Synergetic Contributions of Viral VP1, VP3, and 3C to Activation of the AKT-AMPK-MAPK-MTOR Signaling Pathway for Seneca Valley Virus-Induced Autophagy

ABSTRACT

Seneca Valley virus (SVV), a member of the Picornaviridae family, can activate autophagy via the PERK and ATF6 unfolded protein response pathways and facilitate viral replication; however, the precise molecular mechanism that regulates SVV-induced autophagy remains unclear. Here, we revealed that SVV infection inhibited the phosphorylation of mechanistic target of rapamycin kinase (MTOR) and activated phosphorylation of the serine/threonine kinase AKT. We observed that activating AMP-activated protein kinase (AMPK), extracellular signal-regulated kinase (ERK), mitogen-activated protein kinase (MAPK), and p38 MAPK signaling by SVV infection promoted autophagy induction and viral replication; additionally, the SVV-induced autophagy was independent of the ULK1 complex. We further evaluated the role of viral protein(s) in the AKT-AMPK-MAPK-MTOR pathway during SVV-induced autophagy and found that VP1 induced autophagy, as evidenced by puncta colocalization with microtubule-associated protein 1 light chain 3 (LC3) in the cytoplasm and enhanced LC3-II levels. This might be associated with the interaction of VP1 with sequestosome 1 and promoting its degradation. In addition, the expression of VP1 enhanced AKT phosphorylation and AMPK phosphorylation, while MTOR phosphorylation was inhibited. These results indicate that VP1 induces autophagy by the AKT-AMPK-MTOR pathway. Additionally, expression of VP3 and 3C was found to activate autophagy induction via the ERK1/2 MAPK-MTOR and p38 MAPK-MTOR pathway. Taken together, our data suggest that SVV-induced autophagy has finely tuned molecular mechanisms in which VP1, VP3, and 3C contribute synergistically to the AKT-AMPK-MAPK-MTOR pathway.

IMPORTANCE Autophagy is an essential cellular catabolic process to sustain normal physiological processes that are modulated by a variety of signaling pathways. Invading virus is a stimulus to induce autophagy that regulates viral replication. It has been demonstrated that Seneca Valley virus (SVV) induced autophagy via the PERK and ATF6 unfolded protein response pathways. However, the precise signaling pathway involved in autophagy is still poorly understood. In this study, our results demonstrated that viral proteins VP1, VP3, and 3C contribute synergistically to activation of the AKT-AMPK-MAPK-MTOR signaling pathway for SVV-induced autophagy. These findings reveal systemically the finely tuned molecular mechanism of SVV-induced autophagy, thereby facilitating deeper insight into the development of potential control strategies against SVV infection.

INTRODUCTION

Seneca Valley virus (SVV), a member of the genus Senecavirus in the family Picornaviridae, is a nonenveloped, positive-stranded RNA virus with a genome length of approximately 7.3 kb (1, 2). The SVV genome contains a 5′-untranslated region (UTR), a single open reading frame (ORF) encoding a large polyprotein, and a polyadenylated 3′-UTR. During infection, the polyprotein is proteolytically processed into four structural proteins (VP4-VP2-VP3-VP1) and eight nonstructural proteins (Lpro-2A-2B-2C-3A-3B-3C-3D) (2). Infection with SVV poses a serious threat to the world pork industry, and no vaccine is available to control the disease (3, 4). SVV is a type of oncolytic virus that infects and lyses tumor cells. Targeting host autophagy has potential value in antitumor therapies in the future (5). However, as an emerging disease in the swine industry, limited detailed studies have reported the mechanisms of viral replication and autophagy induction. Many viral replications have been demonstrated to involve induction of autophagy (6), and our previous study revealed that SVV could activate autophagy via the PERK and ATF6 unfolded protein response (UPR) pathways, which facilitate viral replication (7). However, the precise regulation of signaling pathways related to autophagy during SVV infection remains elusive.

Autophagy is an important cellular catabolic process that sustains cellular homeostasis and degrades long-lived proteins and damaged organelles in lysosomes (8–10). It is induced by multiple stress stimuli, such as nutrient starvation, hypoxia, and pathogen infection (11–13). The mechanistic target of rapamycin (MTOR) is a major negative regulator of autophagy in mammalian cells, and multiple signals are incorporated into the MTOR pathway (11, 14–18). The MTOR pathway has been shown to be closely correlated with virus-induced autophagy; recent studies showed that inhibition of the MTOR pathway by infection of various viruses, such as classical swine fever virus (CSFV), peste des petits ruminant virus, foot-and-mouth disease virus (FMDV), and porcine circovirus type 2 (PCV2), can affect virus-induced autophagic reaction (19–24). The serine threonine kinase AKT regulates a series of cellular processes, such as cell survival, cell cycle progression, glucose transport, and autophagy (11, 25). Inhibition of AKT activation enhances autophagy (12, 26), whereas AKT activation suppresses the induction of autophagy (27). AMP-activated protein kinase (AMPK) regulates autophagy by inhibiting MTOR (15, 28). AMPK phosphorylation of the MTOR binding partner raptor is necessary for the suppression of the MTOR pathway (29). MAPK/ERK (mitogen-activated protein kinase) pathways are important regulators in eukaryotic cells; AMPK and MAPK are involved in the formation of autophagosomes (30, 31). Prior studies have demonstrated that PCV2-mediated autophagy occurs via the AMPK-MAPK-MTOR pathway (19). Similarly, a recent study showed that CSFV-induced autophagy is related to the AMPK-MAPK-MTOR pathway (24). The p38 MAPK pathway belongs to one of the MAPK subfamilies (32) and can be activated by diverse stimuli, such as pathogenic infection and inflammatory cytokines (33). p38 MAPK has a double role with both positive and negative regulation in autophagy (34). Initiation of autophagy is regulated by the ULK1 (unc-51 like autophagy activating kinase 1) complex, which includes ULK1, ATG13, ATG101, and RB1CC1/FIP200 (35, 36). The ULK1 complex plays a crucial role in integrating MTOR and AMPK signals and transduces them to the downstream autophagic signaling pathway (35, 37).

The conversion of microtubule-associated protein 1 light chain 3 (LC3) to LC3-II and degradation of SQSTM1/p62 (sequestosome 1) have been used to monitor autophagic flux (38, 39). The conversion of LC3-I to LC3-II is induced by the Picornaviridae family infections, such as encephalomyocarditis virus (EMCV) (40, 41), FMDV (21), coxsackievirus (42), SVV (7, 43), and poliovirus (44). VP1 of EMCV and SVV colocalized with LC3 (7, 40, 41). FMDV VP2 increases LC3-II levels (21). Coxsackievirus and poliovirus infection induced SQSTM1/p62 degradation and cleavage (44, 45), and coxsackievirus 2A was responsible for the cleavage. Our previous study demonstrated that SQSTM1/p62 is degraded after SVV infection (7).

To date, a large number of studies have demonstrated that viruses regulate autophagy by utilizing the AKT-AMPK-MAPK-MTOR signaling pathways, but the specific mechanisms may vary with virus types (19–24). In this study, we investigated the signaling pathways involved in SVV-induced autophagy. The results revealed that SVV induced autophagy through the AKT-AMPK-MAPK-MTOR signaling pathways in host cells, and SVV infection inhibited MTOR by activating the AKT, AMPK, ERK1/2 MAPK, and p38 MAPK pathways to induce autophagy. Further study demonstrated that SVV VP1 interacted with SQSTM1/p62 and upregulated the level of LC3-II; further, expression of VP1 increased the levels of p-AKT and p-AMPK but downregulated the level of p-MTOR, activating the AKT-AMPK-MTOR pathway. In addition, VP3 and 3C activated the ERK1/2 MAPK-MTOR and p38 MAPK-MTOR pathway for induction of autophagy. These results suggest the synergetic contributions of VP1, VP3, and 3C to the activation of the AKT-AMPK-MAPK-MTOR pathway during SVV-induced autophagy.

RESULTS

SVV infection inactivates MTOR pathway and activates AKT phosphorylation.

We previously reported that SVV infection activated autophagy via the PERK and ATF6 UPR pathways (7). To further investigate the upstream pathways involved in the regulation of autophagy by SVV infection, the AKT/MTOR pathway was first determined in BHK-21 cells and PK-15 cells. The results indicated that the levels of MTOR and phosphorylation of MTOR were significantly reduced (Fig. 1A to D), suggesting that the MTOR signaling pathway is inactivated during SVV infection. In addition, the levels of mTOR downstream targets, P70-S6K, 4E-BP1, p-P70-S6K, and p-4E-BP1, were significantly decreased (Fig. 1A and C). The level of p-AKT phosphorylation significantly increased along with LC3-II expression at 9 h postinfection (hpi), suggesting that the AKT pathway is activated during SVV infection (Fig. 1A to D). LC3-II is a marker of autophagy, and the level of LC3-II rapidly increases at 3 hpi until 24 hpi and decreases in p-MTOR and SQSTM1/p62 after SVV infection (Fig. 1A to D), suggesting that the MTOR signaling pathway is related to SVV-induced autophagy. We found two cleavage bands of SQSTM1/p62 after SVV infection, as observed for a previous study (43). Expression of VP1 protein in SVV-infected host cells significantly increased along with LC3-II (Fig. 1A to D). Together, these results indicated that SVV induced autophagy by inactivating the MTOR pathway and activating the AKT pathway.

FIG 1.

Activation of AKT and suppression of MTOR in SVV-induced autophagy. (A and C) BHK-21 cells (A) and PK-15 cells (C) were infected with SVV (multiplicity of infection [MOI], 5). The cells were collected at 0, 3, 6, 9, 12, and 24 hpi and then subjected to immunoblotting to analyze the levels of AKT, p-AKT, MTOR, p-MTOR, P70-S6K, p-P70-S6K, 4E-BP1, p-4E-BP1, SQSTM1/p62, LC3B, SVV-VP1, and ACTB as an internal control. (B and D) The ratios to ACTB from three independent experiments depicted in panels A and C are shown (*, P < 0.05; **, P < 0.01; ***, P < 0.001; ns, not significant). ImageJ was used to quantify the level of protein.

AKT-MTOR pathway was involved in SVV-induced autophagy.

The AKT-MTOR pathway is a crucial piece of regulatory machinery in virus-induced autophagy that has recently been reported (17, 19–24, 37). Therefore, we evaluated the role of the AKT-MTOR pathway after SVV infection with relevant inhibitors and inducers to illustrate the relationship between the AKT-MTOR pathway and SVV-induced autophagy. The levels of p-MTOR, p-P70-S6K, and p-4E-BP1 were significantly decreased in rapamycin-treated cells (Fig. 2A, lanes 1 and 2 and lanes 5 and 6), and the levels of p-MTOR, p-P70-S6K, p-4E-BP1, and SQSTM1/p62 in the rapamycin-treated SVV-infected cells was reduced more than that in the rapamycin-treated cells or SVV-infected cells alone (Fig. 2A, lanes 2 to 4 and 6 to 8). In addition to the decrease in p-MTOR, p-P70-S6K, and p-4E-BP1 in rapamycin-treated and SVV-infected cells, the level of LC3-II in rapamycin-treated SVV-infected cells was more evident than that in SVV-infected cells or rapamycin-treated cells alone (Fig. 2A, lanes 2 to 4 and 6 to 8). The level of p-AKT in rapamycin-treated SVV-infected PK-15 cells was more evident than that in SVV-infected PK-15 cells or rapamycin-treated PK-15 cells alone (Fig. 2A, lanes 6, 7, and 8). The level of p-AKT in rapamycin-treated SVV-infected BHK-21 cells was lower than that in SVV-infected BHK-21 cells or rapamycin-treated BHK-21 cells alone (Fig. 2A, lanes 6, 7, and 8). Therefore, we hypothesized that SVV had much higher viral titers in rapamycin-treated BHK-21 cells, which reduced the level of p-AKT such that the level of p-AKT decreased at 24 hpi (Fig. 1A). The VP1 expression levels of SVV-infected cells and virus titers were significantly increased after rapamycin treatment (Fig. 2A, lanes 3 and 4 and lanes 7 and 8; also see Fig. 7B).

FIG 2.

SVV induced autophagy via AKT phosphorylation and MTOR dephosphorylation. (A to C) BHK-21 cells and PK-15 cells were pretreated with rapamycin (50 nM), wortmannin (1 μM), and LY294002 (10 μM) or DMSO for 1 h. After SVV (MOI, 5) adsorption for 1 h, BHK-21 cells and PK-15 cells were overlaid with new medium containing rapamycin (50 nM), wortmannin (1 μM), and LY294002 (10 μM) or DMSO. The samples were harvested at 12 hpi and then subjected to immunoblotting to analyze the levels of AKT, p-AKT, MTOR, p-MTOR, P70-S6K, p-P70-S6K, 4E-BP1, p-4E-BP1, SQSTM1/p62, LC3B, SVV-VP1, and ACTB as an internal control. The ratios to ACTB from three independent experiments (A to C) are shown (*, P < 0.05; **, P < 0.01; ***, P < 0.001; ns, not significant). Image J was used to quantify the level of protein. (D and E) BHK-21 cells (D) and PK-15 cells (E) were pretreated with insulin (200 ng/ml) or DMSO for 1 h, respectively. After SVV (MOI, 5) adsorption for 1 h, the cells were overlaid with new medium containing insulin (200 ng/ml), and the cells were harvested at 3 hpi or 12 hpi and then subjected to immunoblotting to analyze the levels of AKT, p-AKT, MTOR, p-MTOR, SQSTM1/p62, LC3B, SVV-VP1, and ACTB as an internal control. The ratios to ACTB from three independent experiments are shown (*, P < 0.05; **, P < 0.01; ***, P < 0.001; ns, not significant). ImageJ was used to quantify the level of protein.

FIG 7.

Inhibition of autophagy reduced SVV replication. (A) The viability of BHK 21 cells and PK-15 cells was tested using Cell Counting kit 8 assay after treatment with DMSO, rapamycin (50 nM), ULK-101 (5 μM), LYN1604 (2 μM), compound C (10 μM), AICAR (10 mM), LY294002 (10 μM), wortmannin (1 μM), U0126 (10 μM), SB203580 (10 μM), CA-5f (10 μM), DC661 (1 μM), pepstatin A (10 μM), brefeldin A (2 μM), and insulin (200 ng/ml) for 12 h. The error bars stand for standard deviation (SD) from three independent experiments (ns, not significant). (B) BHK-21 cells and PK-15 cells were pretreated with chemical reagents and infected with SVV. The viruses were titrated with the TCID₅₀ assay at 12 hpi. Data are represented by the mean ± standard deviation (SD) from three independent experiments (*, P < 0.05; **, P < 0.01; ***, P < 0.001; ns, not significant).

Furthermore, wortmannin, LY294002, and insulin were used to analyze the influence of the AKT pathway on SVV-induced autophagy. Both wortmannin and LY294002 treatment decreased the level of AKT phosphorylation (Fig. 2B and C, lanes 1 and 2 and lanes 5 and 6). The levels of p-AKT, p-MTOR, p-P70-S6K, p-4E-BP1, and SQSTM1/p62 in the wortmannin- or LY294002-treated SVV-infected cells were reduced more than those in wortmannin- or LY294002-treated cells or SVV-infected cells alone (Fig. 2A, lanes 3, 2, and 4, lanes 7, 6, and 8). The levels of LC3-II in wortmannin- or LY294002-treated SVV-infected cells were more evident than those in wortmannin- or LY294002-treated cells or SVV-infected cells alone (Fig. 2B and C, lanes 2 to 4 and lanes 6 to 8). Moreover, the levels of VP1 and virus titer were significantly increased after wortmannin and LY294002 treatment (Fig. 2B and C, lanes 3 and 4 and lanes 7 and 8; also see Fig. 7B). Insulin is an inducer of AKT phosphorylation, and the levels of AKT, P70-S6K, and 4E-BP1 phosphorylation in insulin-treated cells were more evident than those in mock-treated cells (Fig. 2D and E, lanes 1 and 2 and lanes 5 and 6). The level of LC3-II in insulin-treated cells was lower than that in mock-treated cells (Fig. 2D and E, lanes 1 and 2 and lanes 5 and 6), and the level of LC3-II in insulin-treated SVV-infected cells was lower than that in SVV-infected cells alone (Fig. 2D and E, lanes 3 and 4 and lanes 7 and 8). Furthermore, VP1 and virus titers were significantly decreased after insulin treatment (Fig. 2D and E, lanes 7 and 8; also see Fig. 7B). This indicates that AKT phosphorylation is a negative regulator of SVV-induced autophagy. These results showed that the inhibition of the MTOR pathway and activation of AKT phosphorylation were associated with SVV-mediated autophagy and dramatically affected SVV replication.

AMPK is the upstream regulator of MTOR in SVV-induced autophagy.

Previous studies have revealed that activation of the AMPK signaling pathway is associated with autophagy (19, 21, 24, 37, 46). In this study, there was a gradually increasing trend of p-AMPK in SVV-infected cells from 0 to 24 hpi (Fig. 3A to D), suggesting that the AMPK signaling pathway is activated during SVV infection. Next, we used the AMPK inhibitor compound C and AMPK inducer AICAR to assess the effects of the AMPK pathway on SVV-induced autophagy. The results showed that AMPK phosphorylation was inhibited in compound C-treated cells and compound C-treated SVV-infected cells (Fig. 3E, lanes 1 to 3 and lanes 5 to 7), suggesting an inhibitory effect of compound C. Levels of p-MTOR increased slightly after treatment with compound C (Fig. 3E, lanes 1 and 2 and lanes 5 and 6), and downregulation of p-MTOR was reduced in SVV-infected cells in the presence of compound C (Fig. 3E, lanes 3 and 4 and lanes 7 and 8). LC3-II levels in compound C-treated cells were higher than those in mock-treated cells (Fig. 3E, lanes 1 and 2, lanes 5 and 6), and the level of LC3-II in compound C-treated SVV-infected cells was not significantly different from that in compound C-treated cells alone (Fig. 3E, lanes 3 and 4 and lanes 7 and 8). The levels of SQSTM1/p62 slightly increased after compound C treatment (Fig. 3E, lanes 3 and 4). In the presence of compound C, the level of VP1 and virus titers of SVV in the infected cells (Fig. 3E, lanes 3 and 4 and lanes 7 and 8; also see Fig. 7B) were significantly reduced.

FIG 3.

Activation of AMPK-MTOR induced autophagy. (A and C) BHK-21 cells (A) and PK-15 cells (C) were infected with SVV (MOI, 5). The cells were harvested at 0, 3, 6, 9, 12, and 24 hpi and then subjected to immunoblotting to analyze the levels of AMPKα, p-AMPK, SVV-VP1, and ACTB as an internal control. The level of AMPKα and p-AMPK against ACTB was quantified using ImageJ in BHK-21 and PK-15, respectively. Data are represented by the mean ± standard deviation (SD) from three independent experiments (*, P < 0.05; **, P < 0.01; ***, P < 0.001; ns, not significant). (B and D) The ratios to ACTB from three independent experiments depicted in panels A and C are shown (*, P < 0.05; **, P < 0.01; ***, P < 0.001; ns, not significant). ImageJ was used to quantify the level of protein. (E and F) BHK-21 cells and PK-15 cells were pretreated with compound C (10 μM) (E), AICAR (10 mM) (F), or DMSO for 1 h. After SVV (MOI, 5) adsorption for 1 h, the cells were overlaid with new medium containing compound C (10 μM) (E), AICAR (10 mM) (F) or DMSO. The samples were harvested at 12 hpi and then subjected to immunoblotting to analyze the levels of AMPKα, p-AMPK, SQSTM1/p62, LC3B, SVV-VP1, and ACTB as an internal control. The ratios to ACTB from three independent experiments (E and F) are shown (*, P < 0.05; **, P < 0.01; ***, P < 0.001; NS, not significant). Image J was used to quantify the level of protein.

In contrast, AMPK phosphorylation was activated in AICAR-treated cells, and the level of p-AMPK in SVV-infected cells with AICAR treatment was more evident than that in AICAR-treated cells alone and SVV-infected cells alone (Fig. 3F, lanes 2 to 4). The phosphorylation of MTOR was slightly decreased by AMPK activation in SVV-infected cells (Fig. 3F, lanes 3 and 4 and lanes 7 and 8). The levels of LC3-II were elevated and SQSTM1/p62 levels decreased after AICAR treatment (Fig. 3F, lanes 3 and 4 and lanes 7 and 8). The levels of VP1 and virus titer were significantly increased after treatment with AICAR (Fig. 3F, lanes 3 and 4 and lanes 7 and 8; also see Fig. 7B). These results demonstrate that activation of the AMPK pathway is closely related to SVV-induced autophagy, and AMPK phosphorylation facilitates MTOR dephosphorylation.

SVV-induced autophagy caused by activating the ERK1/2 MAPK and p38 MAPK pathways.

Several studies have demonstrated that the ERK1/2 and p38 MAPK pathways regulate autophagy (19, 24). We then investigated the activation of the ERK1/2 and p38 MAPK pathways after SVV infection. The levels of p-ERK1/2 and p-p38 MAPK were enhanced in SVV-infected cells (Fig. 4A to D), suggesting that the ERK1/2 MAPK and p38 MAPK signaling pathways were activated during SVV infection. Similarly, the inhibitors U0126 for ERK1/2 MAPK and SB205580 for p38 MAPK were used to test whether the two signaling pathways were associated with SVV-induced autophagy. As shown in Fig. 4E, p-MTOR, p-AKT, and SQSTM1/p62 were increased after inhibition of MAPK activation (Fig. 4E, lanes 1 and 2 and lanes 5 and 6), and the levels of p-ERK1/2 MAPK and LC3-II were significantly decreased (Fig. 4E, lanes 1 and 2 and lanes 5 and 6). After infection with SVV, the levels of p-MTOR, p-ERK1/2 MAPK, and SQSTM1/p62 were slightly recovered, while that of LC3-II significantly decreased (Fig. 4E, lanes 3 and 4 and lanes 7 and 8). These data indicate that ERK1/2 MAPK is an upstream regulator of MTOR in SVV-induced autophagy. The levels of VP1 and virus titers were significantly decreased after treatment with U0126 (Fig. 4E, lanes 3 and 4 and lanes 7 and 8; also see Fig. 7B). These results demonstrate that SVV-induced autophagy is related to the MTOR-ERK1/2 MAPK pathway. SARS-CoV-2 infection activates the p38 MAPK signaling pathway, and virus production is decreased when treated with SB203580 (47). As shown in Fig. 4F, p-MTOR and SQSTM1/p62 were increased after treatment with SB205580 (Fig. 4F, lanes 1 and 2 and lanes 5 and 6), and the levels of p-p38 MAPK and p-AKT were significantly decreased (Fig. 4E, lanes 7 and 8). After SVV infection, the levels of p-MTOR and SQSTM1/p62 recovered slightly (Fig. 4E, lanes 3 and 4 and lanes 7 and 8). The levels of VP1 and virus titers of SVV-infected cells were significantly decreased after treatment with SB205580 (Fig. 4F, lanes 3 and 4 and lanes 7 and 8; also see Fig. 7B). These results show that p-p38 MAPK is an upstream regulator of MTOR in SVV-induced autophagy. Taken together, these data demonstrate that SVV-induced autophagy is related to the ERK1/2 MAPK and p38 MAPK-MTOR pathways.

FIG 4.

Activation of MAPK-MTOR induced autophagy. (A and C) BHK-21 (A) and PK-15 (C) cells were infected with SVV (MOI, 5). The cells were harvested at 0, 3, 6, 9, 12, and 24 hpi and then subjected to immunoblotting to analyze the levels of MAPK (ERK1/2), p-MAPK (ERK1/2), p38 MAPK, p-p38 MAPK, SVV-VP1, and ACTB as an internal control. (B and D) The ratios to ACTB from three independent experiments depicted in panels A and C are shown (*, P < 0.05; **, P < 0.01; ***, P < 0.001; ns, not significant). ImageJ was used to quantify the level of protein. (E and F) BHK-21 cells and PK-15 cells were pretreated with U0126 (10 μM) (E), SB205580 (10 μM) (F), or DMSO for 1 h. After SVV (MOI, 5) adsorption for 1 h, the cells were overlaid with new medium containing U0126 (10 μM) (E), SB205580 (10 μM) (F), or DMSO. The samples were harvested at 12 hpi and then subjected to immunoblotting to analyze the levels of MAPK (ERK1/2), p-MAPK (ERK1/2), p38 MAPK, p-p38 MAPK, SQSTM1/p62, LC3B, SVV-VP1, and ACTB as an internal control. The ratios to ACTB from three independent experiments (E and F) are shown (*, P < 0.05; **, P < 0.01; ***, P < 0.001; ns, not significant). Image J was used to quantify the level of protein.

SVV-induced autophagy is independent of ULK1 complex.

Initiation of autophagy is regulated by the ULK1 protein kinase complex by activating phosphorylation of ULK1 kinases (48). ULK1 is phosphorylated by AMPK and MTOR in the regulation of autophagy (37, 46). Therefore, we wanted to determine whether SVV-induced autophagy is influenced by ULK1. The results showed that phosphorylation of ULK1 and ULK decreased during SVV infection (Fig. 5A to D), suggesting that the ULK1 signaling pathway is inhibited during SVV infection. ULK-101 is a selective inhibitor of ULK1 and LYN-1604, an inducer of ULK1. We chose two regulators to determine the role of ULK1 in SVV-induced autophagy. ULK-101 treatment reduced the level of p-ULK1 and enhanced the level of SQSTM1 in SVV-infected cells compared to SVV-infected cells without treatment (Fig. 5E, lanes 3 and 4 and lanes 7 and 8), suggesting that ULK-101 inhibits ULK-mediated autophagy. LYN-1604 treatment increased the levels of ULK and p-ULK but decreased the level of SQSTM1 in SVV-infected cells compared to SVV-infected cells alone (Fig. 5F, lanes 3 and 4 and lanes 7 and 8), suggesting that LYN-1604 could affect ULK-mediated autophagy. Activation of ULK1 or inhibition of ULK1, levels of VP1, and virus titers were not affected (Fig. 4F and 5E; also see Fig. 7B), suggesting that SVV replication was not affected by the ULK1 pathway. These data show that SVV-induced autophagy is independent of the ULK1 complex.

FIG 5.

SVV induced autophagy independent of the ULK1 complex. (A and C) BHK-21 (A) and PK-15 (C) cells were infected with SVV (MOI, 5). The cells were harvested at 0, 3, 6, 9, 12, and 24 hpi and then subjected to immunoblotting to analyze the levels of ULK1, p-ULK1, SVV-VP1, and ACTB as an internal control. (B and D) The ratios to ACTB from three independent experiments depicted in panels A and C are shown (**, P < 0.01; ***, P < 0.001; ns, not significant). (E and F) BHK-21 cells and PK-15 cells were pretreated with ULK-101 (5 μM) (C), LYN1604 (2 μM) (D), or DMSO for 1 h. After SVV (MOI, 5) adsorption for 1 h, the cells were overlaid with new medium containing ULK-101 (5 μM) (C), LYN1604 (2 μM) (D), or DMSO. The samples were harvested at 12 hpi and then subjected to immunoblotting to analyze the levels of ULK1, p-ULK1, SQSTM1/p62, LC3B, SVV-VP1, and ACTB as an internal control. The ratios to ACTB from three independent experiments of panels E and F are shown (*, P < 0.05; **, P < 0.01; ***, P < 0.001; NS, not significant). ImageJ was used to quantify the level of protein.

SVV-induced complete autophagy facilitated viral replication.

The degradation of SQSTM1/p62 by lysosomes and upregulation of LC3-II are crucial for the evaluation of autophagic flux or complete autophagy (38, 39). DC661 is a novel dimeric chloroquine (CQ) that can deacidify the lysosome, thereby inhibiting autophagy (49). CA-5f is a potent late-stage autophagy inhibitor that blocks the fusion of autophagosome-lysosome, which can induce LC3-II and SQSTM1 accumulation (50). Pepstatin A is a lysosomal degradation inhibitor that prevents LC3-II degradation. Brefeldin A inhibits not only canonical and noncanonical autophagy but also entry or egress of some viruses, suggesting that blockage of viral trafficking following entry or during egress after brefeldin A treatment is a consequence of junctions with both canonical and noncanonical autophagy pathways (51). We used four inhibitors to evaluate the SVV-induced autophagic flux. As shown in Fig. 6, after treatment with DC661, CA-5f, brefeldin A, and pepstatin A, there was a significant upregulation of LC3-II and SQSTM1/p62 compared to mock-infected cells (Fig. 6A to D, lanes 1 and 2 and lanes 5 and 6). The degradation of SQSTM1/p62 during SVV infection was significantly inhibited after treatment with DC661, CA-5f, brefeldin A, and pepstatin A (Fig. 6A to D, lanes 3 and 4 and lanes 7 and 8). Moreover, the level of VP1 and virus titers of SVV-infected cells were significantly decreased after treatment with DC661, CA-5f, and brefeldin A (Fig. 6A to C, lanes 3 and 4, lanes 7 and 8, and 7B). Collectively, these results revealed that SVV-induced complete autophagy promoted viral replication.

FIG 6.

SVV-induced complete autophagy is beneficial to viral replication. (A to D) BHK-21 cells and PK-15 cells were pretreated with CA-5f (10 μM) (A), DC661 (1 μM) (B), pepstatin A (10 μM) (C), brefeldin A (2 μM) (D), or DMSO for 1 h. After SVV (MOI, 5) adsorption for 1 h, the cells were overlaid with new medium containing CA-5f (10 μM) (A), DC661 (1 μM) (B), pepstatin A (10 μM) (C), brefeldin A (2 μM) (D), or DMSO. The samples were harvested at 12 hpi and then subjected to immunoblotting to analyze the levels of SQSTM1/p62, LC3B, SVV-VP1, and ACTB as an internal control. The ratios to ACTB from three independent experiments are shown (*, P < 0.05; **, P < 0.01; ***, P < 0.001; NS, not significant). ImageJ was used to quantify the level of protein.

Inhibition of autophagy reduced SVV replication.

Chemical reagents were used to assess the effects of autophagy on SVV replication, including rapamycin, LY294002, wortmannin, compound C, AICAR, U0126, SB203580, ULK-101, LYN1604, CA-5f, DC661, brefeldin A, pepstatin A, and insulin. First, the viability of BHK-21 cells and PK-15 cells treated with the chemical reagents was tested using Cell Counting kit 8 assay. The results indicated that the viability of cells treated with chemical reagents was not significantly affected (Fig. 7A). The viruses were titrated using a 50% tissue culture infectious dose (TCID₅₀) assay. The viral titer decreased after treatment with the autophagy inhibitors compound C, U0126, SB203580, CA-5f, DC661, brefeldin A, and insulin (Fig. 7B). The viral titer increased after treatment with the autophagy inducers rapamycin, AMPK inducer AICAR, p-AKT inhibitor LY294002, and wortmannin (Fig. 7B). These results indicate that SVV-induced autophagy enhances SVV replication.

Lpro, VP3, and VP1 interacted with SQSTM1/p62 and promoted its degradation.

To evaluate which viral protein could induce autophagy, green fluorescent protein (GFP)-tagged SVV protein-expressing plasmids were transfected into BHK-21 cells and stained with endogenous SQSTM1/p62, hemagglutinin (HA)-tagged SQSTM1/p62, and endogenous LC3-II (Fig. 8A to C). The results showed that GFP-tagged leader proteinase (Lpro), VP4, VP3, VP1, 3A, and 3D colocalized with endogenous SQSTM1/p62 (Fig. 8A). GFP-tagged Lpro, VP4, VP2, VP3, VP1, 3A, and 3D colocalized with HA-SQSTM1/p62 after cotransfection (Fig. 8B). Consistent with the results of confocal microscopy, Western blotting indicated that GFP-tagged Lpro, VP4, VP3, VP2, VP1, and 3A degraded HA-SQSTM1/p62 after cotransfection in BHK-21 cells (Fig. 8D and E). Lpro and VP4 might be the most critical proteins responsible for the degradation after cotransfection in vitro. In addition, we observed that 3C protease cleaved HA-SQSTM1/p62 (Fig. 8D, lane 11), which was consistent with SVV infection (Fig. 1A to C) and a previous study (43). As shown in Fig. 8C, GFP-tagged Lpro, VP2, VP3, VP1, 3A, and 3D colocalized with endogenous LC3B exhibited puncta distribution in the cytoplasm (Fig. 8C). Coimmunoprecipitation (co-IP) further verified the interaction between HA-SQSTM1/p62 and Lpro, VP3, VP1, and 2C in vitro (Fig. 8F). Overall, these results indicated that Lpro, VP3, and VP1 play major roles in the induction of autophagy, as demonstrated by their interaction with SQSTM1/p62 for its degradation, and other viral proteins play collaborative roles.

FIG 8.

Lpro and capsid proteins degraded SQSTM1/p62. (A) BHK-21 cells were transfected with GFP-tagged plasmids. The cells were stained with antibodies to SQSTM1/p62 and examined under confocal microscopy. (B) BHK-21 cells were cotransfected with GFP-tagged SVV protein-expressing plasmids and HA-SQSTM1/p62. The cells were stained with antibodies to HA and examined under confocal microscopy. (C) BHK-21 cells were transfected with GFP-tagged SVV protein-expressing plasmids. The cells were stained with antibodies to LC3B and examined under confocal microscopy. (D) BHK-21 cells were cotransfected with GFP-tagged SVV protein-expressing plasmids and HA-SQSTM1/p62. At 24 h posttransfection, the cell lysates were prepared and then subjected to immunoblotting to analyze the levels of GFP, HA, and ACTB as an internal control. (E) The ratios to ACTB from three independent experiments of panel D are shown (***, P < 0.001; NS, not significant). Image J was used to quantify the level of protein. (F) BHK-21 cells were cotransfected with GFP-tagged SVV protein-expressing plasmids and HA-SQSTM1/p62. At 24 h posttransfection, cell lysates were prepared for co-IP analysis with antibodies to GFP, HA, and ACTB as an internal control.

VP1, VP3, and 3C synergistically activated the AKT-AMPK-MAPK-MTOR pathway to induce autophagy.

We used UV-inactivated SVVs to evaluate viral infection-induced autophagy. As shown in Fig. 9A, the levels of phosphorylated AKT, ULK, AMPK, ERK1/2, p38 MAPK, and MTOR were not significantly changed after UV-inactivated SVV infection, and the levels of SQSTM1/p62 and LC3-II were not influenced by UV-inactivated SVV infection (Fig. 9A, lanes 1 to 3, and B). We also analyzed the levels of p-MTOR, p-AKT, p-ULK, p-AMPK, p-ERK1/2 MAPK, and p-p38 MAPK in transfected cells by immunoblotting to determine which proteins regulate the signaling pathways involved in SVV-mediated autophagy. The levels of LC3-II and SQSTM1/p62 in transfected cells were used to evaluate the activation of autophagy. As shown in Fig. 9C, an increase in LC3-II and a decrease in SQSTM1/p62 were detected in VP1-transfected BHK-21 cells (Fig. 9C, lane 7, and D), which was consistent with the degradation of HA-SQSTM1/p62 after cotransfection with GFP-VP1 plasmid (Fig. 8D and E, lanes 7). In combination with the results of degradation in vitro and in vivo (Fig. 8D and E and 9C, lane 7) and interaction in vitro (Fig. 8F), VP1 might be a major regulator inducing autophagy. GFP-tagged SVV protein-expressing plasmids were transfected into BHK-21 cells to further evaluate which viral protein(s) contributed to the AKT-AMPK-MAPK-MTOR pathway for SVV-induced autophagy. As shown in Fig. 9, the expression of VP1 increased the levels of p-AKT and p-AMPK and decreased the level of p-MTOR, and VP1 induced the highest levels of p-AKT among the viral proteins (Fig. 9C, lane 7, and D). The expression of VP3 and 3C protease enhanced the levels of p-ERK1/2 MAPK and p-p38 MAPK and reduced the level of p-MTOR, and 3C has a principal role, as evidenced by the extent of p-MTOR degradation (Fig. 9C, lane 11, and D). Taken together, these data indicate that VP1 activates the AKT-AMPK-MTOR pathway and VP3 and 3C activate the ERK1/2 MAPK-p38-MAPK-MTOR pathway to synergistically involve the AKT-AMPK-MAPK-MTOR pathway for SVV-induced autophagy.

FIG 9.

VP1, VP3, and 3C synergistically activated the AKT-MTOR-AMPK-MAPK pathway to induce autophagy. (A) BHK-21 cells were infected with SVV or UV-inactivated SVV (MOI, 5) for 12 h. Cell lysates were prepared and analyzed by immunoblotting with antibodies against MTOR, p-MTOR, AKT, p-AKT, ULK1, p-ULK1, AMPK, p-AMPK, MAPK (ERK1/2), p-MAPK (ERK1/2), p38 MAPK, p-p38 MAPK, SQSTM1/p62, LC3B, and ACTB as an internal control. (B) The ratios to ACTB from three independent experiments depicted in panel A are shown. (***, P < 0.001; ns, not significant). ImageJ was used to quantify the level of protein. (C) BHK-21 cells were transfected with GFP-tagged SVV protein-expressing plasmids. At 24 h after transfection, the cell lysates were prepared and analyzed by immunoblotting with antibodies against p-MTOR, p-AKT, p-AMPK, p-MAPK (ERK1/2), p-p38 MAPK, SQSTM1/p62, LC3B, and ACTB as an internal control. (D) The ratios to ACTB from three independent experiments depicted in panel C are shown (*, P < 0.05; **, P < 0.01; ***, P < 0.001; ns, not significant). ImageJ was used to quantify the level of proteins.

DISCUSSION

Many viruses employ the autophagic machinery to favor viral infection. In recent years, increasing research has revealed that members of the family Picornaviridae, including FMDV (21), EMCV (40, 41), enterovirus 71 (EV71) (52), coxsackievirus (42, 53), and poliovirus (44), utilize an autophagic mechanism to promote viral replication. Our previous study revealed that SVV infection activates autophagy via the PERK and ATF6 unfolded protein response pathways and facilitates viral replication (7). Further exploration of the signaling pathways involved in SVV-induced autophagy is necessary to understand the regulatory mechanism of virus replication and design novel antiviral strategies. In this study, we comprehensively investigated the signaling pathways involved in SVV-induced autophagy.

MTOR is a critical autophagy regulator that integrates a multitude of signals, such as AMPK and MAPK, and transduces them to the downstream pathway (35). First, we examined the MTOR pathway in BHK-21 cells and PK-15 cells after SVV infection and found that MTOR, P70-S6K, and 4E-BP1 phosphorylation were significantly inhibited, accompanied by a significant accumulation in LC3-II and degradation of SQSTM1/p62 (Fig. 1). In addition, the AKT-MTOR, AMPK-MTOR, ERK1/2 MAPK-MTOR, and p38 MAPK-MTOR pathways were activated after SVV infection. However, the levels of ULK1 complexes were significantly reduced. Previous studies have demonstrated that the PCV2 ORF5 protein triggers induction of autophagy to enhance viral replication through the AMPK-MAPK-MTOR signaling pathway (19, 54). ZIKV infection inhibits the AKT-MTOR signaling pathway to induce autophagy (55). Infectious bursal disease virus (IBDV) VP2 is a critical inducer of autophagy by the AKT-MTOR pathway (23). Coxsackievirus infection inhibits the AKT/MTOR signaling pathway and activates the MAPK pathway, and the expression of 2C and 3C proteins can induce autophagy (53). Recently, a study demonstrated that CSFV also activated autophagy via the AMPK-MAPK-MTOR pathway to promote viral replication, and NS5A of CSFV induced autophagy by the AMPK-MTOR pathway (24). In our study, we revealed that increased levels of p-AMPK in SVV-infected cells and AMPK were upstream regulators of SVV-induced autophagy. Additionally, treatment with compound C reduced the level of VP1 and virus titers, whereas treatment with AICAR increased the level of VP1 and virus titers (Fig. 3F, lanes 3, 4, 7, and 8, and 7B). AICAR also increases the replication of PCV2 (54). Our results showed that the phosphorylation of ERK1/2 MAPK increased after SVV infection (Fig. 4A to D), and MAPK was another upstream regulator of the MTOR pathway. Treatment with inhibitor U0126 significantly reduced the level of VP1 and virus titers (Fig. 4E, lanes 3, 4, 7, and 8, and 7B). EV71 infection induces activation of the AKT and MAPK pathways, and wortmannin treatment attenuated the levels of p-AKT and p-MAPK (52). Moreover, wortmannin enhanced the replication of porcine teschovirus 2 (PTV-2) and EMCV (56, 57). Similar to these picornaviruses, wortmannin and LY294002 treatment also reduced the levels of p-AKT (Fig. 2B and C) and enhanced the level of SVV VP1 and virus titers (Fig. 2B and C, lanes 3, 4, 7, and 8, and 7B). The ULK1 complex is another crucial regulator that receives signals and transmits them to the downstream autophagy pathway (35). Poliovirus and coxsackievirus infection-induced autophagy are independent of the ULK1 complex (42, 44). We used ULK1 inhibitor ULK-101 and ULK1 inducer LYN-1604 to assess the influence of ULK1 complexes on SVV-induced autophagy, and the results indicated that the replication of SVV was not affected (Fig. 5E and F and 7B). This indicates that the contribution of the ULK1 complex to SVV-induced autophagy is similar to that of poliovirus and coxsackievirus.

Previous studies demonstrated that SQSTM1/p62 is cleaved by coxsackievirus 2A protein during viral infection (45), and the cleaved fragments of SQSTM1/p62 displayed a dominant-negative effect against the role of native SQSTM1/p62 (58). SQSTM1/p62 is also cleaved during poliovirus infection (44). Similarly, a recent study demonstrated that SQSTM1/p62 targeted SVV VP1 to phagophores for degradation, and SVV 3C cleaved SQSTM1/p62 at glutamic acid 355, glutamine 392, and glutamine 395 (43). Here, we analyzed the relationship between SVV proteins and SQSTM1/p62 in more detail. We observed that Lpro, VP4, VP1, 3A, and 3D colocalized with endogenous SQSTM1/p62 under confocal microscopy (Fig. 8A), confirming the interaction between Lpro, VP3, VP1, 2C, and SQSTM1/p62 in the co-IP assay (Fig. 8F). Degradation of SQSTM1/p62 by VP1 protein was also observed in vivo and in vitro (Fig. 8D, lane 7, and 9C, lane 7). We identified the interaction between 2C and SQSTM1/p62 in the co-IP assay. The distribution of SVV 2C protein in the mitochondria (59), while SQSTM1/p62 was mainly localized in the cytoplasm, may have blocked the colocalization with SQSTM1/p62 and 2C. VP4, 3A, and 3D colocalized with SQSTM1/p62, but we did not identify the interaction, and the interaction possibly was not direct. As a papain-like proteinase, Lpro can cleave itself (2). We found that Lpro interacted with SQSTM1/p62 and GFP-Lpro colocalized with SQSTM1/p62. In addition, we found that SVV 3C cleaved SQSTM1/p62 in vitro (Fig. 8D).

FMDV 3A protein and LC3 colocalized and exhibited a punctate distribution pattern (60), and poliovirus 3A protein colocalized with GFP-LC3 (61). VP1, VP3, VP4, 2B, 2C, 3A, and 3D proteins of EMCV colocalized with GFP-LC3 exhibited a number of positive puncta (40). VP1 and 3A colocalized with LC3 presented a subset of LC3-positive punctate cells after EMCV infection (41). The EMCV 3D protein is involved in autophagy, which enhances the level of LC3B-II and downregulates SQSTM1/p62 (40). Here, our data demonstrated that VP1, 3A, and 3D of SVV colocalized with endogenous LC3B (Fig. 8C). SVV 3D protein enhanced the level of LC3B-II and downregulated endogenous SQSTM1/p62 (Fig. 9C, lane 12). This indicates that SVV-induced autophagy has a mechanism similar to that of EMCV.

FMDV VP2 inhibits the phosphorylation of MTOR to induce autophagy (21). The expression of PCV2 Cap increases AMPK phosphorylation (56). CSFV NS5A induces autophagy by activating the AMPK-MTOR pathway; NS5A expression increases AMPK phosphorylation and decreases MTOR phosphorylation (24). We found that SVV VP1 expression increased phosphorylation of AKT and AMPK and reduced phosphorylation of MTOR (Fig. 9C and D) and that VP1 could induce autophagy via the AKT-AMPK-MTOR pathway in transfected BHK-21 cells. In addition, SVV VP3 and 3C activated the ERK1/2 MAPK/p38 MAPK-MTOR pathway and the expression of SVV VP3, and 3C increased phosphorylation of ERK1/2 MAPK and p38 MAPK and decreased the phosphorylation of MTOR. Both VP3 and 3C activated the ERK1/2 and p38 MAPK pathways. This indicated that more than one viral protein could activate these signaling pathways to induce autophagy, and some of them worked together to regulate autophagy-related signaling pathways that are involved in viral replication.

We used a series of chemical reagents to assess the effect of autophagy on SVV replication using the TCID₅₀ assay (Fig. 7B). The results showed that SVV-induced autophagy facilitated viral replication, which is consistent with our previous studies (7). Autophagy induction with rapamycin enhanced the replication of SVV, while inhibition of autophagy with chloroquine and 3-methyladenine dampened SVV replication (7, 43). Compound C treatment inhibited the AMPK pathway and the replication of SVV, while AICAR activated the AMPK pathway and enhanced the replication of SVV. The results were similar to those observed in CSFV- and PCV2-infected cells (19, 24, 54). Wortmannin enhances the replication of EMCV (57). Similarly, wortmannin and LY294002 increased SVV replication. Inhibition of the ERK1/2 MAPK pathway and the p38 MAPK pathway significantly inhibited the replication of CSFV, PCV2, and SARS-CoV-2 (19, 47, 54), which agreed with results from SVV-infected cells. However, it is unclear which step of the SVV life cycle is promoted by autophagy. An alternative explanation would be that the inhibitors of MTOR promote the switch from the cap-dependent translation of cellular mRNAs to internal ribosomal entry site (IRES)-mediated translation of SVV by inducing dephosphorylation and activation of the repressor of cap-dependent translation, 4E-BP1. In contrast, phosphorylation and inactivation of 4E-BP1 in insulin-treated cells should inhibit SVV IRES activity by increasing competition from cellular mRNAs. Modulation of EMCV and poliovirus infection efficiencies by the availability of active eIF4E was previously demonstrated (62). In addition, the ULK1 pathway was not related to SVV replication after treatment with ULK-101 and LYN-1604, as observed for other members of the Picornaviridae family (42, 44).

In summary, the present study demonstrated that SVV infection induced autophagy by suppressing MTOR phosphorylation and activating the AKT-AMPK-ERK1/2 MAPK-p38 MAPK pathway (Fig. 10). VP1 induced autophagy, as evidenced by the degradation of SQSTM1/p62 and increased levels of LC3-II via the AKT-AMPK-MTOR pathway. Both VP3 and 3C activated the ERK1/2 MAPK and p38 MAPK pathways to induce autophagy. These findings provide a better understanding of SVV pathogenesis, as demonstrated by the synergetic contributions of VP1, VP3, and 3C to the AKT-AMPK-MAPK-MTOR pathway for virus-induced autophagy, thereby leading to deeper insight into the development of potential control strategies against SVV infection.

FIG 10.

Proposed model of SVV-mediated autophagy. SVV infection induces the activation of AKT, AMPK, ERK1/2 MAPK, and p38 MAPK and suppresses MTOR signaling, thereby inducing autophagy in host cells. The expression of VP1 increased the level of phosphorylated AKT and AMPK and decreased the level of phosphorylated MTOR, and VP1 activated the AKT-AMPK-MTOR pathway to induce autophagy. VP3 and 3C enhanced the phosphorylation of ERK1/2 MAPK and p38 MAPK and decreased the phosphorylation of MTOR.

MATERIALS AND METHODS

Cells, viruses, and antibodies.

BHK-21 cells and PK-15 cells were cultured in Dulbecco’s modified Eagle’s medium (Invitrogen, CA, USA) supplemented with 10% inactivated fetal bovine serum (Invitrogen) in an incubator containing 5% CO₂ at 37°C. The SVV strain (CHhb17) and an anti-SVV-VP1 monoclonal antibody were prepared in our laboratory and used in this study, as described previously (7). UV-inactivated SVV was kept in a cell dish under a UV lamp for 30 min, and the viability of UV-SVV was tested in BHK-21 and PK-15 cells. The following antibodies were used: MTOR (517464; Santa Cruz), p-MTOR (5536; Ser2448; Cell Signaling Technology), AKT (4685; Cell Signaling Technology), p-AKT (4085; Ser473; Cell Signaling Technology), AMPKα (Cell Signaling Technology), p-AMPK (2535; Thr172; Cell Signaling Technology), MAPK (4695; ERK1/2; Cell Signaling Technology), p-MAPK (9101; ERK1/2; Thr202/Tyr204; Cell Signaling Technology), p38 MAPK (9212; Cell Signaling Technology), p-p38 MAPK (9211; Thr180/Tyr182; Cell Signaling Technology), ULK1 (8504; Cell Signaling Technology), p-ULK1 (14202; Ser757; Cell Signaling Technology), P70-S6K (AF0258; Beyotime Technology), p-P70-S6K (AF5899; Thr389; Beyotime Technology), 4E-BP1 (AF5159; Beyotime Technology), p-4E-BP1 (AF5806; Thr37/46; Beyotime Technology), β-actin (A1978; Sigma-Aldrich), LC3B (L7543; Sigma-Aldrich), SQSTM1/p62 (ab56416; Abcam), HA (H3663; Sigma-Aldrich), HA (3724; Cell Signaling Technology), green fluorescent protein (GFP) (50430-2-AP; Proteintech), Alexa-Fluor-568 goat anti-rabbit secondary antibody (A-11011; Invitrogen), Alexa-Fluor-568 goat anti-mouse secondary antibody (A-11004; Invitrogen), goat anti-rabbit horseradish peroxidase-conjugated IgG (ab205718; Abcam), and goat anti-mouse horseradish peroxidase-conjugated IgG (ab205719; Abcam).

Chemical reagents.

Rapamycin (S1039; Selleck), LY294002 (9901; Cell Signaling Technology), wortmannin (9951; Cell Signaling Technology), compound C (S7840; Selleck), AICAR (S1802; Selleck), U0126 (9903; Cell Signaling Technology), SB203580 (5633; Cell Signaling Technology), CA-5f (S5920; Selleck), ULK-101 (S8793; Selleck), LYN-1604 (S8597; Selleck), DC661 (S8808; Selleck), pepstatin (S7381; Selleck), brefeldin A (S7046; Selleck), and insulin (S6955; Selleck) were used. The chemical reagents were dissolved in dimethyl sulfoxide (DMSO) according to the manufacturers’ recommendations.

Viral infection and cell treatment.

BHK-21 cells and PK-15 cells were grown to 80% confluence in well plates and pretreated with rapamycin (50 nM), compound C (10 μM), AICAR (10 mM), LY294002 (10 μM), wortmannin (1 μM), U0126 (10 μM), SB203580 (10 μM), ULK-101 (5 μM), LYN1604 (2 μM), CA-5f (10 μM), DC661 (1 μM), pepstatin A (10 μM), brefeldin A (2 μM), or insulin (200 ng/ml) for 1 h. The pretreated cells were then infected with SVV for 1 h. The cells were then washed with phosphate-buffered saline (PBS) and incubated with new medium containing the same chemical reagents. Cell viability in the presence of chemical reagents was tested using Cell Counting kit 8 (Abcam, ab228554) in accordance with the manufacturer’s instructions.

Plasmid construction.

The genes coding for the proteins were cloned from the SVV strain (CHhb17) and inserted into pEGFP-C1 (U55763; Clontech) using a one-step cloning kit (C112; Vazyme). The SQSTM1/p62 (GenBank accession number XM_005071858) gene from BHK-21 cells was amplified using the HiScript II one-step reverse transcription-PCR kit (P611; Vazyme) and recombined into pCMV-HA (631604; Clontech). The primers used are listed in Table 1.

TABLE 1.

Primers used in this study

Primera	Sequenceb (5′–3′)	Restriction site
GFP-Lpro-F	TCGAGCTCAAGCTTCGAATTCTATGCAGAACTCTCATTTTTCTTT	EcoRI
GFP-Lpro-R	TTATCTAGATCCGGTGGATCCTTACTGCAGCTCGTATACGATGTCC	BamHI
GFP-VP4-F	TCGAGCTCAAGCTTCGAATTCTGGTAATGTTCAGACAACCTCA	EcoRI
GFP-VP4-R	TTATCTAGATCCGGTGGATCCTTATTTGAGGTAGCCAAGAGGGTT	BamHI
GFP-VP2-F	TCGAGCTCAAGCTTCGAATTCTGATCACAATACCGAAGAAATG	EcoRI
GFP-VP2-R	TTATCTAGATCCGGTGGATCCTTACTGTTCCTCGTCCGTCCCGGT	BamHI
GFP-VP3-F	TCGAGCTCAAGCTTCGAATTCTGGGCCCATTCCCACAGCACCCAGAGAAA	EcoRI
GFP-VP3-R	TTATCTAGATCCGGTGGATCCTTAGTGGAACACGTAGGAAGGATTA	BamHI
GFP-VP1-F	TCGAGCTCAAGCTTCGAATTCTTCCACCGACAACGCCGAGACTGGTGTTA	EcoRI
GFP-VP1-R	TTATCTAGATCCGGTGGATCCTTATTGCATCAGCATCTTTTGCTT	BamHI
GFP-2B-F	TCGAGCTCAAGCTTCGAATTCTGGCCCTGCTTCTGACAACCCA	EcoRI
GFP-2B-R	TTATCTAGATCCGGTGGATCCTTATTGCATCTTGAACAGCTTTCG	BamHI
GFP-2C-F	TCGAGCTCAAGCTTCGAATTCTGGACCCATGGATACAGTCAAAG	EcoRI
GFP-2C-R	TTATCTAGATCCGGTGGATCCTTACTGTAGAACCAGAGTCTGCATATT	BamHI
GFP-3A-F	TCGAGCTCAAGCTTCGAATTCTAGCCCTAACGAGAACGACGACAC	EcoRI
GFP-3A-R	TTATCTAGATCCGGTGGATCCTTACTCGCTCCTAGGCGCTTTAGCA	BamHI
GFP-3C-F	TCGAGCTCAAGCTTCGAATTCTCAGCCCAACGTGGACATGGGCT	EcoRI
GFP-3C-R	TATCTAGATCCGGTGGATCCTTATTGCATTGTAGCCAGAGGCTCA	BamHI
GFP-3D-F	TCGAGCTCAAGCTTCGAATTCTGGACTAATGACTGAGCTAGAGC	EcoRI
GFP-3D-R	TTATCTAGATCCGGTGGATCCTTAGTCGAACAAGGCCCTCCATCTT	BamHI
HA-SQSTM1/p62-F	TGGCCATGGAGGCCCGAATTCGGATGGCGTCCCTCACTGTGAAG	EcoRI
HA-SQSTM1/p62-R	GATCCCCGCGGCCGCGGTACCTCACAATGGCGGAGGGTGCTTTGAA	KpnI

^aF, forward PCR primer; R, reverse PCR primer.

^bRestriction sites are underlined.

Western blotting.

Harvested cells were washed with PBS and lysed using NP-40 buffer (50 mM Tris, 150 mM NaCl, 0.5% NP-40, and 0.5 mM EDTA) containing 1 mM phenylmethanesulfonyl fluoride (PMSF) (ST506; Beyotime) and 1 mg/ml protease inhibitor cocktail (p8340; Sigma) for 30 min at 4°C with rotation. The cell lysates were centrifuged at 14,000 × g for 15 min at 4°C. Twenty micrograms of each lysate extract was fractionated by SDS-PAGE and blotted onto nitrocellulose membranes (66485; Millipore) and then blocked with 5% nonfat milk for 1 h at room temperature (RT). The membranes were probed with primary antibody for 4 h at RT and then incubated with horseradish peroxidase-conjugated secondary antibodies for 1 h at RT. Immunoreactive bands were visualized using enhanced chemiluminescence (ECL) detection kits (34096; Thermo Scientific).

Co-IP.

At 24 h posttransfection, BHK-21 cells were lysed with NP-40 buffer (10 mM Tris, pH 7.5, 150 mM NaCl, 0.5% NP-40, and 0.5 mM EDTA) containing 1 mM PMSF (ST506; Beyotime) and 1 mg/ml protease inhibitor cocktail (p8340; Sigma) for 30 min at 4°C with rotation. After centrifugation at 14,000 × g for 15 min, the cell lysate clarified supernatants were incubated with anti-HA magnetic beads (88836; Thermo Fisher) overnight at 4°C with rotation. The HA magnetic beads were washed with NP-40 buffer. The precipitates were analyzed using Western blotting.

Immunofluorescence assays.

Cells were washed with PBS and fixed with 4% paraformaldehyde for 10 min at RT. The cells were washed again with PBS and permeabilized with 0.1% Triton X-100 in 2% bovine serum albumin (BSA) for 10 min at RT. After blocking with 2% BSA in PBS for 30 min at RT, primary antibodies were incubated for 1 h at RT and then incubated with secondary antibodies for 1 h at RT. 4′,6-Diamidino-2-phenylindole (DAPI) was also incubated with the cells for nucleus staining. Images were captured by a Nikon Al confocal microscope.

Statistical analysis.

Statistical analyses were conducted using GraphPad Prism version 5.0. Results are expressed as the mean ± standard deviation (SD). Statistical significance was analyzed using two-tailed unpaired Student's t test or one-way analysis of variance (ANOVA) for multiple comparisons.