG1 could effectively reduce viral titers. Taken together, the results indicate that NDRG1 promotes RABV production through facilitating viral replication.
NDRG1 increases LD formation and has no effects on fatty acid synthesis and lipolysis.
To determine whether NDRG1 is involved in LD formation, pCAGGS-NDRG1 was transfected into N2a cells for 24 h, and BODIPY 493/503 was used for LD staining. As shown in Fig. 5A, the expression of NDRG1 increased cellular LD formation compared with mock-transfected cells, and the mean fluorescence intensities were also calculated, as shown in Fig. 5B. Furthermore, to uncover the role of NDRG1 in LD biosynthesis, N2a cells were transfected with pCAGGS-NDRG1 or empty vector and treated with the oleic acid (OA) for 24 h. Enzymes involved in fatty acid synthesis, including sterol regulatory element-binding transcription factor-1 (SREBP-1), which is known to induce de novo lipogenesis to generate free fatty acids (FFAs), fatty acid synthase (FAS), acetyl coenzyme A (acetyl-CoA) carboxylase (ACC), and stearoyl CoA desaturase (SCD), which are involved in fatty acid biosynthesis, were assessed by qPCR, respectively. As shown in Fig. 5C and D, no significant differences were observed between cells transfected with pCAGGS-NDRG1 and those transfected with empty vector. To investigate whether NDRG1 is involved in lipolysis, levels of adipose triglyceride lipase (ATGL), hormone-sensitive lipase (HSL), and monoglyceride lipase (MGL) were determined by qPCR. As shown in Fig. 5E, NDRG1 did not affect the transcriptional levels of these three enzymes associated with lipolysis. Taken together, these results indicate that NDRG1 is involved in LD biogenesis, but does not regulate fatty acid synthesis and lipolysis.
FIG 5.
NDRG1 increases LD formation and has no effects on fatty acid synthesis and lipolysis. (A) N2a cells were transfected with pCAGGS-NDRG1 or empty vector for 24 h. Cells were stained with DAPI for nuclei, stained with BODIPY 493/503 for LDs, and stained with anti-Flag antibody for NDRG1. The mean fluorescence intensities of LDs were calculated (n = 6) (B). N2a cells were transfected with pCAGGS-NDRG1 or empty vector for 24 h, and total RNA was isolated for quantification of the mRNA level of sterol regulatory element-binding transcription factor-1 (SREBP-1) (C), fatty acid synthase (FAS), acetyl-CoA carboxylase (ACC), and stearoyl CoA desaturase (SCD) (D), and adipose triglyceride lipase (ATGL), hormone-sensitive lipase (HSL), and monoglyceride lipase (MGL) (E) by qPCR (n = 3). Error bars represent mean ± SD. Statistical significance was determined by Student's t test and is notated as follows: ***, P < 0.001; and ns, not significant. Scale bar, 100 μm.
NDRG1 enhances LD formation by increasing triacylglycerol biogenesis.
DGAT1/2 catalyzes the final step in triglyceride biosynthesis. Compared with the N2a cells transfected with empty vector, N2a cells transfected with pCAGGS-NDRG1 significantly enhanced the mRNA levels of both DGAT1 and DGAT2 after treatment with OA, as shown in Fig. 6A and B. Consistently, the protein levels of DGAT1 and DGAT2 were also evaluated in cells transfected with pCAGGS-NDRG1, as shown in Fig. 6C, indicating that NDRG1 could increase DGAT1 and DGAT2 expression to enhance LD formation. Previous studies have demonstrated that the main component of LDs in the CNS is triacylglycerol (TG); therefore, the level of TG was measured by enzyme-linked immunosorbent assay (ELISA). As expected, significantly higher levels of TG (nearly 2 times) were found in N2a cells transfected with pCAGGS-NDRG1 than in those transfected with empty vector, as shown in Fig. 6D.
FIG 6.
NDRG1 enhances LD formation by increasing triacylglycerol biogenesis. Transfected cells were incubated with oleic acid (OA) at 100 μM for 24 h, and then the total RNA was extracted for quantification of mRNA level of diacylglycerol acyltransferase-1 (DGAT1) (A) and DGAT2 (B) by qPCR (n = 3). (C) Transfected cells were incubated with OA at 100 μM for 24 h, and the cell lysates were subjected to Western blotting. The DGAT1/actin and DGAT2/actin ratios were calculated from the bands. (D) N2a cells were transfected with pCAGGS-NDRG1 or empty vector for 24 h and incubated with OA at 100 μM for 24 h. Cells were collected, and cellular triacylglycerol (TG) was detected by ELISA (n = 4). (E) N2a cells were incubated with DGAT1 inhibitor (DGAT1i) (A922500, 10 μg/mL), DGAT2i (PF-06424439, 40 μg/mL), or a combination (A922500 plus PF-06424439) for 48 h, and cell viability was assessed by a Cell Counting kit-8 (CCK-8) assay (n = 3). (F) Confocal microscopy was used to confirm LD inhibition. Cells were incubated with inhibitors for the indicated times and stained with DAPI for nucleus, BODIPY 493/503 for LDs, and anti-Flag antibody for NDRG1. (G) N2a cells were transfected with pCAGGS-NDRG1 and incubated with the inhibitors for 24 h, followed by infection with RABV at an MOI of 0.1 for 24 h. Cell supernatants were harvested to quantify the viral titers (n = 4), and cell lysates were collected to measure RABV-N and NDRG1. The RABV-N/actin ratio was calculated by ImageJ according to the gray values of Western blotting bands (H). Error bars represent mean ± SD. Statistical significance was determined by one-way ANOVA or Student's t test and is notated as follows: **, P < 0.01; ***, P < 0.001; ****, P < 0.0001; and ns, not significant. Scale bar, 5 μm.
To further verify that DGAT activities that regulate LD formation have an effect on RABV replication, DGAT inhibitors (DGAT1i and DGAT2i) were employed to evaluate the role of DGAT activities in RABV replication. Cell viability assays were initially performed to assess the effect of DGAT1 or DGAT2 inhibitors alone or in combination on treated cells. As shown in Fig. 6E, DGAT inhibitors had no effects on cell viability, even with the combined inhibitors. Thus, the DGAT activities on LDs were determined by using inhibitors with a fluorescence assay. As shown in Fig. 6F, DGAT inhibitors sharply reduced LD accumulation in treated cells. Accordingly, DGAT inhibitors, especially the DGAT1 inhibitor, could significantly decrease the viral titers in treated cells: the mean viral titers in cells treated with dimethyl sulfoxide (DMSO), DGAT1i, DGAT2i, and DGAT1i plus DGAT2i were 105.38, 104.75, 105, 104.63 FFU/mL, respectively, as shown in Fig. 6G. In addition, for the cell lysates, Western blotting was performed to measure viral proteins. As shown in Fig. 6H, the RABV-N level was decreased by DGAT inhibitors, and the gray value ratios of RABV-N to β-actin bands in cells treated with DMSO, DGAT1 inhibitor, DAGT2 inhibitor, and the combination of DGAT1 and DAGT2 inhibitor were 1.44, 0.91, 1.33, and 0.62, respectively. Taken together, the above data indicate that NDRG1 increases DGAT expression and TG levels, resulting in enhanced LD formation.
RABV-M and RABV-G colocalize with LDs.
To further reveal the detailed role of LDs in RABV replication, N2a cells were transfected with RABV-N, -P, -M, or -G, and LDs were stained with the BODIPY probe to observe the colocalization of LDs with RABV structural proteins by confocal microscopy. As shown in Fig. 7A, RABV-M and RABV-G were found to be colocalized with LDs, especially RABV-G, and the possibility of the interaction between LDs and RABV structural proteins was also calculated. The green fluorescence of BODIPY 493/503 colocalized with the red fluorescence of RABV-M (Pearson’s r = 0.593) or RABV-G (Pearson’s r = 0.762). To further determine whether RABV-G was specifically enriched on the surface of LDs, calnexin was employed as an ER-specific protein to indicate that there is a selective enrichment of RABV-G within LDs rather other ER protein. N2a cells were transfected with RABV-G and then subjected to immunofluorescence analysis. Calnexin, LDs, and DAPI (4′,6-diamidino-2-phenylindole), as well as RABV-G, LDs, and DAPI, were stained with antibodies and observed under an immunofluorescence microscope for the specific enrichment of RABV-G within LDs (Fig. 7C). As expected, the mean fluorescence intensity of RABV-G-surrounded LDs was over 5 times higher than that of calnexin-surrounded LDs (Fig. 7D).
FIG 7.
RABV-M and RABV-G are associated with LDs. (A) N2a cells were transfected with the plasmids expressing RABV-N, -P, -M, and -G. LDs were stained with BODIPY 493/503 and an anti-Flag antibody for detecting RABV structural proteins by confocal microscopy, and colocalization levels were determined by ImageJ (B). N2a cells were transfected with pCAGGS-G for 24 h. RABV-G, LDs, and calnexin were stained, respectively, and imaged by confocal microscopy (C). The mean fluorescence intensities of RABV-G- and calnexin-surrounded LDs (white arrows) were calculated by ImageJ (D). Statistical significance was determined by Student's t test and is notated as follows: ****, P < 0.0001. Scale bar, 5 μm.
LDs facilitate viral budding by interacting with RABV-M and RABV-G.
Since RABV-M and RABV-G are the major proteins for viral budding, we speculate that LDs may facilitate the transportation of RABV-M and RABV-G from the ER to the cell surface and thus promote viral budding. To confirm this hypothesis, N2a cells were transfected with RABV-G and treated with OA for 24 h, and the fluorescence of RABV-G on the cell surface was assessed by a microplate reader. Indeed, the fluorescence values of RABV-G on the cell surface increased with the concentration of OA treatment (Fig. 8A), indicating that LDs could help with the transportation of RABV-G to the cell surface. Furthermore, to verify the role of LDs in viral budding, 293T cells were transfected with RABV-M and RABV-G at a ratio of 6:1 to form virus-like particles (VLPs), and the levels of RABV-M and RABV-G in culture supernatants and cell lysates were measured to assess the viral budding efficiency by Western blotting, as previously described (26, 27). As shown in Fig. 8B, with increasing OA concentration, the gray value ratios of both the RABV-M and RABV-G bands detected in the supernatants/lysates were elevated, indicating that OA promotes the number of VLPs budding into the supernatants. Finally, to determine whether NDRG1 could enhance virus budding through increasing LD biogenesis, 293T cells were cotransfected with RABV-M, RABV-G, and NDRG1 (or empty vector), and the protein levels of RABV-M and RABV-G in culture supernatants and cell lysates were measured by Western blotting. After treatment with OA, the protein levels of RABV-M and RABV-G in culture supernatants from NDRG1-transfected cells were higher than those from vector-transfected cells (Fig. 8C). Together, these results suggest that LDs facilitate RABV budding. Collectively, our data reveal that RABV infection upregulates NDRG1 expression, which in turn can increase the generation of LDs by enhancing DGAT expression to facilitate RABV budding (Fig. 9).
FIG 8.
LDs facilitate viral budding by interacting with RABV-M and RABV-G. N2a cells were transfected with pCAGGS-G for 24 h and treated with oleic acid (OA) dissolved in DMSO at 0, 10, 50, and 100 μM for 24 h. The expression level of RABV-G in the cell surface was quantified by a fluorescence microplate reader (n = 5) (A). HEK 293T cells were transfected with pCAGGS-M and pCAGGS-G at a ratio of 6:1 for 24 h and treated with oleic acid (OA) dissolved in DMSO at 0, 10, 50, and 100 μM for 24 h. Cells were lysed with RIPA buffer to detect RABV-M, RABV-G, and GAPDH by Western blotting. VLPs in the supernatants were collected by ultracentrifugation and then subjected to Western blotting (B). 293T cells were cotransfected with pCAGGS-M, pCAGGS-G, and NDRG1 (or empty vector) and then treated with oleic acid (OA) at 100 μM for 24 h. The protein levels of RABV-M and RABV-G in the cell lysate and culture supernatants was measured by Western blotting (C). Statistical significance was determined by one-way ANOVA and is notated as follows: **, P < 0.01; and ****, P < 0.0001.
FIG 9.
Schematic diagram of the proposed mechanism by which LDs assist RABV budding. RABV infection increases cellular NDRG1 expression, which promotes viral production by upregulating DGAT1 and DGAT2 levels and subsequently inducing triacylglycerol (TG) biogenesis to enhance LD formation. LD accumulation facilitates viral budding to increase viral production. The green dotted arrows indicate the mechanism by which it is speculated that LDs may help the transportation of RABV-M and RABV-G from the ER to the cell membrane.
DISCUSSION
Excess neutral lipids in cells induce lipotoxicity; therefore, cells produce LDs to store these excess neutral lipids within the active lipid metabolism level (28). LDs are the main place for neutral lipid storage in cells (29). Viruses have evolved to hijack cell lipid metabolism to produce LDs, and the phospholipid layer and/or surface proteins of LDs consequently facilitate viral assembly and budding (30). For instance, dengue virus (DENV) infection can effectively promote the accumulation of LDs to facilitate viral genome encapsidation (31–33), while Marek’s disease virus (MDV) can activate the fatty acid synthesis (FAS) pathway to facilitate its replication (34). During HCV infection, the surface of LDs can interact with NS5 and nucleocapsid protein to provide a platform for HCV virus assembly (35, 36), and its core protein is linked to LDs as well (37). In rotavirus infection, LDs can form a complex with virions and further play a critical role in virus replication (13). Japanese encephalitis virus (JEV) capsid protein can colocalize with LDs to facilitate the release of infectious viral particles (38). Additionally, the surface proteins of LDs can participate in the interaction between LDs and viruses, such as PLIN3 (39), AUP1 (40), Rab18 (41), and DGAT1 (42), and most of these interactions contribute to viral assembly and budding.
Since LD accumulation in cells can accelerate viral assembly, viruses naturally produce a positive effect on the LD synthesis pathway by regulating a series of molecules. Influenza A virus (IAV) infection can promote fatty acid synthesis by regulating a series of fatty acid synthases, ACC, and FASN (43, 44), while HCV infection can enhance the function of SREBP1, HMGCR (HMG-CoA reductase), LXR (liver X receptor), and FASN to increase lipid synthesis (45–47). A similar mechanism can also be found in infections with other RNA viruses, such as Dengue virus (DENV), chikungunya virus (CHIKV), Zika virus (ZIKV), and West Nile virus (WNV) (48, 49). Additionally, some DNA viruses have evolved strategies to hijack lipid metabolism to benefit their replication and production (50). In this study, we also found that interfering with LD formation could decrease RABV replication. Atorvastatin, an HMG-CoA reductase inhibitor, was used in this study as an LD inhibitor. However, in addition to reduce cholesterol levels, atorvastatin may have multiple additional effects in RABV-infected cells, which may contribute to the reduction of viral production. Thus, other LD inhibitors will be evaluated during RABV infection in our future study.
LD accumulation has been reported in several viral infections; however, NDRG1 did not exhibit a significant effect on fatty acid synthesis or lipolysis processes: whether NDRG1 has a positive effect on subsequent triacylglycerol synthesis from fatty acids remains unclear. NDRG1 has been demonstrated to play important roles in different viral infections. In porcine reproductive and respiratory syndrome virus (PRRSV)-infected cells, NDRG1 expression is downregulated and further triggers lipophagy to promote virus production (24). In HCV infection, v-myc avian myelocytomatosis viral oncogene homolog (MYC) regulates NDRG1-specific kinase serum/glucocorticoid-regulated kinase 1 (SGK1) expression and ultimately leads to downregulation of NDRG1, which promotes virus assembly (21). The above studies suggest that NDRG1 has a negative effect on virus infection. However, NDRG1 has also been reported to be upregulated in some other viral infections. During influenza virus (IAV) infection, the nonclassical NF-κB pathway is suppressed by increased NDRG1, which inhibits cell inflammation to promote IAV production (51). In Kaposi's sarcoma virus (KSHV) infection, NDRG1 expression is enhanced to promote latency-associated nuclear antigen (LANA), which can recruit proliferating cell nuclear antigen (PCNA) and ultimately accelerate virus replication (18). Consistently, in our study, we found that NDRG1 expression was elevated in neuronal cell lines and primary neurons after RABV infection, which facilitated RABV replication by enhancing viral budding through increasing LD formation. Previous studies have indicated that NDRG1 plays important roles in cell lipid metabolism, and NDRG1 has been found to regulate LD production in cancer cells and in PRRSV or HCV infection (15, 21, 22, 24, 52). In our study, we also observed the role of NDRG1 in LD formation in neuronal cells infected with RABV, which confirmed that RABV could employ NDRG1 to regulate cell lipid metabolism for viral production and energy supply. However, overexpressing or silencing NDRG1 or interfering with LDs with atorvastatin or DGAT inhibitors did not sharply change the viral titers of RABV (a roughly 3-fold change), as shown in Fig. 2D, Fig. 4E and H, and Fig. 6G. This could be attributed to the fact that the NDRG1-DGAT-LD axis proposed in our study is one of the mechanisms that affect RABV infection by LDs, and further investigations to explore other possible mechanisms for LDs involving in RABV replication are needed in our future studies.
RABV infection could increase NDRG1 expression to enhance LD formation, which consequently facilitated viral budding by interacting with RABV-M and RABV-G. This result suggests that RABV-M and RABV-G interact with the different surface proteins of LDs to accelerate virus production collaboratively. The rhabdoviral M protein has been demonstrated to interact with lipid bilayers at the site of budding (53), which suggests that lipids are involved in the budding of the rhabdoviral M protein. Intriguingly, LDs have been identified to have a relationship between cellular organelles and the cell membrane, which is regulated by multiple Rab GTPases (54). For membrane trafficking, LDs have been found to use endosomal intermediates to transport lipids to the cell membrane (55). These results suggest the hypothesis that RABV-M and RABV-G interactions with LDs might accelerate LD dynamics and increase lipid trafficking and that RABV-M and RABV-G may also directly interact with multiple Rab GTPases to facilitate LD dynamics and promote viral budding. However, further investigation is needed to provide direct evidence that RABV-G and RABV-M surround LDs trafficking to plasma membrane for viral budding. Moreover, our future studies will focus on exploring the surface proteins of the LDs that participate in the interaction with RABV-M and RABV-G, which could deepen our understanding of the interplay between viral budding and lipid metabolism in RABV infection.
Taken together, the findings of our study indicate that RABV infection induces LD accumulation, and LD biogenesis is regulated by enhancing the expression of DGAT (DGAT1 and DGAT2) via NDRG1, which sheds light for exploring anti-RABV drugs.
MATERIALS AND METHODS
Cells, viruses, mice, antibodies, inhibitors, and drugs.
The N2a (ATCC CCL-131), BSR (ATCC CCL-10), and SK-N-SH (ATCC HTB-11) cell lines were obtained from the American Type Culture Collection (ATCC). Dulbecco’s modified Eagle’s medium (DMEM) and fetal bovine serum (FBS) were purchased from Gibco. B-27 (catalog no. 17504-044) was purchased from Gibco. Penicillin-streptomycin was purchased from Beyotime. For the primary antibodies, an anti-NDRG1 antibody (catalog no. 9408) was obtained from Cell Signaling Technology (MA, USA), an anti-Flag antibody (catalog no. M185-3 LL) and an anti-β-actin antibody (catalog no. M177-3) were purchased from MBL Life Science (Japan), an anti-glyeraldehyde-3-phosphate dehydrogenase (anti-GAPDH) antibody (catalog no. 60004-1-Ig) and anti-DGAT1 antibody (catalog no. 11561-1-AP) were purchased from Proteintech (Wuhan, China), an anti-DGAT2 antibody (catalog no. sc-293211) was purchased from Santa Cruz Biotechnology (CA, USA), an anticalnexin antibody (catalog no. PA5-34754) was purchased from Invitrogen, and anti-RABV-N and anti-RABV-P antibodies were prepared in our lab. The secondary antibodies used were a horseradish peroxidase (HRP)-conjugated goat anti-mouse antibody (catalog no. BA1051) and a goat anti-rabbit antibody (catalog no. BA1055) purchased from Boster (Wuhan, China), and a DyLight 594 goat anti-mouse IgG (H+L) cross-adsorbed secondary antibody (catalog no. 35511), an Alexa Fluor Plus 647 goat anti-rabbit IgG (H+L) highly cross-adsorbed secondary antibody (catalog no. A32733), and an Alexa Fluor 488 goat anti-mouse IgG (H+L) cross-adsorbed secondary antibody (catalog no. 11001) were purchased from Invitrogen. The LD probe BODIPY 493/503 (catalog no. GC42959) was purchased from GLPBIO (CA, USA). The DGAT inhibitors A922500 (catalog no. HY-10038) and PF-06424439 (catalog no. HY-108341A) were purchased from MedChemExpress (NJ, USA). The triacylglycerol ELISA kit (catalog no. BC0620), Oil Red O (catalog no. G1260), and atorvastatin (catalog no. A6800) were purchased from Solarbio (Beijing, China). Cell Counting kit-8 (catalog no. C0005) and oleic acid (catalog no. T2O2668) were purchased from TargetMol (MA, USA). The HiScript II 1st Strand cDNA synthesis kit (catalog no. R211-01), HiScript III 1st Strand cDNA synthesis kit (catalog no. R222-01), and ChamQ SYBR qPCR master mix (catalog no. Q711-02) were purchased from Vazyme (Nanjing, China). TRIzol was purchased from Invitrogen. N2a cells, BSR cells, and SK-N-SH cells were cultured in DMEM containing 10% FBS and 1% penicillin-streptomycin at 37°C in a humidified 5% CO2 atmosphere. Primary neurons were isolated as previously described (56). Neurons were cultured in DMEM containing 5% FBS for 4 h, after which the medium was removed and the cells were cultured with serum-free neural-basal medium (Gibco) containing 2% B-27 (Gibco) and 1% penicillin-streptomycin. CVS-B2c originated from CVS-24 by passaging in BHK-21 cells as previously described (57). C57BL/6 mice were purchased from the Chinese Center for Disease Control and Prevention of Hubei Province, China.
Virus titration.
Viral titers were assessed by using a direct fluorescence assay (58). The medium of the cells was diluted 10-fold into plates in quadruplicate, and BSR cells were added to the microplates and incubated at 37°C for 48 h. After discarding the supernatant, the plates were fixed with 80% cold acetone for 2 h at −20°C, and then fluorescein isothiocyanate (FITC)-P antibody was added for incubation for 1 h at 37°C. A fluorescence microscope (Zeiss, Germany) was used to count the positive foci, and virus titers were calculated and expressed as FFU/mL.
Plasmid construction.
The coding sequence of murine NDRG1 was amplified from mouse brain and cloned into the pCAGGS-Flag vector by the restriction enzyme sites EcoRI and KpnI. The coding sequences of RABV-N, -P, -M, and -G were cloned into the pCAGGS-Flag vector or pCAGGS-HA vector by the restriction enzyme sites EcoRI and XhoI. All plasmids were transfected by Lipofectamine 3000 (Invitrogen) in this study according to the manufacturer’s protocol.
Western blotting.
After virus infection or plasmid transfection, cells were washed with cold PBS twice, and radioimmunoprecipitation assay (RIPA) buffer was added to extract proteins. SDS loading buffer was added, and the samples were loaded onto SDS-PAGE gels and transferred to polyvinylidene difluoride (PVDF) membranes (Merck Millipore). After blocking with 5% skim milk for 2 h, the membrane was incubated with the primary antibody diluted in the same solution overnight and washed three times with Tris-buffered saline-Tween (TBST). The secondary antibody was added and incubated for 1 h at room temperature. Signals were detected by an Amersham Imager 600 (GE Healthcare) imaging system.
RT-qPCR analysis.
Total RNA was extracted from the cells by TRIzol and reverse transcribed with a HiScript III 1st Strand cDNA synthesis kit. Primers for analysis of viral and host RNA were designed as shown in Table 1, and then the PCR was performed with the following program: 95°C for 2 min for one cycle followed by 40 cycles at 95°C for 5 s and 60°C for 30 s.
TABLE 1.
Primers used for qPCR in this study
| Primer type | Primer name | Sequence (5′ to 3′) |
|---|---|---|
| Mus musculus | NDRG1-F | ATGTCCCGAGAGCTACATGAC |
| NDRG1-R | CCTGCTCCTGAACATCGAACT | |
| SREBP1c-F | TGACCCGGCTATTCCGTGA | |
| SREBP1c-R | CTGGGCTGAGCAATACAGTTC | |
| Fasn-F | GGAGGTGGTGATAGCCGGTAT | |
| Fasn-R | TGGGTAATCCATAGAGCCCAG | |
| ACC-F | ATGGGCGGAATGGTCTCTTTC | |
| ACC-R | TGGGGACCTTGTCTTCATCAT | |
| SCD-F | TTCTTGCGATACACTCTGGTGC | |
| SCD-R | CGGGATTGAATGTTCTTGTCGT | |
| PLIN2-F | GGAGGAAAGACTGCCTATTCTGA | |
| PLIN2-R | CATCCTTCGCCCCAGTTACG | |
| PLIN3-F | GCTATGGAGGAACCTGTTGTG | |
| PLIN3-R | GTGAGGGTCTTGACGCCTTTC | |
| DGAT1-F | TCCGTCCAGGGTGGTAGTG | |
| DGAT1-R | TGAACAAAGAATCTTGCAGACGA | |
| DGAT2-F | GCGCTACTTCCGAGACTACTT | |
| DGAT2-R | GGGCCTTATGCCAGGAAACT | |
| ATGL-F | TCCGTGGCTGTCTACTAAAGA | |
| ATGL-R | TGGGATATGATGACGTTCTCTCC | |
| HSL-F | GATTTACGCACGATGACACAGT | |
| HSL-R | ACCTGCAAAGACATTAGACAGC | |
| MGL-F | CGGACTTCCAAGTTTTTGTCAGA | |
| MGL-R | GCAGCCACTAGGATGGAGATG | |
| Homo sapiens | PLIN2-F | ATGGCATCCGTTGCAGTTGAT |
| PLIN2-R | GGACATGAGGTCATACGTGGAG | |
| PLIN3-F | TATGCCTCCACCAAGGAGAG | |
| PLIN3-R | ATTCGCTGGCTGATGCAATCT | |
| NDRG1-F | CTCCTGCAAGAGTTTGATGTCC | |
| NDRG1-R | TCATGCCGATGTCATGGTAGG | |
| Viral DNA | vRNA-F | ACAGGCAACACCACTGATAA |
| vRNA-R | TCAGCGGGACATATTCAGGA |
siRNA transfection.
The specific small interfering RNAs used for knocking down NDRG1 in this study were synthesized by Sangon Biotech. To verify the transfection efficiency, siRNAs were diluted to a final concentration of 50 nM and transfected into N2a cells according to the manufacturer’s instruction. The specific target sequence for siNC was 5′-GGGUUGAUAGAUCACUGAAGG-3′, the siNDRG1-1 sequence was 5′-GGUGUGUGAUAGCACGGAAAU-3′, and the siNDRG1-2 sequence was 5′-GGAUCUUGGAGUUGCUAGAGG-3′.
Cell viability assay.
N2a cells were incubated with DGAT inhibitors or atorvastatin for the indicated times. Cell viability was evaluated by a Cell Counting kit-8 (CCK-8) assay according to the manufacturer’s instructions, and optical density (OD) values were detected with a SpectraMax 190 spectrophotometer (Molecular Devices, CA).
Immunofluorescence microscopy.
N2a cells were transfected with the indicated plasmids or siRNA with transfection reagents according to the manufacturers' protocol and treated with virus or inhibitors for the indicated time. Cells were first treated with 4% paraformaldehyde at room temperature for 30 min and then incubated for 15 min in PBS solution containing 0.1 M glycine. After washing with PBS 2 times, cells were permeabilized with 0.1% NP-40 in PBS at room temperature for 30 min and then incubated with blocking solution (10 mM Tris-HCl [pH 7.5], 150 mM NaCl, 2% bovine serum albumin [BSA], and 10% goat serum) for 30 min at room temperature. The probes or primary antibodies were incubated at 37°C for 1 h and washed twice with PBS. The secondary antibodies were incubated at 37°C for 1 h and washed twice with PBS. DAPI was diluted in PBS at room temperature for 5 min and then washed with PBS.
Confocal microscopy.
N2a cells were plated on coverslips that had been pretreated with polylysine. After transfection of plasmid or virus infection, cells were treated with 4% paraformaldehyde at room temperature for 30 min, followed by 15 min of incubation in PBS solution containing 0.1 M glycine. Cells were washed with PBS and permeabilized with 0.1% NP-40 in PBS at room temperature for 30 min, and then blocking solution (10 mM Tris-HCl [pH 7.5], 150 mM NaCl, 2% BSA, and 10% goat serum) was added for 30 min at room temperature. Coverslips were incubated with the primary antibody diluted in blocking solution at room temperature for 2 h and then incubated with the second antibody diluted in blocking solution for 1 h at room temperature. After washing with PBS, cells were strained with BODIPY 493/503 diluted in PBS, incubated at room temperature for 30 min, and washed with PBS. Finally, coverslips were stained with DAPI diluted in PBS at room temperature for 5 min and then washed with PBS. Prolong Gold antifade mounting solution was added to the glass slides to prevent quenching. The coverslips were imaged with a confocal microscope (Zeiss, Germany) with 488-, 561-, 633-, and 405-nm laser lines for excitation of Alexa Fluor 488, Alexa Fluor 594, Alexa Fluor 647, and DAPI, respectively.
Triacylglycerol ELISA.
N2a cells were transfected with pCAGGS-NDRG1 or empty vector for 24 h, oleic acid (OA) was added to the medium, and the mixture was incubated for another 24 h. Cells were harvested to detect intracellular triacylglycerol by ELISA according to the manufacturer’s instructions. The OD values were detected by a SpectraMax 190 spectrophotometer (Molecular Devices, CA), and the triacylglycerol level was calculated based on the standard curve.
Detection of RABV VLPs.
HEK 293T cells were transfected with pCAGGS-RABV-M and pCAGGS-RABV-G plasmids at a molar ratio of 6:1, as previously described, by using Lipofectamine 3000 according to the manufacturer’s protocol for 24 h, and OA was used to treat the cells at concentrations of 0, 10, 50, and 100 μM for 24 h (26, 27). Cells were collected and lysed for Western blotting. The supernatant was collected for centrifugation (5,200 rpm at 4°C for 30 min) to remove the pellet, and then ultracentrifugation (30,000 rpm at 4°C for 2 h) was performed. The pellets were assessed by Western blotting.
Statistical analysis.
All data were analyzed by using GraphPad Prism 8 (GraphPad Software, CA). The mean fluorescence intensity was calculated by ImageJ software (https://imagej.nih.gov/ij/). Data are representative of two independent experiments. For all results, an unpaired two-tailed t test or one-way analysis of variance (ANOVA) was used to determine whether differences were statistically significant. The following notations are used to indicate significant differences between groups: *, P < 0.05; **, P < 0.01; ***, P < 0.001; and ****, P < 0.0001.
Ethics statement.
The animal experiments were carried out strictly according to the protocols used and approved by the Scientific Ethics Committee of Huazhong Agricultural University (permit no. HZAUMO-2019-065). All institutional and national guidelines for the care and use of laboratory animals were followed.
ACKNOWLEDGMENTS
This study was partially supported by the National Natural Science Foundation of China (31872494), the National Program on Key Research Project of China (2016YFD0500405), and the Natural Science Foundation of Hubei Province (2019CFA010).
Contributor Information
Ling Zhao, Email: zling604@yahoo.com.
Ming Zhou, Email: mikchail@163.com.
Rebecca Ellis Dutch, University of Kentucky College of Medicine.
REFERENCES
- 1.Abela-Ridder B. 2015. Rabies: 100 per cent fatal, 100 per cent preventable. Vet Rec 177:148–149. 10.1136/vr.h4196. [DOI] [PubMed] [Google Scholar]
- 2.Albertini AA, Ruigrok RW, Blondel D. 2011. Rabies virus transcription and replication. Adv Virus Res 79:1–22. 10.1016/B978-0-12-387040-7.00001-9. [DOI] [PubMed] [Google Scholar]
- 3.Mebatsion T, Konig M, Conzelmann K. 1996. Budding of rabies virus particles in the absence of the spike glycoprotein. Cell 84:941–951. 10.1016/s0092-8674(00)81072-7. [DOI] [PubMed] [Google Scholar]
- 4.Mebatsion T, Weiland F, Conzelmann K. 1999. Matrix protein of rabies virus is responsible for the assembly and budding of bullet-shaped particles and interacts with the transmembrane spike glycoprotein G. J Virol 73:242–250. 10.1128/JVI.73.1.242-250.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Fisher CR, Streicker DG, Schnell MJ. 2018. The spread and evolution of rabies virus: conquering new frontiers. Nat Rev Microbiol 16:241–255. 10.1038/nrmicro.2018.11. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Garoff H, Hewson R, Opstelten D. 1998. Virus maturation by budding. Microbiol Mol Biol Rev 62:1171–1190. 10.1128/MMBR.62.4.1171-1190.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Schnell M, Buonocore L, Boritz E, Ghosh H, Chernish R, Rose J. 1998. Requirement for a non-specific glycoprotein cytoplasmic domain sequence to drive efficient budding of vesicular stomatitis virus. EMBO J 17:1289–1296. 10.1093/emboj/17.5.1289. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Walther T, Chung J, Farese R. 2017. Lipid droplet biogenesis. Annu Rev Cell Dev Biol 33:491–510. 10.1146/annurev-cellbio-100616-060608. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Marschallinger J, Iram T, Zardeneta M, Lee S, Lehallier B, Haney M, Pluvinage J, Mathur V, Hahn O, Morgens D, Kim J, Tevini J, Felder T, Wolinski H, Bertozzi C, Bassik M, Aigner L, Wyss-Coray T. 2020. Lipid-droplet-accumulating microglia represent a dysfunctional and proinflammatory state in the aging brain. Nat Neurosci 23:194–208. 10.1038/s41593-019-0566-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Jackson C. 2019. Lipid droplet biogenesis. Curr Opin Cell Biol 59:88–96. 10.1016/j.ceb.2019.03.018. [DOI] [PubMed] [Google Scholar]
- 11.Kimmel A, Brasaemle D, McAndrews-Hill M, Sztalryd C, Londos C. 2010. Adoption of PERILIPIN as a unifying nomenclature for the mammalian PAT-family of intracellular lipid storage droplet proteins. J Lipid Res 51:468–471. 10.1194/jlr.R000034. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Akil A, Peng J, Omrane M, Gondeau C, Desterke C, Marin M, Tronchère H, Taveneau C, Sar S, Briolotti P, Benjelloun S, Benjouad A, Maurel P, Thiers V, Bressanelli S, Samuel D, Bréchot C, Gassama-Diagne A. 2016. Septin 9 induces lipid droplets growth by a phosphatidylinositol-5-phosphate and microtubule-dependent mechanism hijacked by HCV. Nat Commun 7:12203. 10.1038/ncomms12203. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Crawford S, Desselberger U. 2016. Lipid droplets form complexes with viroplasms and are crucial for rotavirus replication. Curr Opin Virol 19:11–15. 10.1016/j.coviro.2016.05.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Melotte V, Qu X, Ongenaert M, van Criekinge W, de Bruïne AP, Baldwin HS, van Engeland M. 2010. The N-myc downstream regulated gene (NDRG) family: diverse functions, multiple applications. FASEB J 24:4153–4166. 10.1096/fj.09-151464. [DOI] [PubMed] [Google Scholar]
- 15.Park KC, Paluncic J, Kovacevic Z, Richardson DR. 2020. Pharmacological targeting and the diverse functions of the metastasis suppressor, NDRG1, in cancer. Free Radic Biol Med 157:154–175. 10.1016/j.freeradbiomed.2019.05.020. [DOI] [PubMed] [Google Scholar]
- 16.Sahni S, Bae D, Lane D, Kovacevic Z, Kalinowski D, Jansson P, Richardson D. 2014. The metastasis suppressor, N-myc downstream-regulated gene 1 (NDRG1), inhibits stress-induced autophagy in cancer cells. J Biol Chem 289:9692–9709. 10.1074/jbc.M113.529511. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Gupta P, Shahzad N, Harold A, Shuda M, Venuti A, Romero-Medina M, Pacini L, Brault L, Robitaille A, Taverniti V, Hernandez-Vargas H, Durand G, Le Calvez-Kelm F, Gheit T, Accardi R, Tommasino M. 2020. Merkel cell polyomavirus downregulates N-myc downstream-regulated gene 1, leading to cellular proliferation and migration. J Virol 94:e00899-19. 10.1128/JVI.00899-19. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Zhang F, Liang D, Lin X, Zou Z, Sun R, Wang X, Liang X, Kaye K, Lan K. 2019. NDRG1 facilitates the replication and persistence of Kaposi's sarcoma-associated herpesvirus by interacting with the DNA polymerase clamp PCNA. PLoS Pathog 15:e1007628. 10.1371/journal.ppat.1007628. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Schonkeren S, Massen M, van der Horst R, Koch A, Vaes N, Melotte V. 2019. Nervous NDRGs: the N-myc downstream-regulated gene family in the central and peripheral nervous system. Neurogenetics 20:173–186. 10.1007/s10048-019-00587-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Stein S, Thomas E, Herzog B, Westfall M, Rocheleau J, Jackson R, Wang M, Liang P. 2004. NDRG1 is necessary for p53-dependent apoptosis. J Biol Chem 279:48930–48940. 10.1074/jbc.M400386200. [DOI] [PubMed] [Google Scholar]
- 21.Schweitzer C, Zhang F, Boyer A, Valdez K, Cam M, Liang T. 2018. N-Myc downstream-regulated gene 1 restricts hepatitis C virus propagation by regulating lipid droplet biogenesis and viral assembly. J Virol 92:e01166-17. 10.1128/JVI.01166-17. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Sevinsky CJ, Khan F, Kokabee L, Darehshouri A, Maddipati KR, Conklin DS. 2018. NDRG1 regulates neutral lipid metabolism in breast cancer cells. Breast Cancer Res 20:55. 10.1186/s13058-018-0980-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Episcopio D, Aminov S, Benjamin S, Germain G, Datan E, Landazuri J, Lockshin R, Zakeri Z. 2019. Atorvastatin restricts the ability of influenza virus to generate lipid droplets and severely suppresses the replication of the virus. FASEB J 33:9516–9525. 10.1096/fj.201900428RR. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Wang J, Liu J, Shao K, Han Y, Li G, Ming S, Su B, Du Y, Liu Z, Zhang G, Yang G, Chu B. 2019. Porcine reproductive and respiratory syndrome virus activates lipophagy to facilitate viral replication through downregulation of NDRG1 expression. J Virol 93:e00526-19. 10.1128/JVI.00526-19. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Sui B, Chen D, Liu W, Wu Q, Tian B, Li Y, Hou J, Liu S, Xie J, Jiang H, Luo Z, Lv L, Huang F, Li R, Zhang C, Tian Y, Cui M, Zhou M, Chen H, Fu ZF, Zhang Y, Zhao L. 2020. A novel antiviral lncRNA, EDAL, shields a T309 O-GlcNAcylation site to promote EZH2 lysosomal degradation. Genome Biol 21:228. 10.1186/s13059-020-02150-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Liu X, Li F, Zhang J, Wang L, Wang J, Wen Z, Wang Z, Shuai L, Wang X, Ge J, Zhao D, Bu Z. 2021. The ATPase ATP6V1A facilitates rabies virus replication by promoting virion uncoating and interacting with the viral matrix protein. J Biol Chem 296:100096. 10.1074/jbc.RA120.014190. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Fontana D, Kratje R, Etcheverrigaray M, Prieto C. 2014. Rabies virus-like particles expressed in HEK293 cells. Vaccine 32:2799–2804. 10.1016/j.vaccine.2014.02.031. [DOI] [PubMed] [Google Scholar]
- 28.Welte M. 2015. Expanding roles for lipid droplets. Curr Biol 25:R470–R481. 10.1016/j.cub.2015.04.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Zhang C, Liu P. 2017. The lipid droplet: a conserved cellular organelle. Protein Cell 8:796–800. 10.1007/s13238-017-0467-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Villareal V, Rodgers M, Costello D, Yang P. 2015. Targeting host lipid synthesis and metabolism to inhibit dengue and hepatitis C viruses. Antiviral Res 124:110–121. 10.1016/j.antiviral.2015.10.013. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Carvalho F, Carneiro F, Martins I, Assunção-Miranda I, Faustino A, Pereira R, Bozza P, Castanho M, Mohana-Borges R, Da Poian A, Santos N. 2012. Dengue virus capsid protein binding to hepatic lipid droplets (LD) is potassium ion dependent and is mediated by LD surface proteins. J Virol 86:2096–2108. 10.1128/JVI.06796-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Iglesias N, Mondotte J, Byk L, De Maio F, Samsa M, Alvarez C, Gamarnik A. 2015. Dengue virus uses a non-canonical function of the host GBF1-Arf-COPI system for capsid protein accumulation on lipid droplets. Traffic 16:962–977. 10.1111/tra.12305. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Samsa M, Mondotte J, Iglesias N, Assunção-Miranda I, Barbosa-Lima G, Da Poian A, Bozza P, Gamarnik A. 2009. Dengue virus capsid protein usurps lipid droplets for viral particle formation. PLoS Pathog 5:e1000632. 10.1371/journal.ppat.1000632. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Boodhoo N, Kamble N, Kaufer B, Behboudi S. 2019. De novo replication of Marek's disease virus is dependent on synthesis of fatty acid and prostaglandin E. J Virol 93:e00352-19. 10.1128/JVI.00352-19. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Miyanari Y, Atsuzawa K, Usuda N, Watashi K, Hishiki T, Zayas M, Bartenschlager R, Wakita T, Hijikata M, Shimotohno K. 2007. The lipid droplet is an important organelle for hepatitis C virus production. Nat Cell Biol 9:1089–1097. 10.1038/ncb1631. [DOI] [PubMed] [Google Scholar]
- 36.Appel N, Zayas M, Miller S, Krijnse-Locker J, Schaller T, Friebe P, Kallis S, Engel U, Bartenschlager R. 2008. Essential role of domain III of nonstructural protein 5A for hepatitis C virus infectious particle assembly. PLoS Pathog 4:e1000035. 10.1371/journal.ppat.1000035. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Barba G, Harper F, Harada T, Kohara M, Goulinet S, Matsuura Y, Eder G, Schaff Z, Chapman M, Miyamura T, Bréchot C. 1997. Hepatitis C virus core protein shows a cytoplasmic localization and associates to cellular lipid storage droplets. Proc Natl Acad Sci USA 94:1200–1205. 10.1073/pnas.94.4.1200. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Ishida K, Goto S, Ishimura M, Amanuma M, Hara Y, Suzuki R, Katoh K, Morita E. 2019. Functional correlation between subcellular localizations of Japanese encephalitis virus capsid protein and virus production. J Virol 93:e00612-19. 10.1128/JVI.00612-19. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Vogt DA, Camus G, Herker E, Webster BR, Tsou CL, Greene WC, Yen TS, Ott M. 2013. Lipid droplet-binding protein TIP47 regulates hepatitis C virus RNA replication through interaction with the viral NS5A protein. PLoS Pathog 9:e1003302. 10.1371/journal.ppat.1003302. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Zhang J, Lan Y, Li M, Lamers M, Fusade-Boyer M, Klemm E, Thiele C, Ashour J, Sanyal S. 2018. Flaviviruses exploit the lipid droplet protein AUP1 to trigger lipophagy and drive virus production. Cell Host Microbe 23:819–831.e5. 10.1016/j.chom.2018.05.005. [DOI] [PubMed] [Google Scholar]
- 41.Salloum S, Wang H, Ferguson C, Parton RG, Tai AW. 2013. Rab18 binds to hepatitis C virus NS5A and promotes interaction between sites of viral replication and lipid droplets. PLoS Pathog 9:e1003513. 10.1371/journal.ppat.1003513. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Herker E, Harris C, Hernandez C, Carpentier A, Kaehlcke K, Rosenberg AR, Farese RV, Jr, Ott M. 2010. Efficient hepatitis C virus particle formation requires diacylglycerol acyltransferase-1. Nat Med 16:1295–1298. 10.1038/nm.2238. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Tian X, Zhang K, Min J, Chen C, Cao Y, Ding C, Liu W, Li J. 2019. Metabolomic analysis of influenza A virus A/WSN/1933 (H1N1) infected A549 cells during first cycle of viral replication. Viruses 11:1007. 10.3390/v11111007. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Limsuwat N, Boonarkart C, Phakaratsakul S, Suptawiwat O, Auewarakul P. 2020. Influence of cellular lipid content on influenza A virus replication. Arch Virol 165:1151–1161. 10.1007/s00705-020-04596-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Alvisi G, Madan V, Bartenschlager R. 2011. Hepatitis C virus and host cell lipids: an intimate connection. RNA Biol 8:258–269. 10.4161/rna.8.2.15011. [DOI] [PubMed] [Google Scholar]
- 46.Schaefer E, Chung R. 2013. HCV and host lipids: an intimate connection. Semin Liver Dis 33:358–368. 10.1055/s-0033-1358524. [DOI] [PubMed] [Google Scholar]
- 47.Meng Z, Liu Q, Sun F, Qiao L. 2019. Hepatitis C virus nonstructural protein 5A perturbs lipid metabolism by modulating AMPK/SREBP-1c signaling. Lipids Health Dis 18:191. 10.1186/s12944-019-1136-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Martín-Acebes M, Vázquez-Calvo Á, Saiz J. 2016. Lipids and flaviviruses, present and future perspectives for the control of dengue, Zika, and West Nile viruses. Prog Lipid Res 64:123–137. 10.1016/j.plipres.2016.09.005. [DOI] [PubMed] [Google Scholar]
- 49.Byers N, Fleshman A, Perera R, Molins C. 2019. Metabolomic insights into human arboviral infections: dengue, chikungunya, and Zika viruses. Viruses 11:225. 10.3390/v11030225. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 50.Lange P, Lagunoff M, Tarakanova V. 2019. Chewing the fat: the conserved ability of DNA viruses to hijack cellular lipid metabolism. Viruses 11:119. 10.3390/v11020119. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 51.Chen L, Xing C, Ma G, Luo J, Su W, Li M, Shi Q, He H. 2018. N-myc downstream-regulated gene 1 facilitates influenza A virus replication by suppressing canonical NF-κB signaling. Virus Res 252:22–28. 10.1016/j.virusres.2018.05.001. [DOI] [PubMed] [Google Scholar]
- 52.Zhou W, Huang K, Zhang Q, Ye S, Zhong Z, Zeng C, Peng G, Li L, Ye Q. 2020. LINC00844 promotes proliferation and migration of hepatocellular carcinoma by regulating NDRG1 expression. PeerJ 8:e8394. 10.7717/peerj.8394. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 53.Okumura A, Harty RN. 2011. Rabies virus assembly and budding. Adv Virus Res 79:23–32. 10.1016/B978-0-12-387040-7.00002-0. [DOI] [PubMed] [Google Scholar]
- 54.Liu P, Bartz R, Zehmer JK, Ying YS, Zhu M, Serrero G, Anderson RG. 2007. Rab-regulated interaction of early endosomes with lipid droplets. Biochim Biophys Acta 1773:784–793. 10.1016/j.bbamcr.2007.02.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 55.Zehmer JK, Huang Y, Peng G, Pu J, Anderson RG, Liu P. 2009. A role for lipid droplets in inter-membrane lipid traffic. Proteomics 9:914–921. 10.1002/pmic.200800584. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 56.Zhao L, Rose K, Elliott R, Van Rooijen N, Weiss S. 2011. Cell-type-specific type I interferon antagonism influences organ tropism of murine coronavirus. J Virol 85:10058–10068. 10.1128/JVI.05075-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 57.Wang Z, Sarmento L, Wang Y, Li X, Dhingra V, Tseggai T, Jiang B, Fu Z. 2005. Attenuated rabies virus activates, while pathogenic rabies virus evades, the host innate immune responses in the central nervous system. J Virol 79:12554–12565. 10.1128/JVI.79.19.12554-12565.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 58.Cliquet F, Aubert M, Sagné L. 1998. Development of a fluorescent antibody virus neutralisation test (FAVN test) for the quantitation of rabies-neutralising antibody. J Immunol Methods 212:79–87. 10.1016/s0022-1759(97)00212-3. [DOI] [PubMed] [Google Scholar]









